Previous Article | Next Article ![]()
Journal of Bacteriology, December 2004, p. 7988-7999, Vol. 186, No. 23
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.23.7988-7999.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
PRM Promoter: Implications for Evolution of Gene Regulatory Circuitry
and
John W. Little1,2*
Department of Biochemistry and Molecular Biophysics,1 Department of Molecular and Cellular Biology, University of Arizona, Tucson, Arizona2
Received 18 February 2004/ Accepted 1 September 2004
|
|
|---|
centers on a complex region called the
OR region. This
100-bp region is densely
packed with regulatory sites, including two promoters and three
repressor-binding sites. The dense packing of this region is likely to
impose severe constraints on its ability to change during evolution,
raising the question of how the specific arrangement of sites and their
exact sequences could evolve to their present form. Here we ask whether
the sequence of a cis-acting site can be widely varied while
retaining its function; if it can, evolution could proceed by a larger
number of paths. To help address this question, we developed a
cloning vector that allowed us to clone fragments spanning
the OR region. By using this vector, we carried out
intensive mutagenesis of the PRM promoter, which
drives expression of CI repressor and is activated by CI itself. We
made a pool of fragments in which 8 of the 12 positions in the
35 and 10 regions were randomized and cloned this
pool into the vector, making a pool of PRM variant
phage. About 10% of the PRM variants were
able to lysogenize, suggesting that the
regulatory circuitry
is compatible with a wide range of PRM sequences.
Analysis of several of these phages indicated a range of behaviors in
prophage induction. Several isolates had induction properties
similar to those of the wild type, and their promoters resembled the
wild type in their responses to CI. We term this property of different
sequences allowing roughly equivalent function "sequence
tolerance " and discuss its role in the evolution of gene
regulatory
circuitry. |
|
|---|
in the
intact system. This system is probably the best-understood complex
circuit (38,
39). Most, if not all,
of the regulatory interactions have been identified, and
most of these are well characterized at the mechanistic level.
Previous analysis of this circuit generally has been carried
out in uncoupled systems (such as the use of reporter genes and fusions
with the lac promoter), an approach necessary to disentangle
the causality of this system. With a circuit diagram in hand, it is now
possible to return to the intact circuit and ask how particular changes
affect the overall operation of the system.
Many of the critical
interactions in the
circuit center on a complex regulatory
region termed the OR region (Fig.
1C). This
100-bp region is densely packed with cis-acting
sites, including two promoters and three sites to which both the CI and
Cro repressors can bind
(38). In addition, the
promoters and repressor-binding sites overlap extensively. CI and Cro
regulate the expression of these promoters, and their actions determine
the overall behavior of the regulatory circuitry.
![]() View larger version (22K): [in a new window] |
FIG. 1. Structure
of the JL387 vector and sequence of PRM.
All maps are to scale, as indicated. (A) Comparison with
l+. The indicated BsrGI and XhoI sites in
JL351 were introduced; that for BsrGI is the only BsrGI site
to the right of the XhoI site. The letter X in the JL387 map
indicates the site of the XhoI site removed by filling in.
(B) Maps of cI and cro. The NsiI and BglII
sites shown were used for routine subcloning of the
OR region and are present in both and
JL351. (C) Close-up of the OR
region showing the locations of the promoters and operators and those
of the new XhoI and BsrGI sites. Cro and CI both bind to sites
OR1, OR2, and
OR3. JL387 contains v1 and
v3 mutations (not shown; see text) not present in
JL351 or the wild type. (D) Sequence of the
PRM promoter, inverted from the usual order of the
map. The locations of OR3 and the end of
OR2 are shown in bold; the 35 and
10 regions of PRM are underlined, and the
NNNN sequences represent positions that were randomized (Fig. S3 of the
supplemental material contains more details). Above the sequence is
that of a consensus promoter. Positions at which
PRM matches it are
underlined.
|
circuitry is bistablethat is, lambda can exist in either of
two stable epigenetic states, the lytic state and the lysogenic state.
A choice is made between these two states soon after infection; this
choice involves regulatory elements (CII, CIII, and
PRE [see reference
14]) that we do not
consider here. Once a particular choice is made, it is stabilized by
the interactions of CI or Cro with the OR region.
In the lytic state, Cro is made from PR. At
moderate concentrations, Cro binds preferentially to
OR3, repressing PRM but not
affecting its own expression; at higher levels, Cro also binds to
OR1 and OR2, partially
repressing its own synthesis. Hence, if Cro but not CI is present, this
pattern is perpetuated. In the lysogenic state, by contrast, CI but no
Cro is present; CI binds tightly to OR1 and
cooperatively to OR2 but only weakly to
OR3. Binding to OR1 and/or
OR2 represses PR. CI bound to
OR2 also stimulates expression of
PRM about 10-fold
(31); hence, CI acts in
this context as an activator of its own expression in a positive
feedback loop. Again, if CI but not Cro is present, this pattern is
perpetuated by the behavior of the circuitry. At higher CI levels,
PRM is partially repressed by binding of CI to
OR3, both directly and by a cooperative long-range
interaction with CI molecules bound at a distant regulatory region
termed OL
(7,
8,
40). It is of interest to ask how this particular arrangement and spacing of cis-acting sites benefits the phage, how it arose during the course of evolution, and how the sequences of the sites were refined during the course of evolution. We chose to address the last question by asking whether one of these cis-acting sites, the PRM promoter, could tolerate substantial genetic changes and still allow relatively normal behavior of the intact circuitry.
