Previous Article | Next Article 
Journal of Bacteriology, November 2004, p. 7593-7600, Vol. 186, No. 22
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.22.7593-7600.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Pyruvate Formate Lyase and Acetate Kinase Are Essential for Anaerobic Growth of Escherichia coli on Xylose
Adnan Hasona,
Youngnyun Kim,
F. G. Healy,
L. O. Ingram, and
K. T. Shanmugam*
Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida 32611
Received 21 May 2004/
Accepted 16 August 2004

ABSTRACT
During anaerobic growth of bacteria, organic intermediates of
metabolism, such as pyruvate or its derivatives, serve as electron
acceptors to maintain the overall redox balance. Under these
conditions, the ATP needed for cell growth is derived from substrate-level
phosphorylation. In
Escherichia coli, conversion of glucose
to pyruvate yields 2 net ATPs, while metabolism of a pentose,
such as xylose, to pyruvate only yields 0.67 net ATP per xylose
due to the need for one (each) ATP for xylose transport and
xylulose phosphorylation. During fermentative growth,
E. coli produces equimolar amounts of acetate and ethanol from two pyruvates,
and these reactions generate one additional ATP from two pyruvates
(one hexose equivalent) while still maintaining the overall
redox balance. Conversion of xylose to acetate and ethanol increases
the net ATP yield from 0.67 to 1.5 per xylose. An
E. coli pfl mutant lacking pyruvate formate lyase cannot convert pyruvate
to acetyl coenzyme A, the required precursor for acetate and
ethanol production, and could not produce this additional ATP.
E. coli pfl mutants failed to grow under anaerobic conditions
in xylose minimal medium without any negative effect on their
survival or aerobic growth. An
ackA mutant, lacking the ability
to generate ATP from acetyl phosphate, also failed to grow in
xylose minimal medium under anaerobic conditions, confirming
the need for the ATP produced by acetate kinase for anaerobic
growth on xylose. Since arabinose transport by AraE, the low-affinity,
high-capacity, arabinose/H
+ symport, conserves the ATP expended
in pentose transport by the ABC transporter, both
pfl and
ackA mutants grew anaerobically with arabinose. AraE-based xylose
transport, achieved after constitutively expressing
araE, also
supported the growth of the
pfl mutant in xylose minimal medium.
These results suggest that a net ATP yield of 0.67 per pentose
is only enough to provide for maintenance energy but not enough
to support growth of
E. coli in minimal medium. Thus, pyruvate
formate lyase and acetate kinase are essential for anaerobic
growth of
E. coli on xylose due to energetic constraints.

INTRODUCTION
All living systems generate the needed energy for cell maintenance
and growth by catalyzing a set of coupled oxidation-reduction
reactions. A critical component of these oxidation-reduction
reactions is the redox balance of the sum of all metabolic reactions.
With external input of an oxidant, such as dioxygen, the carbon
and energy source can be completely oxidized to carbon dioxide
with concomitant reduction of the terminal electron acceptor.
However, under strict anaerobic conditions and in the absence
of an external input of an oxidant, such as nitrate, metabolic
intermediates serve the role of oxidant to maintain the overall
redox balance. For many heterotrophic fermentative bacteria,
the primary oxidant is pyruvate or derivatives of pyruvate,
the terminal product of glycolysis. The redox state of total
carbon in all final end products produced by the anaerobic cell
should equal the redox state of the starting C compound, such
as glucose carbon. Because of this constraint, the amount of
energy available and ATP produced during anaerobic growth is
significantly smaller than during complete oxidation of glucose
to CO
2 and H
2O.
An anaerobic culture of a facultative bacterium like Escherichia coli is limited by ATP, and this is manifested by a lower growth rate and cell yield and higher glycolytic flux than those for an aerobic culture (9, 24, 31, 33). Under anaerobic conditions, the net yield of ATP per glucose is only 2 if pyruvate is reduced to lactate as in a homolactate-producing pfl mutant (37, 38). This yield can be increased by an additional ATP per glucose if two molecules of pyruvate are converted to one each of acetate and ethanol (24). The enzyme complex which starts this transformation of pyruvate to acetate and ethanol is pyruvate formate lyase, which metabolizes pyruvate to formate and acetyl coenzyme A (acetyl-CoA) (15). Thus, a bacterium that can convert glucose to acetate and ethanol will produce three net ATPs while still maintaining the overall redox balance of the carbon. In agreement with this possibility, both the ATP pool size and ATP/AMP ratio of a microaerobic (oxygen-limiting, less than 1 ppm) glucose minimal medium culture of a pfl mutant were reported to be about twofold lower than those for the wild type (38). Although this additional ATP produced at the acetate kinase step in fermentation of sugars is expected to provide a significant growth advantage (1), it has not been studied in detail. However, under severe ATP limitation, this difference in ATP yield may manifest itself more profoundly as a difference in growth rate and cell yield.
