Department of Microbiology and Molecular Genetics, University of Texas Health Science Center at Houston, Houston, Texas,1 Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts,2 Department of Microbiology, Cornell University, Ithaca, New York3
Received 16 June 2004/ Accepted 29 July 2004
| ABSTRACT |
|---|
|
|
|---|
610 different open reading frames, far fewer than the predicted number of 2,400, assuming random insertion. There was no significant preference in orientation of the Tn917 insertions with either transcription or replication. Even though OG1RF has a smaller genome than strain V583 (2.8 Mb versus 3.2 Mb), the only E. faecalis strain whose sequence is in the public domain, over 10% of the Tn917 insertions appear to be in a OG1RF-specific sequence, suggesting that there are significant genomic differences among E. faecalis strains. | INTRODUCTION |
|---|
|
|
|---|
In this study, we have attempted to construct an ordered transposon library of mutants for the human opportunistic pathogen Enterococcus faecalis, with the goal of obtaining an insertion in every nonessential ORF, analogous to a transposon library recently constructed for Pseudomonas aeruginosa (18). Transposon Tn917 insertion mutants were collected from E. faecalis strain OG1RF (25). Strain V583, the only strain with a publicly available sequence, was not selected, because unlike OG1RF, it has resistance to many antibiotics, including vancomycin, and therefore is difficult to genetically manipulate and poses a biohazard risk in the laboratory (33). OG1RF does not have these drawbacks and has been shown to successfully cause disease in a number of animal models. The replicative Tn3-like transposon Tn917 was chosen for the following reasons. First, it is the most commonly used gram-positive transposon and has been used successfully in Bacillus subtilis (43), E. faecalis (3), Staphylococcus aureus (4), and Streptococcus mutans (16) to construct stable insertion lines. Second, Tn917 is smaller and therefore easier to work with than Tn916 (5.2 kb versus 16 kb), and, unlike Tn916, it has not been shown to have a strong preference for intergenic regions (26). Third, although Tn4001 has successfully been used in Streptococcus pyogenes (22), pilot experiments with Tn4001 in E. faecalis indicated that it was prone to multiple insertions. Finally, and most importantly, several published reports that used a variety of gram-positive bacteria have purportedly shown that Tn917 insertion is sufficiently random to find mutations throughout the genome (3, 4, 16, 43). On the other hand, there have also been anecdotal reports that Tn917 does not insert randomly (see Discussion).
By sequencing a relatively large number of Tn917 insertions, we are able to report that Tn917 insertion in E. faecalis is far from random and is strongly biased towards the replication terminus. This study also generated interesting data with respect to whether Tn917 has a preferential target site and pinpointed significant differences between the OG1RF and V583 genomes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
To determine the location of the transposon in each mutant in the library, we sequenced the flanking DNA by amplifying the region via PCR with a primer specific to one end of the Tn917 transposon and an arbitrary primer with a constant region at the 5' end. In the second round of PCR, a specific primer, further nested, was used with a primer specific to the constant region of the arbitrary primer. The resulting product was sequenced by using a third nested primer specific to the transposon.
The details of this protocol are as follows. First, we replicated the library onto BHI agar plates with 50 µg of erythromycin/ml and then into liquid culture, all in a 96-well format. After overnight growth, 70 µl of the culture was heated to 99°C in a thermocycler for 10 min and then was spun down. Three microliters of the supernatant was added to a PCR mix containing 2.8 µl of 10x Taq buffer, 2.8 µl of dimethyl sulfoxide (DMSO), 1.4 µl of deoxynucleoside triphosphates (dNTPs) (5 mM) (Roche), 0.25 µl of Taq polymerase (Roche), 16.65 µl of sterilized, deionized water, and 0.55 µl of each of the following primers at a 50-ng/µl concentration: ARB1B, GGCCACGCGTCGACTAGTACNNNNNNNNNNGTAAT; and ODG29, GCAATAACCGTTACCTGTTTGTGC, which was specific to the left end of the transposon. The following cycling profile was used: 95°C for 5 min followed by 30 cycles of 95°C for 30 s, 42°C for 45 s, and 72°C for 1 min, followed by holding at 72°C for 5 min. The PCR was diluted 1:25 in sterile, deionized water, and 5 µl of the dilution was added to the second PCR, consisting of 2.5 µl of 10x Taq buffer, 2.5 µl of DMSO, 1.25 µl of dNTPs (5 mM) (Roche), 0.25 µl of Taq polymerase (Roche), 12.5 µl of sterile, deionized water, and 0.5 µl of the following primers at a 50-ng/µl concentration: ARB2, GGCCACGCGTCGACTAGTAC; and ODG30, GAAAACTGTACCACTAATAACTCACAATAGAGAGATGTC. The following cycling profile was used: 40 cycles of the 95°C for 30 s, 45°C for 30 s, and 72°C for 1 min, followed by 72°C for 5 min. Five microliters of the reaction product was added to 2 µl of ExoSAP-IT (USB), incubated at 37°C for 15 min, and then incubated at 80°C for 15 min to destroy the enzyme. The product was then sequenced using primer ODG31 (GATGTCACCGTCAAGTTAAATGTACAAAATAACAGCG).