Although unstimulated
PRM is a relatively weak promoter, it differs from
the consensus
70-specific promoter in only 4
positions out of 12 (Fig.
1D). Is its resemblance to
the consensus important, or could it tolerate substantial changes and
still preserve its function? Previous work and our unpublished studies
have identified several point mutations in PRM that
weaken or strengthen it, and these mutations affect the behavior of the
circuitry (12,
31,
42,
43; our unpublished
work), suggesting that its sequence is important. It is unclear whether
more extensive changes in the promoter would destroy the
operation of the circuitry. For instance, promoter mutations might also
affect other processes operating in this complicated regulatory region.
In this work, we have tested the effects of extensive changes in
PRM on the operation of the
circuitry.
In order to facilitate this and similar studies, it
would be useful to be able to clone variants of the
OR region into a wild-type background. This would
allow one, for example, to use intensive site- or region-directed
mutagenesis to create large pools of recombinant molecules and then to
introduce these into intact genomes and assess their effects by using
the powerful screens and selections afforded by
genetics.
This approach could be extended to combinatorial approaches in which
many combinations are made and tested simultaneously. We describe here
the isolation of a cloning vector that allows such manipulations in the
OR regulatory region and use it to carry out
extensive mutagenesis of PRM. We find that
sequences differing markedly from the wild-type sequence can confer
nearly normal behavior on the
circuitry.
|
|
|---|
DNA isolation kit was from QIAGEN (Valencia, Calif.). The Phagemaker
packaging kit was from Novagen (Madison, Wis.). TE was 10 mM
Tris-HCl (pH 8.0) plus 1 mM EDTA; BTE was TE plus 0.1 M
NaHCO3; TZ8 (7)
was 100 mM Tris-HCl (pH 8.0) plus 1 mM MgSO4 plus 10 mM KCl.
LB and tryptone broth were as previously described
(27) and supplemented
with antibiotics as appropriate at the levels previously described
(27), except that
lysogens of
JL351 and the PRM variants
were grown with 10 µg of kanamycin per ml and were not fully
resistant to 30 µg/ml. LBGM and LBMM were LB with 1 mM
MgSO4 and either 0.2% glucose or 0.2% maltose,
respectively (27). DNA
sequencing was carried out as previously described
(27). For each MD phage
(see Table 2), DNA
sequencing was done on a PCR product extending from the distal end of
cro to the end of cI; sequencing was done from the
end of cro through about the first third of cI,
spanning the entire cloned
region. |
View this table: [in a new window] |
TABLE 2. PRM
variants that form turbid
plaquesa
|
JL387 (see supplemental material); phage
isolated from the pool of PRM variants, termed MDx,
where x is an allele number (MDx phage differ from
JL351 only
by the changes listed in Table
2); MDWx phages, isolated
as described below, which differ from
JL163 only by the
altered PRM (x has the value of its MDx forebear);
and phages bearing
PRM::lacZ fusions. In
addition, phages HK106, HK244, HK542 clear, and HK544, which
were originally isolated and shown to have
immunity by
T. S. Dhillon (personal communication), were obtained from
R. A. Weisberg; phages CL707 and CL715, isolated in Davis,
Calif., and also found to have
immunity (Dhillon, personal
communication), were obtained from T. S. Dhillon. Plasmids
not listed include those used to make reporter fusions and derivatives
used to make MDW phages. |
View this table: [in a new window] |
TABLE 1. Strains
used in this study
|
Construction of cloning vector
JL387 and preparation of vector arms.
For a description of the construction
of cloning vector
JL387 and the preparation of vector arms,
see Fig. S1 and S2 of the supplemental
material.
Preparation of doped PRM pools. A collection of DNA fragments bearing randomized bases in the eight positions shown by the NNNN sequences in Fig. 1D was prepared as outlined in Fig. S3 of the supplemental material.
Cloning in
JL387.
Vector arms
in equimolar amounts at a total concentration of 75 µg/ml were
mixed with a twofold molar excess of the doped PRM
pool, treated with DNA ligase overnight at 16°C in a total
volume of 10 µl, and packaged with a commercial packaging kit
(Novagen). From 0.75 µg of input DNA we recovered only
20,000 plaque-forming phage, far fewer than expected from the
stated efficiency of this kit (
107 plaques per
µg of ligation mixture), and infer that ligation or packaging
was inefficient.
Subcloning of PRM variants.
The vector pJWL502 (from Andrea
Watson) was the same as pJWL344 (Fig. S1C of the supplemental
material), except that it lacked the SpeI site; also, the SalI site had
been removed by cutting, filling in, and ligation; hence, the HincII
site within OR was unique. pJWL502 was cut with
NsiI and HincII as a backbone; inserts were a PCR fragment (with
JL163 as the template) from the NsiI site to a BsiHKAI site at
codon 2 of cI and BsiHKAI-HincII fragments from PCR products
of various PRM variants. The resulting plasmids
lacked the XhoI and BsrGI sites while retaining the variant
PRM and were used in two ways. First, the
PRM variants were crossed into a wild-type
background by a cross with
JL161; recombinants were identified
as turbid-plaque formers, verified by DNA sequencing, and termed MDWx.