In E. coli, both transport and phosphorylation of glucose occur simultaneously at the expense of one ATP equivalent, phosphoenolpyruvate (26, 28). However, the cell expends two ATPs, one for transport (high-affinity ABC transporter) and the second for activation (phosphorylation) when xylose serves as the carbon source (19, 20). This need for two ATPs per internal production of one pentose phosphate reduces the net yield of ATP per xylose to 0.67 when lactate is the sole fermentation product (32). In glucose equivalents (6-carbon), the net ATP yield from xylose is 0.8 ATP, only 40% of the glucose-to-lactate fermentation value of 2.0 ATP. If the fermentation leads to acetate and ethanol, the net ATP yield from xylose will increase to 1.5 (1.8 ATP based on 6-carbon equivalent), a value close to the glucose-to-lactate yield of 2.0 but still less than the three ATPs for glucose to acetate and ethanol. This difference in the net ATP yield is expected to lower both the growth rate and the cell yield, as seen with ethanologenic E. coli (strain KO11 and E. coli B with plasmid pLOI297) growing in xylose medium compared to the values in glucose medium (specific growth rate of 0.19 h1 for xylose and 0.3 h1 for glucose [12]; Yglucose of 0.091 and Yxylose of 0.05 [g of dry-weight cells · g of sugar1] [17]).
During the construction of E. coli K-12 derivatives for the production of lactic acid, acetic acid, and pyruvic acid, the gene coding for pyruvate formate lyase was deleted (4, 5, 37). These and other pflB mutants required acetate for anaerobic growth, in agreement with previous observations (35). However, even with acetate supplementation, the pflB mutants failed to grow with xylose as a carbon source under anaerobic conditions. We have investigated the physiological basis for this anaerobic xylose-negative phenotype of the pflB mutant. Results presented here provide evidence that the inability of the pflB mutant to grow with xylose anaerobically is a consequence of insufficient net ATP yield from this pentose.

MATERIALS AND METHODS
Bacterial strains and growth conditions.
All bacterial cultures are derivatives of
E. coli K-12 unless
indicated otherwise and are listed in Table
1. Strain W3110
(ATCC 27325) was used as the wild type. Cultures were grown
in either rich medium (Luria-Bertani [LB]) or minimal salts
medium described previously (
18). For routine aerobic cultures
the sugar concentration in minimal medium was 0.3%, and for
anaerobic growth conditions the sugar concentration was increased
to 1%. Minimal medium was supplemented with sodium acetate (0.1%)
during anaerobic growth. Aerobic cultures were grown in 125-ml
Erlenmeyer flasks with 10 ml of medium at 200 RPM in a shaker.
Anaerobic cultures were grown in 13- by 100-mm screw-cap tubes
filled to the top with medium. For pH-controlled anaerobic fermentations,
250-ml cultures were grown at 37°C in a custom-made pH-stat
at a constant pH of 7.0 (adjusted with 2N KOH), as described
previously (
2). After inoculation, the medium was sparged with
argon for 10 min at a flow rate of about 100 ml per min. Argon
was maintained in the gas phase by continuous addition throughout
the experiment. Inoculum for fermentation experiments was grown
aerobically in the same medium until the culture reached the
mid- to late-exponential phase of growth. Immediately after
inoculation, the optical density (OD) of the culture at 420
nm was about 0.05 (Beckman DU640 spectrophotometer).
Construction of mutants.
Mutants with gene deletions were constructed using the methods
described by Datsenko and Wanner (
8) with appropriate gene-specific
primers flanking the region of the gene to be deleted. Construction
of a

(
focA-pflB) mutation with kanamycin resistance genes flanked
by FRT sequences was described previously (
37). The kanamycin
resistance gene and one of the FRT sequences from the deletion
strains constructed by this method were removed as described
by Datsenko and Wanner, using the yeast FLP recombinase (
8).
Mutations were transduced to appropriate backgrounds using phage
P1 as before (
27).
Construction of xylE plasmids.
Two xylE plasmids with different copy numbers and promoters were constructed. Plasmid pAH291 contains the xylE gene and 455 bp of upstream DNA from the translation start site in a high-copy-number plasmid, PCRII-TOPO (Invitrogen). In this plasmid, the xylE gene is expected to be expressed from the native promoter. The xylE gene with the upstream sequence was amplified by PCR using two primers, XylE3 (TCTGCATTACCGATCACCATCGT) and XylE2 (AATCCCGGGTGGACAGGAAGATTACAGCGT), and the product was cloned into plasmid vector PCRII-TOPO (Invitrogen), appropriately linearized. In plasmid pAH286, the xylE gene was expressed from a synthetic promoter, PCP6 (14). The xylE gene without the promoter was amplified by PCR using the primers XylE1 (TTAAAGAATTCTCTAGAGGAGAGGTCTTGAATGAATACCCAGT) and XylE2. The XylE1 primer at the 5' end contains in series restriction sites for EcoRI and XbaI and the sequence GGAG nine bases upstream of the "A" in the ATG for effective translation initiation. The XylE2 primer has an AvaI site at the 5' end. The PCR-amplified product was hydrolyzed by EcoRI and AvaI and cloned into the EcoRI-AvaI fragment from plasmid pBR322, resulting in plasmid pAH285. The PCP6 promoter DNA along with an erythromycin resistance gene was removed from plasmid pAH281 as an XbaI fragment and cloned into the XbaI site immediately upstream of the xylE gene in plasmid pAH285. In this plasmid, pAH286, the xylE gene is expressed from the synthetic promoter PCP6 (14). Both plasmids complemented an E. coli mutant with deletions in both xylE and xylFGH for growth in xylose minimal medium under aerobic conditions.