A small pool of Tn917LTV3 insertion events was mapped from L. monocytogenes strain 10403S. The insertion pool was a kind gift from Helene Marquis (Cornell University, Ithaca, N.Y.) (2). Isolates from this pool were collected manually, and PCR was used to individually sequence these isolates according to the above-described protocol. The position of transposition events was determined by using the L. monocytogenes strain EGD-e genome sequence (14).
Determination of transposon-interrupted genes. The analysis of the E. faecalis transposon insertion mutant database was accomplished by using an automated bioinformatic pipeline developed for the Pseudomonas aeruginosa Transposon Insertion Mutant Library (http://ausubellab.mgh.harvard.edu/enterococcus). Sequences generated by the Massachusetts General Hospital core sequencing facility were imported as ABI files corresponding to 96-well microtiter plates. Base calling and sequence quality estimation was accomplished with PHRED (http://www.phrap.org). The transposon sequence was located in these raw sequences through the use of a Smith-Waterman algorithm. Using the PHRED quality scores as a guide, low-quality sequence was trimmed off the 5' and 3' ends. The processed sequences were blasted against the V583 genome and the insertions, and the interrupted genes were determined with a high degree of confidence in regions common to V583 and OG1RF.
Determination of preferred insertion site consensus sequence.
Base frequency matrices and log-likelihood position-specific scoring matrices (PSSMs, weight matrices) were generated by methods analogous to those described previously (5). Two in-house-developed tools were used. MakeMatrices.pl (http://ausubellab.mgh.harvard.edu/enterococcus/files/makeMatrices.pl) was used to compute raw matrices, positional
2 values, normalized matrices, and the normalized log-likelihood scoring matrices used in scoring matches to the Tn917 insert motif. Score Matrix.pl (http://ausubellab.mgh.harvard.edu/enterococcus/files/scoreMatrix.pl) was used for scoring matches to a matrix output by makeMatrices.pl.
PSSMs for the Tn917 insertion sequence were generated with two different sequence sets. For the purpose of identification of the chromosomal location of the insertion, flanking genomic sequence was obtained only from the left end of the transposon. Sequence quality was judged by the level of agreement between the known and the observed transposon sequence by using the Smith-Waterman algorithm. We obtained a PSSM for the left end by using 1,684 high-quality sequences for which the transposon sequence matched exactly. In order to characterize the right-end insertion consensus, we sequenced about 96 mutants from the right end of the transposon and obtained 74 right-end sequences that had three or fewer mismatches or gaps in the transposon sequence. In addition to allowing us to develop a PSSM specific to the right side of the transposon insertion, it verified that Tn917 inserts with a 5-base duplication.
In order to get additional information about the right side of the insertion site consensus, the V583 genome was used to retrieve sequences off the right end of the transposon, whereas only the left end had been sequenced. This was possible only in regions of the genome where there was perfect identity of the OG1RF transposon-flanking sequences with that of the V583 sequence. The consensus insertion sequence determined in this manner was found to agree closely with the consensus obtained when both sides were sequenced off the transposon.
To test whether or not the consensus sequence was symmetrical, we took the transposon insertion sequences, in both forward and reverse orientations, masked all but bases 3 through 7 (treating the middle base as position 0), and scored them against the original matrix. Sequences for which the reverse read scored higher than the forward read were reversed. The new sequence set containing some reversed sequences was then used to make a reoriented matrix. The reoriented matrix still showed signs of symmetry, suggesting that the consensus insertion site is at least partially symmetrical.