Second, to make protein fusions of these promoters with lacZ,
the plasmids were used as PCR templates with the primers
GGGGGGGATCCTTAAGGCGACGTGC and
CCCCCGAATTCAACCTCCTTAGTAC, followed by digestion
with EcoRI and BamHI and cloning into pRS414. The resulting
protein fusions contained the PRM variants and the
first 18 amino acids of CI fused to lacZ. Codons in
cI are numbered beginning not with the N-terminal Met, since
this is removed posttranslationally
(45,
46), but with the
following Ser.
Modification of Simons vectors.
We modified the
Simons vector
RS45
(50) in three ways
(detailed in the supplemental material). First, we isolated a
Kanr derivative, allowing selection of lysogens. Second, we
deleted the distal part of the lac operon, from the middle of
lacY to the end of the operon
(7). Finally, we made
another derivative in which a variant of the
OL region was placed downstream of lacZ.
These steps created a pair of phages,
JL611 (shown in Fig. S4
of the supplemental material) and
JL628, without and with the
OL variant, respectively. These phages were crossed
with derivatives of pRS414 bearing various PRM
variants (see above) to create reporter phages used in the assay
described below. In derivatives of
JL628 with
PRM::lacZ protein
fusions, the OL site lay 3.6 kb from
OR, slightly closer than in the phages of Dodd et
al. (7) (3.8 kb) and more
distant than in
(2.46
kb).
Reporter assays.
ß-Galactosidase assays were
performed as previously described
(7), with several
modifications, with the Molecular Devices Spectra MAX 340PC plate
reader. Overnight cultures were diluted 1:6,000 with shaking in tubes
in 3 ml of LBGM without and with graded amounts of
isopropyl-ß-D-thiogalactopyranoside (IPTG) at
37°C to 1 x 108 to 3 x
108 cells per ml. Cell density was measured by determining
optical density at 600 nm (OD600) with a plate reader (250
µl of culture per well); 50 µl of culture was added to
150 µl of TZ8 assay buffer (TZ8 plus 2.7 µl of
ß-mercaptoethanol per ml and 2.5 µl of 2%
polymyxin B per ml). Assays were run in triplicate in flat-bottom
96-well plates (Evergreen Scientific) at 28°C for 1 or
5 h after addition of 50 µl of 0.4% ONPG
(o-nitrophenyl-ß-D-galactopyranoside)
dissolved in TZ8. Units were defined by the following formula: 1,000
x (
OD420/min)/(OD600 x
1.5 x volume of culture in milliliters). Units defined in this
way are roughly comparable to Miller units
(32).
For each PRM variant, assays for reporter gene function were carried out with two pairs of strains. In each pair, the host carried either pA3B2, which provided a low level of CI (JL6740), or pJWL486, a derivative of pACYC184 (like pA3B2) but lacking cI (JL6853). The pairs differed in whether the fusion had the OL variant distal to lacZ. In all cases, single lysogens were used (37). Strains with pA3B2 carried pJWL615 as a source of Lac repressor; various levels of CI were supplied in these strains by adding graded amounts of IPTG.
Distinguishing vector from recombinants.
Most
recombinants formed clear plaques. These were distinguished from the
JL387 vector, which bears v1 and v3 and also
forms clear plaques, as follows. The v1 and v3
mutations are present in
vir, which can grow in a
lysogen.
vir also contains a third
mutation, v2, in OL1, allowing expression
of the PL operon. CI binds poorly to the mutant
operators and cannot repress the lytic genes of
vir.
Since the only essential gene product from the PL
operon is the N protein,
v1 v3
should be virulent if N is provided in trans, as in
strain JL5434.
and a cI mutant could not form
plaques on JL5434, but
v1 v3
and
JL387 formed small, clear plaques. Hence, clear plaques
formed on JL2497 were tested individually for the ability to plate on
JL5434. Alternatively, phage were plated on a 10:1 mixture of JL2497
and JL5434;
v1 v3 and
JL387 formed
clear plaques, while
,
cI, and recombinants
formed turbid plaques.
Prophage induction. Experiments were carried out as previously described (27), with two exceptions. First, after that study we changed the brand of UV lamp used for irradiation and found that the set point for the wild type changed from 5 to 12 J/m2, a difference we attribute to changes in the spectral properties of the lamp relative to those of the meter (International Light model IL1400A) used to measure its output. Second, phage titers were determined with lawns made from exponentially growing cells (JL2497 was grown to 2 x 108/ml in LBMM, centrifuged, and resuspended in 1/10 volume of TMG [27]),rather than the starved overnight lawns used in the previous studies. This change gave higher and more reproducible titers.
|
|
|---|
has been widely used
as a cloning vector, it has seldom been used in this way for analyzing
itself. As described below, we developed a vector that allows
us to clone fragments carrying only the OR region
and a small portion of cI. We then used this vector to carry
out cassette mutagenesis of the PRM promoter and
analyzed progeny with properties resembling those of wild-type
. We judged the resemblance of the behavior of PRM variants to that of the wild type by several criteria. First was the ability to grow lytically, which is not a demanding criterion since PRM has no role in lytic growth. Second was the ability to establish and maintain a stable lysogenic state. Expression of CI from PRM is required for maintenance of this state. Third was the ability to undergo prophage induction, or the "genetic switch," in which the regulatory state changes from lysogenic to lytic upon induction of the host SOS system (26, 41).
