Chlamydiaphage Chp2, a Skeleton in the {phi}X174 Closet: Scaffolding Protein and Procapsid Identification

Chlamydiaphage Chp2 is a member of the family Microviridae,of which bacteriophage ${phi}$ X174 is the type species. Although groupedin the same family, the relationship between the Microviridaecoliphages and the Chp2-like viruses, which infect obligateintracellular parasitic bacteria, is quite distant, with majordifferences in structural protein content and scaffolding proteindependence. To investigate the morphogenesis of Chp2, largeparticles were isolated from infected Chlamydophila abortusby equilibrium and rate zonal sedimentation. A monoclonal antibodythat recognizes only assembled viral coat proteins was usedin these detection assays. Thus, the detected particles representvirions and/or postcapsid formation assembly intermediates.Two distinct particle types were detected, differing in bothprotein and DNA content. Filled particles lacked VP3, the putativeinternal scaffolding protein, whereas empty particles containedthis protein. These results indicate that VP3 is a scaffoldingprotein and that the isolated VP3-containing particles mostlikely represent Chp2 procapsids.

INTRODUCTION

Top

Introduction

Although chlamydiae are widespread bacterial pathogens causinga wide range of illnesses, such as blindness, respiratory infections,and possibly coronary artery disease (23, 24, 26), detailedmolecular mechanisms of pathogenesis will remain obscure aslong as significant barriers hinder laboratory manipulation.One of these barriers is the lack of a stable gene transfersystem. In recent years, five chlamydiaphages belonging to thefamily Microviridae, of which the prototype is bacteriophage ${phi}$ X174, have been isolated (11, 14, 22, 25). The mechanisms andtechniques to package ${phi}$ X174 in vitro and in vivo are well defined(1, 12). Thus, the microviruses of chlamydiae have the potentialof becoming the basis of a genetic transfer system.

Critical to this goal is the identification of a chlamydiaphageprocapsid, the assembly intermediate into which DNA is packaged.Although the chlamydiaphages are within the same family as ${phi}$ X174,the relationship is distant. The family has a deep evolutionarydivide between the ${phi}$ X174-like phages (coliphages) that infectfree-living enterobacteria and the Chp-like phages infectingobligate intracellular parasites and mollicutes, such as thechlamydiae, Bdellovibrio bacteriovorus, and spiroplasma (3).The most striking differences are structural and morphogenetic(3, 5). Structurally, the ${phi}$ X174-like phages contain a large pentamericspike protein complex at each vertex of the T = 1 virion. Thesespikes and their requisite genes are not present in the Chp-likephages, which have elaborate viral coat protein protrusionson the three fold axes of symmetry not seen in the coliphages.Accordingly, structural differences have led to different morphogeneticrequirements vis-à-vis scaffolding proteins. The ${phi}$ X174-likephages utilize two scaffolding proteins during assembly: aninternal and external species, proteins B and D, respectively(10). While it is evident that the Chp-like phages do not encodean external scaffolding protein (3, 18), the exact identityor existence of the internal scaffolding protein remains obscure.

Amino acid sequence identity between the Chp-2-like VP3s andthe internal scaffolding proteins of the ${phi}$ X174-like viruses islow. However, key amino acids known to make contacts betweenthe ${phi}$ X174 internal scaffolding and coat proteins are conservedin Chp2-like particles (18). While VP3 is found in icosahedralparticles, it is unclear whether these particles are virionsor procapsids (the assembly intermediate into which DNA is packaged)or a mixture of the two. To define the assembly pathway of theChp2 virions, post-coat protein assembly particles were isolatedfrom Chp2-infected chlamydiae and characterized. Particles wereanalyzed for DNA and VP3 content, and the results indicatedthat VP3 is a scaffolding protein component of a putative procapsidspecies. The latter particle will be required for the developmentof a phage-based genetic transfer system for chlamydiae.

MATERIALS AND METHODS

Top

Materials and Methods

Purification and separation of Chp2 virions and procapsids. The Chp2-bearing strain of Chlamydophila abortus (strain MA)was propagated as previously described (8). Chp2-infected reticulatebodies were lysed by successive freezing and thawing. Cell debriswas removed by low-speed centrifugation, and the supernatantwas passed through 0.45- and 0.22-µm-pore filters. Virionsand other post-coat assembly structures were isolated by twodifferent protocols: pellet formation by rate zonal centrifugation(8) or equilibrium sedimentation in CsCl gradients (4). In thelatter technique, material within the 1.25- to 1.35-g/cm³ densityrange was extracted for further analyses. Material was resuspendedor dialyzed against the buffer used in the subsequent purification(4), layered over 5 to 30% sucrose gradients, and spun at 45,000rpm for 75 min in a Beckman SW50.1Ti rotor. Gradients were dividedinto 50 0.1-ml fractions for analysis. Purification and platingassays for bacteriophages ${phi}$ MH2K and ${phi}$ X174, used as S value markers,have been previously described (3, 9).