Analytical methods.
Cell density was determined as the OD at 420 nm after appropriate dilutions (Beckman DU640). Fermentation products and sugars were determined by high-pressure liquid chromatography, using HP 1090 (Hewlett-Packard) fitted with an Aminex HPX-87H column (Bio-Rad Laboratories). The mobile phase was 4 mM H2SO4 at 0.4 ml per min. Organic acids, sugars, and ethanol were detected by a filter photometric detector (210 nm) and/or a refractive index monitor, in series, as described previously (34).
For determination of xylulose kinase activity, cultures were grown in a pH-stat at pH 7.0 in minimal medium with both glucose and xylose (0.5% each) and sodium acetate (0.1%). Cells were harvested when the wild type utilized about 50% of the xylose from the medium as seen by base consumption and were collected by centrifugation at 4°C (5,000 x g; 10 min) and washed with 50 mM Tris-HCl buffer, pH 7.5. Cells were broken by passage through a French pressure cell (20,000 lb/in2). Broken-cell suspension was centrifuged at 30,000 x g for 30 min, and the supernatant was centrifuged again at 100,000 x g for 1 h. The clear supernatant was used in the assay. Xylulose kinase activity was determined as described previously (32) but with [
-32P]ATP. The concentration of cold ATP in the 20-µl reaction was 10 mM, and that of [
-32P]ATP was 10 µCi (3,000 Ci per mmol) (Perkin-Elmer, NEN). After the reaction was stopped with 20 mM EDTA, xylulose-dependent ATP hydrolysis was determined as described previously (29).
Quantitative real-time PCR experiments.
For determination of xylose-specific mRNA levels in the cell, cells were grown in minimal medium with glucose (0.5%) and xylose (0.5%) as carbon sources and sodium acetate (0.1%) at a constant pH of 7.0 in a pH-stat (adjusted with 2 N KOH) under an argon gas phase. Fresh aerobic cultures in mid- to late-exponential phase of growth were used to inoculate at an initial cell density of 0.1 OD at 420 nm (Beckman DU640 spectrophotometer). Cultures were maintained at 37°C until all the glucose was exhausted and the wild-type culture utilized at least 50% of the xylose in the medium. Total RNAs from the cells were isolated by using a modified hot-phenol procedure described previously (32). xylA- and xylF-specific mRNAs were reverse transcribed from 5 µg of total RNA by Superscript II reverse transcriptase (Invitrogen), using primers XylA2 (AGGCTGCTGCCACGGACGATT) and XylF2 (CCGAGAGATTCTGCCTTTTTCAC), respectively. The xylA cDNA was amplified using the primers XylA1 (CAAACCCGTTAGCATTCCGTCA) and XylA2. The expected product was 161 bp long, extending from +68 to +228 from the translation start site (A in the ATG) for the xylA gene. The primers used for amplifying the xylF gene were XylF1 (GAACATTCTACTCACCCTTTGC) and XylF2. These two primers amplified a fragment of 153 bp between +12 and +164 from the translation start site of xylF. The xylA or xylF cDNA was amplified by using the primers in a master mix containing SYBR green (Bio-Rad Laboratories), using iCycler (Bio-Rad Laboratories). DNA containing xylA or xylF served as the standard for quantitation of the amount of xylA- or xylF-specific cDNA/mRNA in the RNA sample.

RESULTS AND DISCUSSION
The pflB mutant is defective for anaerobic growth in xylose minimal medium.
E. coli wild-type strain W3110 grew in minimal medium with either
glucose or xylose as the sole C source under anaerobic conditions
(with pH control) with growth rates of 0.35 and 0.2 h
1,
respectively. An isogenic

(
focA-pflB) derivative, strain SE2358,
grew in glucose minimal medium supplemented with acetate under
anaerobic conditions with a growth rate of 0.3 h
1 but
failed to grow with xylose as the C source, although xylose
supported growth of the mutant under aerobic conditions. This
inability of the
pfl mutant to grow with xylose under anaerobic
conditions was independent of the growth temperature and control
of the medium at pH 7.0. Strain SE1900, an
E. coli K-12 derivative
with a point mutation in the
pflB gene, also did not grow with
xylose as a sole C source under anaerobic conditions. Strain
SE2273, a
pflB derivative of
E. coli B, also failed to grow
in xylose minimal medium under anaerobic conditions. These results
show that the
pflB gene is essential for growth of
E. coli with
xylose in the absence of oxygen.