Determination of L. monocytogenes transposon-interrupted genes. To investigate Tn917 target site preference in L. monocytogenes, individual insertions were mapped by using arbitrary PCR in strain 10403S (see above). As with E. faecalis, nonduplicate sequence reactions that could definitively call the actual base pair of transposon insertion were used to determine sequences flanking the point of insertion based on the sequenced genome (n = 12). The L. monocytogenes insertion sequences were aligned and compared with those determined for E. faecalis.
| RESULTS |
|---|
|
|
|---|
Of the 8,865 sequences we obtained, 2,628 of the sequences were found to be too short and/or of too poor quality to determine their origin. The remaining 6,237 were analyzed by comparison with the V583 genome database (www.tigr.org), using BLAST to determine the genomic location of each transposon insertion event (see Materials and Methods). Of these, 4,889 mutant sequences resulted in BLASTN alignments with the V583 genome having bit scores above a threshold of 60. There was a significant number of mutants that shared the same insertion location. Of the 4,889 good-quality mutants, 1,923 were unique but 2,869 had apparent siblings, and 97 could not be precisely located. These 2,869 nonunique mutants, representing 676 distinct positions, could have resulted from transposition events that were sequenced twice because of cell division following transposition. Alternatively, they could represent independent insertions. We did find 93 examples of mutants with insertions into the same base pair that could not be siblings, because they inserted in opposite directions. In total, transposition events were identified in 540 different genes that are also found in E. faecalis strain V583. This set of 540 mutants is available as an ordered library set from the Ausubel laboratory (http://ausubellab.mgh.harvard.edu/enterococcus). A description of the sequences that did not match our threshold is discussed later.
We estimate that the library of 540 mutants corresponds to 23% of the nonessential E. faecalis genes based on the following assumptions. The size of the chromosome of the sequenced strain of E. faecalis, V583, is 3.2 Mb and contains about 3,200 genes (28). Because OG1RF has a smaller genome of 2.8 Mb, we assumed that it has approximately 2,800 genes (24). Based on the number of nonessential genes in Escherichia coli (87%) (44), we calculated that there are approximately 2,400 nonessential genes in OG1RF.
Tn917 inserts preferentially at the chromosome terminus. Assuming colinearity between the E. faecalis OG1RF and V583 genomes, we mapped the OG1RF Tn917 insertion events onto the V583 genome to identify any regional preferences, i.e., hot spots. There are several potential biases in our analysis. We cannot completely rule out the possibility that the sequences that did not amplify well and were discarded from our analysis were in particular regions of the chromosome. Double insertions in a large subset of our mutants could confuse our analysis, but by performing southern hybridization on a small subset of mutants we found that less than 5% contained double insertions (data not shown). Another potential bias is possible siblings, which we avoided by counting only once the mutants with insertions into the same base. As shown in Fig. 1, most of the mutants (65%) had insertions corresponding to a position in the V583 genome between 1.45 and 1.65 Mb, with the highest number of insertions occurring between 1.55 and 1.56 Mb (23%) (Fig. 1). This region corresponds to the terminus of the chromosome; it is directly opposite the gene encoding the DnaA protein, indicative of the origin of DNA replication. We performed G+C skew analysis with the V583 genome to identify the terminus, and as shown in Fig. 2, the region where the skew switches from positive to negative is between 1.55 and 1.56 Mb (Fig. 2). A cumulative skew analysis (15) pinpointed the location between 1.555 and 1.556 Mb (data not shown).
|
|
Tn917 has a slight preference for noncoding regions. We examined whether or not Tn917 has a preference for noncoding regions. Other transposons have been shown to have a strong preference for intergenic regions, which is potentially a survival strategy. For example, 90% of Tn916 insertions were found to be in noncoding regions (26). To not bias this analysis, we only chose a single representative sequence from a given genomic position when more than one mutant had an insertion in that position. In addition, we also only selected insertions that had a strong match to the V583 genome (bit score of greater than 200) to ensure that we would be able to easily determine whether or not the transposon was in an ORF or an intergenic region. Of the 2,522 sequences that matched the criteria, we found that 30% had insertions in intergenic regions. Only 13% of the E. faecalis chromosome is made up of intergenic space, suggesting that there is a preference for noncoding DNA, albeit not as dramatic a bias as that for Tn916.
Consensus sequence for Tn917 insertion site.