ELISA protocols, MAbs, and polyclonal antiserum. Enzyme-linked immunosorbent assay (ELISA) protocols and themonoclonal antibodies (MAbs) used in the assays have previouslybeen described (8). The VP3 gene of Chp2 was cloned into theexpression vector pRSETA as previously described (8). RecombinantVP3 expressed in Escherichia coli was purified from host proteinsby metal affinity chromatography using the six-histidine tagintroduced by the N-terminal fusion peptide as described bythe manufacturer (Invitrogen Life Technologies). Hyperimmuneantisera to purified recombinant VP3 were produced in Wistarrats. A primary immunization with 100 µg of VP3 was administeredsubcutaneously in complete Freund's adjuvant followed by fiveboosts (100 µg each) in incomplete Freund's adjuvant at10-day intervals.

The ELISA to detect Chp2 using MAb 40 was used to detect VP3in sucrose gradient fractions: briefly 3 µl of each gradientfraction was added to 100 µl of 0.05 M carbonate-bicarbonatebuffer and used to coat immunoassay trays overnight. VP3 wasdetected by the same protocol with polyclonal serum to VP3.Bound anti-VP3 antibodies were detected with an anti-rat-horseradishperoxidase conjugate (ISL, Paignton, United Kingdom) and tetramethylbenzidinesubstrate.

Estimation of Chp2 DNA in sucrose gradient fractions by quantitative PCR. The absolute number of Chp2 phage genomes in each sample wasdetermined by real-time, quantitative PCR on an ABI PRISM 7700sequence detection system (Applied Biosystems), using TaqManchemistry. Primer and probe sequences were designed within theChp2 VP2 gene: forward primer 1931F (¹⁹³¹CTGCGAAGCAAATTGCTAGAGAG¹⁹⁵³),reverse primer 2044R (²⁰⁴⁴AAGCTAACATAGGGTTAAGGCCAG²⁰²¹) andfluorescent, dual-labeled probe 1957T (car-boxyfluorescein-ATGGCTTTTCAGGAGCGCATGTCTAACA-carboxytetramethylrhodamine).Sucrose gradient fractions were diluted 100-fold in deionizedwater, and 5 µl was used in each PCR, which also containedthe primers, probe, and TaqMan Universal PCR mix (Applied Biosystems).Forty-cycle PCR was performed according to the manufacturer'sinstructions. A recombinant plasmid, comprising the entire Chp2genome cloned by its unique BamHI site into pUC18, was accuratelyquantified by A₂₆₀ measurement, and serial dilutions were usedas assay standards. All standard dilutions contained pBR322(100 µg/ml) to block adsorption of DNA to the polypropylenetubes.

EM. Gradient fractions were adsorbed onto Formvar-coated carbongrids for 2 min and then negatively stained with 0.75% phosphotungsticacid (pH 6.0) for 10 s and air dried. Electron microscopy (EM)grids were examined with a Hitachi H7000 transmission EM.

RESULTS AND DISCUSSION

Top

Results and Discussion

Biochemical characterization of particles with assembled capsids. Lysates of Chp2-infected C. abortus were generated and processedby two protocols described in Material and Methods and layeredonto 5 to 30% sucrose gradients. Duplicate gradients also containing10⁶ particles of ${phi}$ MH2K (90S) and ${phi}$ X174 (114S), used as S valuemarkers, were also analyzed to ensure that the presence of theother bacteriophages did not lead to false positives in subsequentELISA and quantitative PCR assays. Differences in the two purificationprotocols and the presence of other phages in the duplicategradients did not affect the results of the subsequent assaysand analyses.

After centrifugation, each gradient was divided into 50 0.1-mlfractions, which were assayed for the presence of the coat proteinVP1 and the hypothesized scaffolding protein VP3. The MAb tothe coat protein (MAb 40) only recognizes assembled coat protein(8). Thus, only virions and particles with assembled capsidswould be detected. Assembled Chp2 coat protein was detectedin fractions 3 to 7 and 12 to 17 (Fig. 1). Fraction 1 representsthe bottom of the gradient. However, VP3 was only associatedwith the material in the slower-sedimenting peak (Fig. 1). Svalues were estimated by determining the location of bacteriophages ${phi}$ X174 (114S) and ${phi}$ MH2K (90S) from the gradient in direct platingassays and were found in greatest concentration in fractions2 and 5, respectively (positions indicated in the figure). Thus,the faster-moving VP1-containing particles sediment at 90S,like mature ${phi}$ MH2K particles, and are likely to be Chp2 virions(see below). The VP3-containing particles were estimated tosediment at 55S.