Since the pflB mutant did not grow in xylose minimal medium, it was difficult to differentiate between the ability of the mutant to transport and ferment xylose from the ability to support growth. To overcome this limitation, the wild-type strain, W3110, and the pflB mutant (strain SE2358) were grown in minimal medium containing limiting amounts of both glucose and xylose in a pH-stat at pH 7.0 (Fig. 1). Strain W3110 exhibited an expected diauxie and utilized glucose preferentially over xylose, since xylose utilization is additionally controlled by CRP-cAMP (23, 30). Main fermentation products produced by the wild type were acetate, ethanol, and formate. Only small amounts of lactate (2 mM) and succinate (11 mM) were detected in the spent medium. Under the same conditions, the cell yield of strain SE2358 (pflB) was only half of that of the wild-type parent. Growth of the pfl mutant ceased after the glucose in the medium was exhausted. Xylose was utilized at a very low rate (0.19 mmol h1 compared to the rate of 1.9 mmol h1 for the wild type), and the increase in lactate during this phase (after about 20 h; Fig. 1) was directly proportional to the xylose consumed. During the glucose utilization phase, strain SE2358 produced about 6 mM succinate, and this was not appreciably increased during the xylose phase. With these low sugar concentrations, the efficiency of xylose fermentation to products was about 70% for both the wild type and the mutant, indicating that the pfl mutant is apparently growing but only at about 1/10 the growth rate of the wild type on xylose. This would represent a generation time of about 35 h for the pflB mutant in xylose minimal medium under anaerobic conditions. During the xylose phase, the cells did not lose their viability, which is in agreement with the very low growth rate of the culture.
Total RNA from both the wild type and the
pfl mutant was isolated
when the amount of xylose consumed by the wild type reached
about the midpoint. Using two sets of appropriate DNA primers,
the amounts of
xylA and
xylF mRNA in the total RNA were determined
by quantitative real-time PCR. The relative mRNA levels of
xylA,
representing the
xylAB operon, encoding xylose isomerase and
xylulose kinase, respectively, and
xylF, part of the ABC transporter
for xylose (XylFGH), in the
pflB mutant were about 70% of the
parent levels. The xylulose kinase activity was about 85% of
the parent level in the mutant. These results show that the
xyl operons are transcribed and translated in the
pflB mutant
even when the organism is not growing with xylose as the C source
under anaerobic conditions.
Acetate kinase-minus mutant is also xylose negative under anaerobic conditions.
The results presented above suggest that the ATP derived from the pyruvate-to-acetyl-CoA-to-acetate pathway is a requirement for supporting anaerobic growth of E. coli on xylose. Since acetate kinase is the enzyme that converts acetyl phosphate to acetate and ATP, an ackA mutant is also expected to be defective in anaerobic growth on xylose. The results presented in Table 2 show that strain YK19, with the ackA202 mutation, also failed to grow with xylose under anaerobic conditions. The rate of anaerobic growth on glucose of strain YK19 was slightly lower than that of the wild-type parent but not significantly different from that of the pflB mutant in the same medium. Aerobic growth of the ackA or pflB mutant on either glucose or xylose was unaffected. These results are in agreement that the ATP produced during the interconversion of acetyl-CoA to acetate is essential for growth of E. coli on xylose in minimal medium under anaerobic conditions. This additional ATP is probably responsible also for the observed increase in the cell yield of glucose-grown cultures by 1.5-fold (Fig. 1).
These results further confirm that the net ATP yield from xylose
(0.67) is only slightly higher than the need for maintenance
energy of an anaerobic culture of a
pflB (
ackA) mutant of
E. coli. The maintenance energy requirement for an
E. coli culture
growing in glucose minimal medium was calculated to be 18.9
mmol of ATP per g of cell dry weight per h (
25). Apparently,
due to the need for two ATPs per xylulose-5-phosphate production,
the specific rate of net ATP production from xylose is close
to the calculated value for maintenance energy for these pH-controlled,
anaerobic batch cultures on xylose minimal medium in the absence
of acetyl-CoA production. The net anaerobic ATP yield from xylose
may even be lower if the ATP consumed during the production
of acetyl-CoA from external acetate by the acetyl-CoA synthetase
for biosynthesis is also included in these calculations.
Growth of pflB mutant in LB-xylose medium.