We examined the sequences flanking the transposon insertion sites for commonalities that would define a preferential insertion sequence. We included only sequences that were a perfect match to the V583 genome in the first 60 bp flanking the end of the transposon and included redundant insertions only once. We sequenced off the end of the transposon closest to the erythromycin resistance-encoding gene (erm), known as the erm-proximal end. After assigning the location, we used the V583 sequence database to predict the sequence on the erm-distal side of each transposon insertion. To assess these predictions, and also to confirm the presence of the 5-bp duplication that is a hallmark of Tn917 transposition (29), we sequenced the flanking regions on the erm-distal side of about 100 insertions. When we compared these sequences to our virtual sequences we did not find any significant differences (data not shown). Therefore, using the erm-proximal end sequence and erm-distal end virtual sequence, the frequency of A, T, G, and C at each position was tabulated to create a base frequency matrix. The matrix was normalized to reflect differences in nucleotide occurrence frequencies in the E. faecalis genome (a low-G+C gram-positive bacterium), and a log-likelihood PSSM was generated. The
2 test was used to determine the statistical significance of deviations from the expected frequency of occurrence of each nucleotide at each position. Based on this analysis, a 29-bp motif was identified, characterized by a central A/T-rich region that consists of the residues that make up the 5-bp duplication. Flanking this central sequence is a preference for G/A residues on the erm-proximal side (right side in Fig. 3) and C/T residues on the erm-distal side (left side in Fig. 3). In particular, a guanine is strongly favored at position 3 and a cytidine is strongly favored at position 3. The 29-bp sequence appears somewhat symmetric, suggesting that the insertion site is palindromic. However, an alignment of randomly oriented sequences could artificially produce a seemingly palindromic insertion site. Following a previously published method (5), we reoriented the sequenced insertion sites so that the sides that best match bases 3 through 7 of the palindrome were on the same side. This corresponds to the region of the insertion site that directly abuts the duplication. In contrast to what was previously observed with Tn3 (5), such an analysis resulted in an insertion sequence that was nearly identical to the original, strongly suggesting that the palindromy is not artifactual (data not shown).
|
|
Tn917 insertion preferences in L. monocytogenes. To determine if Tn917's strong bias for the terminus also occurs in a different low-G+C gram-positive species, we used arbitrary PCR to map a small collection of Tn917 insertions in the chromosome of L. monocytogenes strain 10403S (n = 24) (2). A survey of the literature reveals anecdotal accounts of favored hot spots for Tn917 transposition (see Discussion). We used the publicly available DNA sequence from strain EGD-e (14) to determine the location of insertions in 10403S, as was done for E. faecalis. All but one of the sequences used as insertion sites in strain 10403S matched the EGD-e genome; sequencing revealed that one apparent transposon insertion resulted from integration of the entire delivery vector or reversion of its temperature-sensitive origin of DNA replication. Both L. monocytogenes strains EGD-e and 10403S are of the same serotype, but a genome size estimate has not been determined for 10403S. We found that the sequences did not cluster in the terminus; rather, they appeared to be scattered relatively evenly around the chromosome (Fig. 5). As with E. faecalis, some duplicate insertions were also identified (Fig. 5).
|
2 values were not significant due to our small sample size (data not shown). The L. monocytogenes sequences were scored against the E. faecalis matrix. The average log odds score for L. monocytogenes insertion site sequences was 1.59, compared to 2.59 for the average of the E. faecalis insertion site sequences (Material and Methods). By comparison, random sequences from the L. monocytogenes genome have an average log odds score of 1.96, suggesting that Tn917 prefers an insertion sequence in L. monocytogenes similar to that of E. faecalis. Also like E. faecalis, the transposon orientation did not seem to be strongly affected by the direction of replication (Fig. 5). Genomic differences between OG1RF and V583. Recall that of the 6,237 sequences that were of sufficient quality and length to merit further analysis, only 4,889 had matches to the V583 strain sequence by BLAST analysis (see Materials and Methods). We hypothesized that some of the Tn917 insertions, which occurred in DNA sequences that did not match the V583 sequence, might be vector sequences due to insertion of the entire shuttle vector into the chromosome, but in only a few mutants did we find significant homology to the delivery vector. Therefore, we examined these 1,348 sequences more closely.