Design of the cloning vector.
The
cloning vector used, termed
JL387 (Fig.
1), has several useful
features. First, it carries a kanamycin resistance marker
replacing a portion of the b2 region, allowing selection of
lysogens. Second, it has two new restriction sites flanking the
OR region (Fig.
1), both arising by
single-base changes: a unique, silent XhoI site located at codons 12 to
13 of cI, and a BsrGI site at the start of the
PR transcript. These sites were used in preparing
vector DNA for cloning (Fig. S2 of the supplemental material). Third,
to distinguish the vector from recombinants bearing inserts in the
OR region, it contains two mutations in the
OR operators, v1 in
OR2 and v3 in OR1.
These mutations prevent lysogeny
(16), so the cloning
vector formed clear plaques. Recombinants forming turbid plaques could
easily be recognized by screening for this phenotype. In addition, we
developed genetic tests to distinguish recombinants forming clear
plaques from the vector (see Materials and
Methods).
JL351, which differs from the cloning vector
only in that it lacks mutations in the OR
operators, was used as a wild-type control for the behavior of
recombinants. This phage differed phenotypically from wild-type
in two ways. First, it formed plaques that were slightly less
turbid than the wild type. Second, in prophage induction
experiments (not shown), lysogens of this phage were
induced at UV doses roughly half of those of the wild type
(see Discussion). While these differences can limit the usefulness of
this vector, as described below, its use has allowed us to gain initial
insights into
regulation that can then be explored in a more
systematic way.
Doping of the PRM promoter.
We made a pool of recombinant DNA
molecules in which 8 of the 12 bases in PRM were
randomized (Fig. 1D;
detailed in the supplemental material). We avoided the first two
positions of the 35 and 10 regions because these
overlap OR2 and OR3,
respectively (Fig. 1D),
and changes in these positions would also affect CI and Cro binding.
This approach should allow 48 different
PRM variants. This recombinant pool was cloned into
JL387, yielding about 20,000 plaque-forming phage; hence, not
all possible PRM variants were recovered. The
resulting pool of packaged phage was then
characterized.
Wild-type
forms turbid plaques because
lysogens arise in the plaque and continue to grow. By contrast, many
mutants, including those defective in CI, unable to bind CI (such as
the cloning vector), or unable to make CI due to a defect in
PRM, form clear plaques. Most of the phage in the
pool formed clear plaques, either because they had an
OR region from the vector or because
PRM was nonfunctional. To assess the fraction of
phage containing an insert, individual clear plaques formed on JL2497
were tested on JL5434, which allows phage containing the
OR region from the vector, but not those containing
an insert, to make plaques (see Materials and Methods); about half of
the clear plaques tested were recombinants. On JL2497, about 5%
of the total phage formed turbid plaques, indicating that roughly
10% of the lytically competent PRM variants
could form turbid plaques. The analysis below suggests that
recombinants that are not lytically competent are likely to be rare. In
any case, the ability of many isolates to form turbid plaques suggested
that these phages might be able to lysogenize and hence that their
PRM promoter was functional in the context of the
circuitry.
Properties of PRM variants.
We purified and further characterized
61 turbid-plaque-forming phage, picking isolates with a range of
phenotypes (Table 2). The
degree of turbidity varied substantially, from barely turbid to more
turbid than
JL351. A few isolates formed plaques more
uniformly turbid across the plaque than those of
JL351 or
wild-type
, for which the center of the plaque was more turbid
than the periphery.
From all but seven of the isolates, we could
readily isolate lysogens by streaking plaques on kanamycin plates.
Among those that lysogenized, six isolates gave small numbers of
lysogens but the colonies were healthy; most of these isolates also
formed plaques less turbid than those of the wild type. Nine other
isolates conferred a phenotype we term the unstable-lysogen phenotype;
most of the Kanr colonies of these isolates were small, with
a few large ones interspersed. Extensive analysis of another phage,
prm240, which contains a very weak
PRM promoter and confers this same phenotype,
suggests that the small colonies are single lysogens, which are barely
stable (unpublished data), while the larger colonies are multiple
lysogens. We infer, but have not confirmed directly, that the present
isolates that confer the unstable-lysogen phenotype likewise had very
weak PRM promoters and that the stability of
lysogens was improved by multiple lysogeny.
One might expect that
all of the variants forming turbid plaques would be able to form stable
lysogens, but this was not the case. Lysogens arising in a plaque might
not be stable in isolation, because the conditions in a plaque differ
from those affecting single cells streaked on a plate. Lysogens in a
plaque are frequently superinfected by phage. A phage with a weak
PRM could follow the lysogenic pathway after
infection, since CI is expressed during the establishment phase from
the much stronger PRE promoter. Hence, lysogens can
arise as a plaque grows. CI is then expressed from
PRM, which might be too weak to maintain lysogeny
in a single copy. In a plaque, superinfecting phage would also express
PRM, leading to higher CI levels through a gene
dosage effect and maintenance of lysogeny. In contrast, when cells are
isolated by streaking, superinfection no longer occurs and unstable
lysogens could switch to the lytic state. In other studies, we have
also isolated numerous derivatives of
OR323
(27) that form turbid
plaques but not stable lysogens
(27; our unpublished
data), and the
prm240 phage with the unstable-lysogen
phenotype described above forms plaques indistinguishable from those of
the wild type.