The cell yield (YATP) for E. coli is expected to be higher in rich medium than in minimal medium, as seen with Enterobacter, due to the availability of small molecule building blocks in the rich medium (31). If the ATP yield from xylose of the pflB mutant is the same when grown in rich or minimal medium, the availability of most of the building blocks in LB medium could spare the ATP used for small molecule biosynthesis, which in turn can be used for growth of the pfl mutant in complex medium with xylose as the fermentable sugar. Since both pflB and ackA mutants have the same anaerobic xylose-minus phenotype, all subsequent experiments were carried out with the pflB deletion mutant. With the same amount of total sugar (0.5% each of glucose and xylose), the cell yield of the wild type doubled in the complex medium compared to that in the minimal medium (Fig. 2 and 1, respectively). A similar increase was observed with the pflB mutant, which also included limited growth during the xylose phase at a lower rate. In contrast to the inability of the pflB mutant to ferment xylose when cultured in minimal medium (Fig. 1), xylose was completely fermented by the LB-xylose culture (Fig. 2). Although the pflB mutant utilized all the added sugars, the cell yield from xylose was only about 40% of that for the wild type, suggesting poor efficiency in converting xylose carbon to cell material due to ATP limitation during anaerobic growth.
Anaerobic growth of pflB mutant in minimal medium with other pentoses.
In order to test whether the observed xylose-negative growth
phenotype of
pfl mutants is specific for xylose or for all pentoses,
strain SE2358 was cultured in minimal medium with either arabinose
or ribose as the C source. Even the wild-type strain used in
this experiment, W3110, failed to grow on ribose anaerobically,
and this pentose was not used in further experiments.
E. coli strain W3110 grew in minimal medium with both glucose and arabinose
with an expected diauxie in sugar utilization (Fig.
3) (
23).
This diauxie was not apparent in the growth or production of
fermentation products, probably due to a combination of very
short transition time from the end of glucose to the beginning
of arabinose and the high rate of arabinose utilization (compared
to that for xylose [Fig.
1]). Strain SE2358, the
pfl mutant,
grew in minimal medium containing both glucose and arabinose,
and both sugars were utilized simultaneously. The rate of glucose
utilization by the
pfl mutant was lower than that by the parent
strain, probably accounting for the co-utilization of both sugars.
The cell yield of strain SE2358 was also significantly lower
than that of the wild-type parent strain in the glucose-arabinose
medium (Fig.
3). Lower cell yield combined with higher fermentation
product yield (115 mM lactate for strain SE2358 compared to
90 mM concentration of acetate plus ethanol for the wild type)
(Fig.
3) suggests that arabinose is not as efficient as glucose
in supporting growth of the
pfl mutant (Fig.
1). However, the
pflB mutant did grow in arabinose minimal medium, in contrast
to results in xylose minimal medium. Similar results were also
obtained with the
ackA mutant, strain YK19 (data not presented).
Arabinose is transported by two arabinose-inducible transport
systems; a low-affinity, high-capacity arabinose/H
+ symport
(AraE) and a high-affinity ABC-type transporter (AraFGH) (
7).
The two transport systems are analogous to the two xylose transporters
(
13,
20). The observed growth of the
pfl mutant in arabinose
minimal medium (Fig.
3) suggests that the
pfl mutant is utilizing
ATP-independent AraE for transport of arabinose and thus conserving
ATP for growth. It has been previously reported that
araE expression
is enhanced by arabinose and that the H
+/arabinose symport is
the main arabinose transporter in wild-type
E. coli (
16). In
agreement with these published results, an
araFGH mutant lacking
the ABC transporter (strain AH245) grew in arabinose minimal
medium anaerobically at a rate comparable to that of the parent
(µ of 0.19 h
1 and 0.23 h
1, respectively)
(Fig.
4). In contrast, an
araE deletion mutant (strain AH247)
had a longer lag and a significantly lower growth rate (µ
of 0.07 h
1) than the wild-type parent. A
pflB araE double
mutant (AH250) did not grow in arabinose minimal medium, while
the growth characteristics of strain AH248, a
pfl 
(
araFGH) double
mutant, and a
pfl mutant were similar (µ of 0.15 h
1 for strain AH248 and 0.13 h
1 for the isogenic
pfl mutant,
strain AH243). These results show that in
E. coli, ATP-independent
arabinose/H
+ symport is conserving ATP during sugar transport,
leading to the observed growth of the
pflB mutant on arabinose
under anaerobic conditions. Although ATP can be utilized to
generate an H
+ gradient, the energy needed for arabinose symport
is apparently independent of ATP-dependent energization of the
membrane. Since the amount of succinate produced by the various
mutants was comparable, the electron flow to fumarate through
the membrane-bound fumarate reductase may provide the needed
energy for arabinose/H
+ symport (
3).
Xylose transport mutants.