We hypothesized that the 1,348 sequences that did not match the V583 genome might be bacterial genes contained in OG1RF but not the sequenced strain, V583. We compared these sequences against the National Center for Biotechnology Information (NCBI) microbial database and indeed found that many of these sequences were homologous to bacterial genes found in related species. We grouped overlapping non-V583 sequences by assembling them with PHRAP (8, 9) and in this way identified a total of 48 stretches of contiguous DNA sequence that could be assembled from overlapping transposon sequences (contigs). One-hundred twenty of the 1,348 sequences did not match the V583 genome and did not overlap with other sequences, but these singlet sequences had at least 100 bp of sequence adjacent to the transposon such that we could include them in our analysis. Twenty of the contigs and 58 of the singlets had homology to known bacterial genes in the GenBank bacterial database (gbbct) as judged by the BLAST algorithm, corresponding to approximately 69 different genes in total. No significant hits were identified for the remaining 18 contigs and 62 singlets. Ten of the sequences that matched other sequences found in the NCBI database were examined more closely by designing primers specific to the OG1RF sequence, generating labeled probes, and hybridizing against genomic DNA from Enterococcus spp. strains OG1RF, V583, FA2-2, E002, E006, and E007. As expected, all the probes hybridized to OG1RF but none hybridized to V583, confirming that these sequences are indeed present in strain OG1RF but not strain V583. Some of the sequences were found in FA2-2 (10), another commonly used laboratory strain of clinical origin, and in E006, a clinical isolate. None were present in E002, another clinical isolate, or in E007, which is an E. faecium clinical isolate (Table 1) (12).
|
| DISCUSSION |
|---|
|
|
|---|
The distribution of Tn917 insertions in E. faecalis prompted us to reexamine published accounts from previous mutant screens that utilized Tn917. Multiple examples exist in the literature where certain genes were found to be highly overrepresented in collections of Tn917 transposition events. The most notable is the finding of hot spots in the gltAB genes in B. subtilis, which are located near the replication terminus (35, 39, 43). However, when these genes were replaced with DNA from another strain of B. subtilis the bias became much weaker, suggesting that this hot spot did not solely result from its location near the terminus (39).
Our data show that both sequence and regional biases strongly affect the composition of collections of Tn917 insertions in E. faecalis. However, caution is warranted in extending this finding to bacteria other than E. faecalis. Any regional bias will need to be determined on a case-by-case basis given our results with L. monocytogenes. In the small collection of Tn917 insertions in L. monocytogenes we sequenced, there was no strong bias for transposition into any region of the chromosome. It is true, however, that a strong insertion bias for certain DNA sequences may still limit the use of Tn917 in many gram-positive organisms, and there is a need for the development of new tools for these medically and industrially important bacteria.
The hint of fairly significant genomic differences between OG1RF and V583 is perhaps not surprising, considering that a vast array of mobile genetic elements has been found to be characteristic of E. faecalis. It is worth noting, however, that OG1RF and V583 were also isolated under very different circumstances. V583 was isolated from a blood culture (33), while the parent of OG1RF, OG1, is thought to have been isolated from dental caries (27), very different environments that may require unique subsets of genes. Significant differences between strains have also been noted for E. coli (41), Helicobacter pylori (34), and S. aureus (11), while considerably less heterogeneity has been observed in Vibrio cholerae (7) and P. aeruginosa (42).
Tn917 is in the Tn3 transposon family, and its transposase shares 80% similarity to the Tn3 transposase (37). Previous work looked at the sequences at the site of Tn917 insertion and, as was the case with Tn3, identified a 5-bp duplication (29). We have confirmed this 5-bp duplication in our examination of about a hundred clones for which we obtained sequences from both sides of the insertion. Like Tn3, the preferred 5-bp target is AT rich, followed by a G or a C. But unlike Tn3, for which the target sequence was determined to be asymmetric, upon careful analysis the preferred insertion sequence for Tn917 is strongly palindromic. It was concluded in previous work on Tn3 that the primary sequence structure is necessary, but not sufficient, for the creation of a transposition hot spot and that primary sequence is not a factor in the creation of a cold spot. The authors hypothesized that some other factor, such as DNA secondary structure, might be involved. More recent work has shown that the deformability of certain sequences can be of prime importance for transposable elements from highly divergent organisms (21, 40). Molecular dissection of Tn10 target site selection has revealed that the ability of the transposase to alter a potential target sequence can be a critical component of target site selection (32). We have found that primary sequence cannot explain Tn917's penchant for the terminus region. There is no difference in the preferred sequence within the hot spot region compared to that used in the rest of the genome, and examination of the OG1RF sequence does not indicate that there are more preferred sequence positions in the terminus (data not shown). We hypothesize that there must be some aspect to the terminus that attracts transposon insertion by Tn917 in E. faecalis. We cannot formally rule out the possibility that Tn917 insertions are preferentially isolated in terminus regions because they are fitter; however, insertions outside the terminus region did not give any obvious growth disadvantage based on colony size (personal observation). It is very unlikely that the tight grouping of insertions to such a small area of the chromosome is driven by a lack of essential genes in this region, given that a relatively small number of genes are believed to be essential in the laboratory in other bacteria, such as E. coli and B. subtilis (13, 20).