Sequence analysis of the PRM
variants revealed a wide range of PRM sequences
(Table
2). Each isolate had a different sequence; MD29 was the same as the wild
type. These sequences are further analyzed in the
Discussion. We conclude from these findings that a very wide range of
PRM sequences is compatible with at
least some functioning of the
regulatory
circuitry.
Prophage induction. All of these phage isolates were able to grow lytically (as expected, since they were isolated as plaques and since PRM has no role in lytic growth), and most could form stable lysogens, indicating that these aspects of the regulatory circuitry were functional. As a more stringent test for normal behavior of the regulatory circuitry, we asked whether the PRM variants could undergo prophage induction. In this process, often termed the genetic switch, a lysogen is induced to switch from the lysogenic state to the lytic state by induction of the host SOS regulatory system (26, 41). Treatment with DNA-damaging agents, such as UV irradiation, activates the co-protease activity of RecA (24), which mediates cleavage and inactivation of CI, leading to prophage induction.
In wild-type
,
prophage induction has several characteristics, each of which
can be assessed in the mutants. First, it gives a burst size of about
100 phage per induced cell, comparable to that seen after infection.
Second, it exhibits threshold behavior. Induction is inefficient at low
levels of DNA damage (such as that which occurs with low doses of UV
light) but abruptly becomes efficient at higher doses. Finally, and
related, this threshold behavior has a particular set point, which is
the dose at which induction becomes efficient. Mutants are known that
have changes in any one or combinations of these characteristics
(27; our unpublished
data).
To identify PRM variants resembling
the wild type, we carried out spot tests (not shown) on plates with low
and various levels of mitomycin C, an SOS-inducing agent. With
increasing mitomycin C concentrations, phage spots became progressively
less turbid. Among the isolates that appeared in this test to be as
hard as or harder to induce than
JL351, nine were selected for
further characterization. Because
JL351 differed somewhat from
the wild type in prophage induction, we cloned the variant
PRM regions into a wild-type background (see
Materials and Methods), giving variants termed MDWx.
Prophage induction experiments were performed (Fig. 2) with single lysogens of these variants. A variety of dose responses was evident. Several isolates showed curves similar to that of the wild type. Some were harder to induce, some gave a small burst size, and mutant MDW14 was scarcely induced at all. We conclude that several different PRM variants can be found that allow relatively normal prophage induction.
![]() View larger version (24K): [in a new window] |
FIG. 2. UV
induction of selected MDW phages. Nine variants of
PRM were subcloned into a wild-type (WT) background
(see text), making phages termed MDW for MD wild type. UV induction
curves were obtained for single lysogens as described in Materials and
Methods. Results of typical experiments are shown. The data in each
panel were obtained in a single
experiment.
|
With this system, we analyzed promoter
strengths for these nine PRM variants. All of those
similar to the wild type were stimulated by CI (Fig.
3A); however, all five variants differed somewhat from the wild type either
in their basal (unstimulated) levels, in the maximum level seen in the
presence of CI, or in both features. One variant, MDW28, had about the
same stimulated level but a higher basal level, three others were
stimulated to somewhat lower levels, and MDW49 was about half as strong
as the wild type, although this result is hard to interpret since MDW49
has an extra base pair at the end of the PRM
10 region. We conclude that variants similar but not identical
to wild-type PRM in this uncoupled assay were able
to substitute effectively for wild-type PRM in the
context of the intact
circuitry.
![]() View larger version (28K): [in a new window] |
FIG. 3. Promoter
activity and response to various levels of CI. Single lysogens of
phages bearing
PRM::lacZ protein
fusions were prepared. For each, two host strains were used. The first,
JL6853, contained no CI; the second, JL6740, contained pA3B2
(51), which is regulated
by the Lac repressor and makes low levels of CI. Cells were grown in
the presence of the indicated levels of IPTG, and then
ß-galactosidase levels were measured as described in Materials
and Methods. Results of a typical experiment are shown. (A and
B) Activity in the absence of OL. (C and
D) Activity in the presence of an
OL variant located distal to the lacZ
reporter. WT, wild
type.
|
JL351 was found to be about half as strong as its
counterpart lacking the XhoI site, a finding that might
account for the ease of prophage induction of
JL351
(see Discussion). PRM is also under negative autoregulation (7, 30), an effect mediated in large part by looping between CI dimers bound at the OR region and those bound at OL (7). We tested the same isolates in a reporter gene construct carrying a version of OL distal to lacZ. We found that the variant promoters also were negatively autoregulated (Fig. 3C and D), that the magnitude of this effect was similar to that seen with the wild type, and that their relative strengths were similar to those seen in the absence of OL.
|
|
|---|
Cloning vector.
Use of
JL387 allowed us to
carry out localized combinatorial mutagenesis of the
OR region. The same strategy can be used with any
restriction site that is unique to the right of the XhoI site (Fig.
1). For instance, we have
used an NsiI site located beyond cro to carry out extensive
modification of the region between this site and the XhoI site
(1).
A major
advantage of this vector is that it allows us to identify variants with
a desired behavior in the context of an intact
regulatory
circuit. In this way, promising candidates for further analysis can
readily be identified and then subjected to more intensive analysis,
much as is done for rapid screens such as two-hybrid systems or
microarrays.
As noted above, the regulatory behavior of
JL351 (the OR+ version
of this vector) was not completely wild type. The silent XhoI site in
cI (Fig. 1) is
responsible for this, at least in part. A phage carrying the XhoI site
but not the BsrGI site resembled
JL351 in prophage
induction and plaque turbidity, while a phage lacking both sites had a
set point and turbidity like those of wild-type
(data not
shown). Also, in the presence of the XhoI site the strength of
wild-type PRM was reduced by about 50%, with
or without OL (Fig.
3B and D). Perhaps these
effects result from changes in the translation efficiency of the
leaderless cI mRNA (e.g., see reference
49) or in its stability.
In addition, in other versions of the vector, we found (see
supplemental material) that minor changes at the start of the
PR transcript also affected the
circuitry, since phages with the XhoI site in cI and an SpeI
site or a Bsu36I site instead of the BsrGI site at the start of the
PR transcript formed plaques less turbid than those
of the XhoI-bearing phage. The OR region appears to
be extremely sensitive to several seemingly innocuous changes, which
makes our findings obtained with PRM variants even
more unexpected (see
below).
PRM variants. Our data indicate that many PRM sequences are compatible with relatively normal regulatory behavior. The ease with which we obtained variants with behavior close to that of the wild type strongly suggests that many possible variants in this region could substitute adequately for wild-type PRM.
We tabulated the changes both for the variants that could form stable lysogens and for those that could not (Table 3). Among the lysogenizing variants, no clear patterns emerged, except that the last position of the 10 region was usually a T. At all other positions, no base was present in more than half of the isolates. The most frequently occurring base matched the consensus at five positions out of the eight that we mutagenized and matched the wild-type PRM sequence at four positions. Possibly the 35 region was able to vary more than the 10 region. Among the much smaller set of variants forming turbid plaques but not stable lysogens, again no clear patterns were evident.
|
View this table: [in a new window] |
TABLE 3. Frequency
of bases at each
positiona
|
PRM
variants with very strong promoters might not have been identified in
our screen. In other work (J.W.L., unpublished data), we have made and
studied a phage carrying the up promoter mutation
prmup-1 (a change of the 35 region from
TAGATA to TAGACA), which makes PRM
10-fold
stronger in the absence of CI and four- to fivefold stronger than the
stimulated wild type in the presence of CI
(31).
prmup-1 has a low plating efficiency and
forms very turbid plaques that are heterogeneous in size; perhaps
singly infected cells often follow the lysogenic pathway or cannot
complete the lytic pathway. Hence, isolates with promoters as strong as
or stronger than the prmup-1 promoter might not plate
efficiently and might not have been isolated in our
screen.
Because PRM is intrinsically a rather
weak promoter, it is not surprising that many variants could provide a
promoter with roughly equivalent strength. More surprising is that it
is very difficult to predict from the sequences of the
PRM variants whether they will create a functional
promoter in the context of the
regulatory circuitry. The
PRM sequences from many of the phage that can
lysogenize bear no recognizable resemblance to the consensus site (see
reference 33).
We
observed changes in response to CI in some of the
PRM variants (Fig.
3 and Table4). At least two related
explanations are possible for this finding. First, expression of
PRM is stimulated by CI bound to
OR2. Activation involves a contact between residues
in the DNA-binding domain of CI and the
70 subunit
of RNA polymerase (19,
21,
22,
35). This contact takes
place close to the DNA. Subtle, sequence-dependent structural
variations in different 35 regions might lead to local
variations in the way
70 interacts with the
35 region, influencing the strength of this interaction, as
previously suggested
(18). Second, it is known
(13,
19) that CI stimulates
the isomerization of the closed complex to the open complex
(kf), rather than the binding step
(KB). Since this transition involves several steps
(2,
5), a mutation could alter
the response to an activator that stimulates kf by
changing which step in open-complex formation is rate limiting.
|
View this table: [in a new window] |
TABLE 4. Set
points and promoter
propertiesa
|
,
since these isolates were stimulated by CI, an effect dependent on the
exact spatial relationship between PRM and
OR2. The promoter cannot lie downstream of the
wild-type location, since the A in the AUG start codon of cI
is the first nucleotide in the mRNA. Conceivably, one or more
of the PRM variants has a different location in the
absence of CI. For instance, the MDW4 mutation creates a reasonable
35 region, TTACCA, overlapping OR2 by 3 bp
instead of 2, but this would have an 18-bp spacing with the 10
region. A version of PRM termed
34 was
made by a 1-bp deletion and created a 3-bp overlap with
OR2
(53). CI represses this
promoter, in contrast to stimulation of MDW4 by CI, so that in the
presence of CI the natural promoter must be used by
MDW4.
Although several PRM variants had
properties similar to those of the wild type in laboratory experiments,
the wild-type
promoter sequence may be more fit in nature,
since several different wild isolates of phages with lambda immunity
have the same PRM sequence as that of
.
These include HK97 (20)
and 933H (36); in
addition, we have sequenced the OR regions of
HK106, HK244, HK542, HK544, CL707, and CL715 (D. Wert and J.
W. Little, unpublished data). Interpretation of these data is
complicated by the likelihood that these phages are not reproductively
isolated from each other, but they did contain a few other changes in
and near the OR region, suggesting that gene flow
among them is not exceedingly rapid.
Do the changes in our
mutants affect other aspects of the
circuitry? Preliminary
evidence obtained with
PR::lacZ operon
fusions indicates that in the nine mutants analyzed in detail, the
strength of PR was reduced to about 70 to
90% of its wild-type value. This finding is consistent with
previous evidence (44)
suggesting that a weak UP element for PR may
overlap the 35 region of PRM.
PR is slightly stronger when the region from
66 to 42 is present than in its absence
(44), although this
region does not have this effect in a different context. An AT-rich
segment within this region matches fairly well with the upstream part
of a consensus UP element
(44), and a
PRM mutation, prm116, in the 35
region that improves this match is known to increase the strength of
PR
(9). The region changed
here in the 35 region of PRM is included
in that AT-rich segment, and the match is weakened in the nine variants
analyzed.
It is unclear whether other aspects of regulation have also been subtly altered in some variants. If so, perhaps we have chosen phages for which the balance of forces resembles those in the wild type, and restoring balance in this way is relatively straightforward. Evaluation of this possibility must await more detailed analysis of functional interactions in this region. However, comparison between the set points for prophage induction and the promoter strengths provides some evidence for other subtle changes in OR function, as we now discuss.
Prophage induction and promoter strength. Our evidence suggests a relationship between PRM strength and the set point for prophage induction. Table 4 and Fig. 4 summarize the data from Fig. 2 and 3. For MD2 and MD19, the dashed lines in Fig. 4 indicate the uncertainty in estimating the set point (Table 4). Considering the entire set of mutants, there is a clear correlation between the value of the set point and the strength of stimulated PRM.
![]() View larger version (13K): [in a new window] |
FIG. 4. Correlation
between set points and maximal promoter activities. Data from Table
4 were plotted to
illustrate a correlation between the set point for UV induction and the
maximal promoter strength observed in the presence (A) or
absence (B) of the OL site located distal
to lacZ. WT, wild type. For MD2 and MD19, dashed lines
indicate uncertainty in estimating the set
point.
|
mutant with higher CI levels, a higher UV dose might be needed because
RecA needs to remain activated longer to reduce CI levels to a critical
value. This model implies that one could predict the set point from promoter strength; that is, some function of the promoter strength would give the set point and the set point would increase monotonically as promoter strength increased. It is not straightforward to determine what this function is, for several reasons. First, it is hard to predict the CI levels expected for each promoter, owing to negative feedback, conferred mostly by looping with OL. Second, it is not clear how negative feedback and positive feedback change as CI levels drop. Third, the rate of RecA-mediated cleavage almost certainly varies with CI concentrations, both because only CI monomers are efficiently cleaved (4, 6, 11) and because the in vivo level of monomers is probably below the Km for this reaction (11).
Whatever the function relating promoter strength and the set point may be, our data are not completely consistent with the expectation of a monotonic function. Considering the wild type and the group of mutants with set points between 10 and 20 J/m2 (Fig. 4), there is little correlation between promoter strength and the set point. The most likely explanation for this disparity is that some of the changes in the mutants affect other aspects of OR function (see above). We conclude that the strength of PRM plays an important role in controlling the set point, particularly with large changes in PRM strength, but that it is not the only determinant.
The model discussed above suggests that other forces contributing to the set point are the rate of CI cleavage and the CI level at which switching becomes likely. In turn, the latter value is likely controlled by many factors. Some of these, such as cooperative CI binding and looping or efficiency of PRM mRNA translation, are unlikely to be affected by changes in PRM. Others, such as the affinity of CI for its operators or the affinity of Cro for OR3, might be modestly affected by changes adjacent to the operators. In addition, our mutations slightly reduce the strength of PR, although it is uncertain that this would have marked effects on the set point.
The term "robustness" refers to a property that describes the relative insensitivity of a system to changes in certain parameters, such as promoter strength and the affinity of DNA-binding proteins for their targets. An alternative term is "parameter sensitivity" (15, 47, 48), which quantifies how much an output (such as the set point) varies with changes in an input (such as promoter strength). The mathematical treatment of this property has not been extended to bistable switches (M. A. Savageau, cited in reference 27), so that a quantitative treatment of our findings is not possible at present. In addition, it is uncertain that only one input parameter has changed markedly. Qualitatively, however, the set point is not highly resistant to changes in promoter strength; a twofold change in promoter strength usually results in about a twofold change in the set point.
Evolution of gene regulatory circuitry.
We have previously
suggested (27) that
robustness has played an important role in the evolution of complex
circuits in two ways. First, it allows an initial circuit to take a
wide variety of forms, provided that the circuit offers a selective
advantage (the lysogenic state in the case of
). Second, as
this initial circuit is refined in the later stages of evolution,
robustness likewise allows a wider range of pathways for
refinement.
An important aspect of this refinement process is evolution of the cis-acting sites to which RNA polymerase and regulatory proteins bind. Evolution of cis-acting sites likely involves two types of changes: changing the relative arrangements and locations of these sites, including spacing between sites, and refining the exact sequences of these sites. The present findings bear primarily on the latter issue.
We find that the sequence of PRM can adopt a wide variety of forms compatible with a functional regulatory circuit. One might use the term "sequence robustness" to describe this property, but the term "robustness" is increasingly being used in different ways, and this would further confuse its meaning. Instead, we offer the term "sequence tolerance" to describe this feature. Sequence tolerance is in a sense complementary to robustness, in that sequence tolerance allows different sequences to confer the same or similar parameter values on the system, rather than making the system tolerant of changes in parameter values as robustness does.