Based on the results of the xylose and arabinose utilization
patterns, the XylE, xylose/H
+ symport is apparently not the
main contributor to xylose transport in
E. coli, and xylose
is preferentially transported by the high-affinity ABC-type
XylFGH transport system. This was corroborated by the growth
characteristics of
xylG and
xylE deletion derivatives, especially
under anaerobic conditions (Table
3). Specific growth rate of
a
xylG mutant, AH280, utilizing only the XylE (H
+/symport) for
transport, was reduced by about 50% even under aerobic conditions
in xylose minimal medium. Growth of this mutant in xylose minimal
medium under anaerobic conditions was minimal, reaching a specific
growth rate of only 0.03 h
1 compared to 0.19 h
1 for the parent. Increasing the copy number of the
xylE gene
with the native promoter (plasmid pAH291) did not increase the
growth rate of the
xylG deletion mutant (
pfl+) either aerobically
or anaerobically. When
xylE was expressed from a synthetic promoter
(plasmid pAH286), the growth rate of the
xylG mutant (
pfl+)
on xylose only increased by about twofold under anaerobic growth
conditions, although aerobic growth rates of both the wild type
and the
xylG mutant with the plasmid pAH286 were comparable.
This anaerobic growth rate of the
xylG mutant with the plasmid
pAH286 expressing
xylE was still only about 30% of that of the
wild type. Neither plasmid supported growth of the
pfl mutant
on xylose anaerobically. These results show that the xylose/H
+ symport is not an effective xylose transporter in
E. coli, and
under anaerobic conditions, xylose is primarily transported
by the ATP-dependent ABC transporter. As expected, deleting
the
xylE gene had only a minimal effect (about 20%) on the growth
rate of the mutant, strain AH257, in xylose minimal medium (Table
3).
Xylose transport by AraE.
It is well established that sugar symport systems have limited
specificity and transport heterologous sugars (
7). It is possible
that the AraE protein can also transport xylose, but under normal
physiological conditions
araE would be repressed by the AraC
protein and could not contribute to xylose transport. In the
presence of both arabinose and xylose, arabinose would be preferentially
transported and utilized over xylose, and when the arabinose
concentration decreased below the required critical level, the
araE again would be repressed by the free AraC protein. In order
to overcome this physiological limitation, the
araE gene was
expressed from a synthetic promoter (
16), and the mutation was
transduced into the
pflB deletion strain AH243. The transductant,
strain AH249, grew at about the same rate in xylose minimal
medium (µ of 0.12 h
1) as the corresponding
pfl mutant (strain AH243) grew on arabinose (µ of 0.13 h
1)
(Fig.
5). These results show that an ATP-independent xylose
transport is essential for growth of the
pfl mutant in xylose
minimal medium.
In
E. coli, xylose is primarily transported by the high-affinity
XylFGH, with a stoichiometric requirement for ATP. This higher
energy demand for xylose transport and further phosphorylation,
coupled with the inability to produce energy from pyruvate,
as in the case of a
pflB mutant, does not allow sufficient net
ATP to support anaerobic growth. The pyruvate formate lyase,
phosphotransacetylase, acetate kinase pathway is required not
only for growth of
E. coli on xylose but also for growth of
other bacteria on limiting sugars (
11,
36).
Lactococcus lactis and
Lactobacillus pentosus produce lactate as the sole product
during glucose or lactose fermentation. In the presence of galactose
or limiting concentration of glucose, these bacteria additionally
produce acetate and ethanol as fermentation products (
6,
21).
It has been established that the pyruvate formate lyase is induced
under these carbon-limiting conditions (
22). It is apparent
from these studies and the present study on the
E. coli pfl mutant that one of the physiological roles of pyruvate formate
lyase in bacteria is to provide the precursor acetyl phosphate
for production of an additional ATP at the level of acetate
kinase to support a higher growth rate of the bacterium under
fermentative conditions.

ACKNOWLEDGMENTS
We thank Jensen for providing plasmids containing synthetic
promoters and M. Berlyn, CGSC, for providing strains used in
this study.
This work was supported in part by grants from the Department of Energy (DE-FC36-01GO11073 and FG02-96ER20222) and U.S. Department of Agriculture (00-52104-9704 and 01-35504-10669).

FOOTNOTES
* Corresponding author. Mailing address: Department of Microbiology and Cell Science, Box 110700, Bldg. 981, Museum Road, University of Florida, Gainesville, FL 32611. Phone: (352) 392-2490. Fax: (352) 392-5922. E-mail:
shan{at}ufl.edu.

Florida Agricultural Experiment Station Journal Series no. R-10339. 
Present address: Department of Oral Biology, University of Florida, Gainesville, FL 32610. 
Present address: Department of Biology, Trinity University, San Antonio, TX 78212. 

REFERENCES
1 - Bauchop, T., and S. R. Elsden. 1960. The growth of microorganisms in relation to their energy supply. J. Gen. Microbiol. 23:457-469.[Abstract/Free Full Text]
2 - Beall, D. S., K. Ohta, and L. O. Ingram. 1991. Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli. Biotechnol. Bioeng. 38:296-303.[CrossRef][Medline]
3 - Bernhard, T. H., and G. Gottschalk. 1978. Cell yields of Escherichia coli during anaerobic growth on fumarate and molecular hydrogen. Arch. Microbiol. 116:235-238.[CrossRef][Medline]
4 - Causey, T. B., K. T. Shanmugam, L. P. Yomano, and L. O. Ingram. 2004. Engineering Escherichia coli for efficient conversion of glucose to pyruvate. Proc. Natl. Acad. Sci. USA 101:2235-2240.[Abstract/Free Full Text]
5 - Causey, T. B., S. Zhou, K. T. Shanmugam, and L. O. Ingram. 2003. Engineering the metabolism of Escherichia coli W3110 for the conversion of sugar to redox-neutral and oxidized products: homoacetate production. Proc. Natl. Acad. Sci. USA 100:825-832.[Abstract/Free Full Text]
6 - Cselovszky, J., G. Wolf, and W. P. Hammes. 1992. Production of formate, acetate, and succinate by anaerobic fermentation of Lactobacillus pentosus in the presence of citrate. Appl. Microbiol. Biotechnol. 37:94-97.
7 - Daruwalla, K. R., A. T. Paxton, and P. J. Henderson. 1981. Energization of the transport systems for arabinose and comparison with galactose transport in Escherichia coli. Biochem. J. 200:611-627.[Medline]
8 - Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
9 - De Graef, M. R., S. Alexeeva, J. L. Snoep, and M. J. T. De Mattos. 1999. The steady-state internal redox state (NADH/NAD) reflects the external redox state and is correlated with catabolite adaptation in Escherichia coli. J. Bacteriol. 181:2351-2357.[Abstract/Free Full Text]
10 - Feng, J., M. R. Atkinson, W. R. McCleary, J. B. Stock, B. L. Wanner, and A. J. Ninfa. 1992. Role of phosphorylated metabolic intermediates in the regulation of glutamine synthetase synthesis in Escherichia coli. J. Bacteriol. 174:6061-6070.[Abstract/Free Full Text]
11 - Garrigues, C., P. Loubiere, N. D. Lindley, and M. Cocaign-Bousquet. 1997. Control of the shift from homolactic acid to mixed-acid fermentation in Lactococcus lactis: predominant role of the NADH/NAD+ ratio. J. Bacteriol. 179:5282-5287.[Abstract/Free Full Text]
12 - Gonzalez, R., H. Tao, K. T. Shanmugam, S. W. York, and L. O. Ingram. 2002. Global gene expression differences associated with changes in glycolytic flux and growth rate in Escherichia coli during the fermentation of glucose and xylose. Biotechnol. Prog. 18:6-20.[CrossRef][Medline]
13 - Henderson, P. J. F., and M. C. J. Maiden. 1990. Homologous sugar transport proteins in Escherichia coli and their relatives in both prokaryotes and eukaryotes. Philos. Trans. R. Soc. Lond. B 326:391-410.[Abstract/Free Full Text]
14 - Jensen, P. R., and K. Hammer. 1998. The sequence of spacers between the consensus sequences modulates the strength of prokaryotic promoters. Appl. Environ. Microbiol. 64:82-87.[Abstract/Free Full Text]
15 - Kessler, D., and J. Knappe. 1996. Anaerobic dissimilation of pyruvate, p. 199-205. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
16 - Khlebnikov, A., K. A. Datsenko, T. Skaug, B. L. Wanner, and J. D. Keasling. 2001. Homogeneous expression of the PBAD promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. Microbiology 147:3241-3247.[Abstract/Free Full Text]
17 - Lawford, H. G., and J. D. Rousseau. 1995. Comparative energetics of glucose and xylose metabolism in ethanologenic recombinant Escherichia coli B. Appl. Biochem. Biotechnol. 51-52:179-195.[Medline]
18 - Lee, J. H., P. Patel, P. Sankar, and K. T. Shanmugam. 1985. Isolation and characterization of mutant strains of Escherichia coli altered in H2 metabolism. J. Bacteriol. 162:344-352.[Abstract/Free Full Text]
19 - Lin, E. C. C. 1996. Dissimilatory pathways for sugars, polyols, and carboxylates, p. 307-342. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
20 - Linton, K. J., and C. F. Higgins. 1998. The Escherichia coli ATP-binding cassette (ABC) proteins. Mol. Microbiol. 28:5-13.[CrossRef][Medline]
21 - Melchiorsen, C. R., N. B. Jensen, B. Christensen, K. Vaever Jokumsen, and J. Villadsen. 2001. Dynamics of pyruvate metabolism in Lactococcus lactis. Biotechnol. Bioeng. 74:271-279.[CrossRef][Medline]
22 - Melchiorsen, C. R., K. V. Jokumsen, J. Villadsen, H. Israelsen, and J. Arnau. 2002. The level of pyruvate-formate lyase controls the shift from homolactic to mixed-acid product formation in Lactococcus lactis. Appl. Microbiol. Biotechnol. 58:338-344.[CrossRef][Medline]
23 - Montalvo, V. H., F. Valle, F. Bolivar, and G. Gosset. 2001. Characterization of sugar mixtures utilization by an Escherichia coli mutant devoid of the phosphotransferase system. Appl. Microbiol. Biotechnol. 57:186-191.[CrossRef][Medline]
24 - Neijssel, O. M., M. J. T. de Mattos, and D. W. Tempest. 1996. Growth yield and energy distribution, p. 1683-1692. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
25 - Pirt, S. J. 1965. The maintenance energy of bacteria in growing cultures. Proc. R. Soc. Lond. B 163:224-231.[Medline]
26 - Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57:543-594.[Abstract/Free Full Text]
27 - Rosentel, J. K., F. Healy, J. A. Maupin-Furlow, J. H. Lee, and K. T. Shanmugam. 1995. Molybdate and regulation of mod (molybdate transport), fdhF, and hyc (formate hydrogenlyase) operons in Escherichia coli. J. Bacteriol. 177:4857-4864.[Abstract/Free Full Text]
28 - Saier, M. H., and J. Reizer. 1994. The bacterial phosphotransferase system: new frontiers 30 years later. Mol. Microbiol. 13:755-764.[Medline]
29 - Self, W. T., A. Hasona, and K. T. Shanmugam. 2001. N-terminal truncations in the FhlA protein result in formate- and MoeA-independent expression of the hyc (formate hydrogenlyase) operon of Escherichia coli. Microbiology 147:3093-3104.[Abstract/Free Full Text]
30 - Song, S., and C. Park. 1997. Organization and regulation of the D-xylose operons in Escherichia coli K-12: XylR acts as a transcriptional activator. J. Bacteriol. 179:7025-7032.[Abstract/Free Full Text]
31 - Stouthamer, A. H. 1977. Energetic aspects of the growth of micro-organisms. Symp. Soc. Gen. Microbiol. 27:285-315.
32 - Tao, H., R. Gonzalez, A. Martinez, M. Rodriguez, L. O. Ingram, J. F. Preston, and K. T. Shanmugam. 2001. Engineering a homo-ethanol pathway in Escherichia coli: increased glycolytic flux and levels of expression of glycolytic genes during xylose fermentation. J. Bacteriol. 183:2979-2988.[Abstract/Free Full Text]
33 - Tempest, D. W., and O. M. Neijssel. 1984. The status of YATP and maintenance energy as biologically interpretable phenomena. Annu. Rev. Microbiol. 38:459-486.[CrossRef][Medline]
34 - Underwood, S. A., S. Zhou, T. B. Causey, L. P. Yomano, K. T. Shanmugam, and L. O. Ingram. 2002. Genetic changes to optimize carbon partitioning between ethanol and biosynthesis in ethanologenic Escherichia coli. Appl. Environ. Microbiol. 68:6263-6272.[Abstract/Free Full Text]
35 - Varenne, S., F. Casse, M. Chippaux, and M. C. Pascal. 1975. A mutant of Escherichia coli deficient in pyruvate formate lyase. Mol. Gen. Genet. 141:181-184.[CrossRef][Medline]
36 - Yamada, T., S. Takahashi-Abbe, and K. Abbe. 1985. Effects of oxygen on pyruvate formate-lyase in situ and sugar metabolism of Streptococcus mutans and Streptococcus sanguis. Infect. Immun. 47:129-134.[Abstract/Free Full Text]
37 - Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam, and L. O. Ingram. 2003. Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110. Appl. Environ. Microbiol. 69:399-407.[Abstract/Free Full Text]
38 - Zhu, J., and K. Shimizu. 2004. The effect of pfl gene knockout on the metabolism for optically pure D-lactate production by Escherichia coli. Appl. Microbiol. Biotechnol. 64:367-375.[CrossRef][Medline]
Journal of Bacteriology, November 2004, p. 7593-7600, Vol. 186, No. 22
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.22.7593-7600.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Bi, C., Rice, J. D., Preston, J. F.
(2009). Complete Fermentation of Xylose and Methylglucuronoxylose Derived from Methylglucuronoxylan by Enterobacter asburiae Strain JDR-1. Appl. Environ. Microbiol.
75: 395-404
[Abstract]
[Full Text]
-
Murarka, A., Dharmadi, Y., Yazdani, S. S., Gonzalez, R.
(2008). Fermentative Utilization of Glycerol by Escherichia coli and Its Implications for the Production of Fuels and Chemicals. Appl. Environ. Microbiol.
74: 1124-1135
[Abstract]
[Full Text]
-
Kim, Y., Ingram, L. O., Shanmugam, K. T.
(2007). Construction of an Escherichia coli K-12 Mutant for Homoethanologenic Fermentation of Glucose or Xylose without Foreign Genes. Appl. Environ. Microbiol.
73: 1766-1771
[Abstract]
[Full Text]