View larger version (26K):
[in this window]
[in a new window]
FIG. 1. Sedimentation profile of gradient-purified Chp2-related particles. Each fraction was assayed by ELISA for the presence of capsid (VP1) with MAb 40 (triangles, solid line) and procapsids with polyclonal antiserum to recombinant VP3 (squares, dashed line). Quantitative PCR (Taqman) was used to identify virions by the presence of genomic DNA (histogram). OD, optical density.

By the classical definition (16), a scaffolding protein is foundin the viral procapsid, the empty assembly intermediate intowhich the genome is packaged, but not in the mature virion.To investigate further the particles detected by ELISAs, quantitativePCR assays were performed (Fig. 1, histogram). Whereas materialfrom the 90S peak yielded a clear signal, the 55S material wasnot associated with DNA above background levels, suggestingthe 55S particle represented the Chp2 procapsid.

Verification of particle identity by EM. The 90S and 55S particles were examined by EM (Fig. 2). Whilethe 55S particles were stain penetrated, the 90S particles werenot. Stain penetration usually indicates a hollow structure,one in which DNA does not inhibit the internal saturation ofthe particle, and/or a structure with pores, as is often thecase with viral procapsids, but not virions (2). Forty particlesfrom each fraction were measured on electron micrographs, andthe respective average diameters of the virion and procapsidwere found to be 20.0 ± 0.1 and 23.4 ± 0.3 nm,respectively. The ${phi}$ X174 procapsid-to-virion transition involvesa radial collapse of the maturing particle (6, 7, 19), ratherthan the expansion seen in many double-stranded DNA (dsDNA)viruses (15, 17, 21). The additional morphogenetic requirementof an external scaffolding protein during ${phi}$ X174 assembly hasgenerally been believed to be responsible for this morphogeneticeccentricity. The external scaffolding protein outwardly restrainscoat protein pentamers, thus preventing their contact in theprocapsid (2). While the N terminus of the ${phi}$ X174 internal scaffoldingprotein may self-associate across two fold axes of symmetry,N-terminal sequences are not required for procapsid morphogenesis(20). The results of the analyses presented here demonstratethat capsid collapse is a general property of Microviridae assemblyand is not solely the consequence of an external scaffoldingprotein, which the Chp2-like phages appear to lack.

View larger version (114K):
[in this window]
[in a new window]
FIG. 2. Negative-stain EM picture of particles. (Left panel) Fraction 5 (virion). (Right panel) Fraction 16 (putative procapsid).

Conclusions. Although the results of the analyses presented here do not directlydetermine an internal or external location for Vp3 within theprocapsid, several observations strongly argue for an internallocation. (i) The amino acid sequences of the Chp-2 like Vp3sare more closely related to the ${phi}$ X174-like internal scaffoldingproteins than the external scaffolding proteins. (ii) Key aminoacids known to make contacts between the ${phi}$ X174 internal scaffoldingand coat proteins are conserved in the Chp2-like Vp3 and coatproteins (18). (iii) An internal location better explains twoother observations about the particles described here and differencesfrom the well-characterized ${phi}$ X174-like phages (10, 13). First,the difference in values of sedimentation rates between theChp2 virion and procapsid is considerably larger than that observedfor ${phi}$ X174, 114S and 108S, respectively. The ${phi}$ X174 procapsid contains240 copies of the external scaffolding protein, which constitutesapproximately 30% of the particles' mass. Secondly, no assemblyintermediate corresponding to the ${phi}$ X174 provirion was detected.The ${phi}$ X174 provirion intermediate is found between the procapsidand virion in the assembly pathway as packaged particles thathave lost the internal scaffolding protein, due to DNA packaging,but retain the external scaffolding protein. Studies on themorphogenesis of the Chp2-like phages will be useful in understandingMicroviridae morphogenesis in the absence of an external scaffoldingprotein. The identity of both the early assembly intermediatesand the molecular details of procapsid morphogenesis remainto be determined. Be that as it may, the ability to isolateprocapsids is a critical step toward our longer-term aim ofdeveloping an in vitro packaging extract based on the chlamydiaphages.

ACKNOWLEDGMENTS

This research was supported by research grants from the WellcomeTrust 063882 (I.N.C.), NSF MCB0234976 (B.A.F.), and USDA-Hatchfunds to the University of Arizona.

FOOTNOTES

* Corresponding author. Mailing address: Department of Veterinary Sciences and Microbiology, Building 90, University of Arizona, Tucson, AZ 85721-0090. Phone: (502) 626-6634. Fax: (520) 621-6636. E-mail: bfane{at}u.arizona.edu.

REFERENCES

Top