The functional consequences of sequence tolerance are also likely to be complementary to those of robustness, for both the establishment and refinement stages of the evolutionary pathway described above. Sequence tolerance further expands the range of acceptable initial solutions to the regulatory problem. Moreover, as these initial circuits are refined during a subsequent stage of evolution, it allows this refinement process to follow a wider range of pathways. Operating together, parameter robustness and sequence tolerance greatly expand the range of accessible pathways beyond those allowed by either feature alone.
A promoter like PRM is a favorable case for sequence tolerance, since PRM is a weak promoter and multiple sequences can likely provide comparable strength. In contrast, strong promoters like PR and PL are less likely to allow this feature. Use of a weak promoter imposes additional constraints on a bistable system, however. For such systems to operate, the forces stabilizing each epigenetic state must be in balance (e.g., see references 1, 10, and 55). If a system is not in balance, one state can take over even when the other has been established. For instance, two regulatory proteins might stabilize two alternative states; if the two proteins had equal affinities for DNA and equal dimer dissociation constants but were present in markedly unequal amounts, the action of the more abundant one would eventually lead to establishment of the state it stabilized. Accordingly, a protein whose expression is driven by a weak promoter might use other mechanisms, such as tighter DNA binding or dimerization, cooperativity, or increased stability, to compensate for its lower levels.
Our
set of variants had a wide variety of phenotypes. This is also likely
to be important for evolution, in two ways. First, we do not study
(or its host) in its natural environment. This environment
almost certainly affords a wide variety of selective pressures at
different times and places. It is likely that different
PRM variants would be advantageous under different
conditions. Environmental variability would offer a further expanded
set of pathways by which the circuitry could evolve to its
present state.
Second, lambdoid phages have a
"mosaic" or modular organization, and it is thought
that modules assort rather freely among lambdoid phages during
evolution. Hence, the immunity region of
is likely to have
evolved at various times in different genome contexts that were
subjected to differing selective pressures. For instance, recent
studies with phages H-19B and 933W, which express toxins from
the late lytic pR' promoter, show that these phages have a much
lower set point for prophage induction
(28), and exhibit far
higher levels of spontaneous induction, than does
. It was
hypothesized that this low set point confers a selective advantage on
the lysogen: If a small fraction of the bacterial population undergoes
induction, the resulting toxin causes diarrhea in the
vertebrate host, dispersing the surviving bacterial cells in the
environment and promoting their spread. In contrast, we have argued
that the set point of
is optimized to allow prophage
induction to occur efficiently only at doses of DNA damage likely to
kill the host cell.
Shifting selective pressures might
facilitate the evolution of PRM sequences. If an
immunity region with a PRM with strength comparable
to that of
became associated with a toxin-producing late
region, selective pressure for a weakerPRM might result. In a later step, loss of the
toxin genes would change the selective pressures, favoring a stronger
PRM, but possibly one with a different sequence. We
suggest that variable contexts provide yet another way to expand
greatly the number of possible pathways for evolution of
cis-acting sites such as
PRM.
We are grateful to Stanley Brown, Piero Bianco, Don Court, and Gary Gussin for helpful discussions; Tarlochan Dhillon, Ian Dodd, David Friedman, and Shota Atsumi for communicating unpublished results; Tarlochan Dhillon and Bob Weisberg for strains; Ian Dodd, Andrea Watson, and Naomi Franklin for plasmids; and Carol Dieckmann, Andrea Watson, and Gary Gussin for helpful comments on the manuscript. We thank Alex Blumenkron, Kantad Supamit, and Louise Lin for excellent technical assistance.
Supplemental
material for this article may be found at
http://jb.asm.org/. ![]()
Present
address: Department of Pediatrics, University of Colorado Health
Sciences Center, Denver, CO 80262. ![]()
|
|
|---|
. Genes
Dev.
18:2086-2094.
cI protein to
RecA-mediated proteolysis. J. Mol. Biol.
152:815-820.[CrossRef][Medline]
CI
repressor. Genes Dev.
18:344-354.
: explicit programming and responsiveness. Annu.
Rev. Genet.
14:399-445.[CrossRef][Medline]
gt10 and
gt11, p.49
-80. In D. Glover (ed.),
DNA cloning: a practical approach, vol. I. IRL Press, Inc., Boca Raton,
Fla.
70 that
result in defects in phage lambda repressor-stimulated transcription.J. Bacteriol.
176:2991-2998.
. I. OR3 and autogenous
negative control by repressor. J. Mol. Biol.
139:147-161.[CrossRef][Medline]
. II. OR1,
OR2, and OR3: their roles in
mediating the effects of repressor and cro. J. Mol.
Biol.
139:163-194.[CrossRef][Medline]
CI, and UmuD by site-directed mutagenesis of
recA. J. Bacteriol.
182:1659-1670.
70
region 4 involved in transcription activation by
cI. J.
Mol. Biol.
324:17-34.[CrossRef][Medline]
and higher
organisms. Cell Press and Blackwell Scientific Publications, Cambridge,
Mass.
cI gene. Nature
276:301-302.[CrossRef][Medline]
repressor and P22 repressor dimers.Genes Dev.
8:1212-1223.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»