What is it about the terminus that so strongly attracts Tn917 transposition events? Perhaps Tn917 is attracted to a certain accessory protein or DNA secondary structure associated with replication termination. Accessory-targeting proteins are sometimes element encoded, as in the case of Tn7, which uses the transposon-encoded protein TnsE to target the terminus region and other DNA replication-associated targets (30). However, in the case of Tn7, targeting is not as precise as it is in the case of Tn917 (31). Additionally, Tn917 does not have any obvious element-encoded accessory proteins that would suggest a targeting mechanism. This does not rule out the possibility that host-encoded accessory proteins are used to direct transposition events preferentially to the terminus region. It is clear that host-encoded accessory proteins are important for other transposable elements that show strong regional biases in transposition. For example, in yeast, Ty1 and Ty3 use transcription factors to target upstream of RNA polymerase III-transcribed genes (6, 19) and Ty5 uses SIR4 to target silent DNA (45).
Tn917 could target a replication termination apparatus in E. faecalis. In B. subtilis and E. coli, DNA replication forks are impeded by one-way terminators of DNA replication progression, called ter sites, through the use of a trans-acting protein called Tus or RTP (1). It has been previously shown that Tn7 preferentially targets the terminus region and that this process is altered, although it is not eliminated, in E. coli Tus cells (31). The transposable element IS903 also seems to have a bias for places where replication fork progression can be inhibited, but not necessarily in the terminus of DNA replication where opposing replication forks meet (38). When IS903 inserts into the chromosome it preferentially inserts into eight hot spot regions. While five of these hot spots are within 30 kb of ter sites, only one of the IS903 hot spots is in the terminus region where DNA replication forks likely meet. Unfortunately, a termination apparatus has not been identified in E. faecalis. We have looked but have been unable to find a Tus or RTP homolog and have not been able to find ter sequences. It is possible that E. faecalis uses an undefined mechanism of replication termination which could be a target for Tn917 transposition. It is also possible that E. faecalis completely lacks a mechanism, as replication termination is not an essential process, at least in laboratory grown bacteria.
Another phenomenon that occurs in the terminus region that could attract Tn917 transposition events is dif-mediated site-specific recombination. Site-specific recombination at dif allows the resolution of dimer chromosomes, which are formed via homologous recombination between sister chromosomes in circular bacterial chromosomes after DNA replication. In E. coli and in B. subtilis, tyrosine-recombinase proteins XerC/CodV and XerD/RipX resolve dimer chromosomes at a specific site in the terminus region called dif. We have identified a putative dif site in the terminus region centered at 1,565,836 based on homology to dif sites found in the chromosomes of E. coli and B. subtilis. The putative dif site is within 10,000 bp of the point where G-C/G+C shifts in the E. faecalis chromosome. XerC/CodV and XerD/RipX homologs exist in the E. faecalis V583 genome. Precedent for transposons targeting site-specific recombination systems exists. The Tn5053 family of transposons selectively directs transposition into the region of resolution used by site-specific serine recombinases when the transposons are located on plasmids (23). There are significant differences between the targeting found with Tn5053 elements and that with Tn917. One difference is that Tn5053 does not appear to target the dif region in E. coli; however, only two Tn5053 insertions were mapped in the E. coli chromosome (200 and 1,241 kb from dif) (23). A second difference between the Tn5053 and Tn917 insertion patterns concerns how close they occur to the point of resolution in the two systems. Tn5053 insertions are focused primarily over a few base pairs within the region of dimer resolution, while Tn917 insertions occur primarily over a region of many thousands of base pairs unequally distributed around the putative dif site identified in E. faecalis.
In addition to the above examples, many other structures or complexes could be imagined that might occur in the terminus region and provide an attractive target for Tn917. Whatever factor results in the frequent isolation of Tn917 insertion events in the terminus region of E. faecalis, this highly preferred target does not appear to exist in L. monocytogenes. Much remains unknown about the factors that contribute to the acquisition and integration of mobile DNA. It is intriguing that the regional bias for Tn917 seems so different between E. faecalis and L. monocytogenes. It will be interesting to learn if certain hosts have developed adaptations to direct mobile DNA to certain regions of the genome in an attempt to protect essential genes. Further research will be needed to determine if a host mechanism specific to E. faecalis mediates this process and how widespread this hypothetical system might be in bacteria.
| ACKNOWLEDGMENTS |
|---|
We thank Helene Marquis for providing us with the pool of L. monocytogenes Tn917 mutants.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |