Previous Article | Next Article ![]()
Journal of Bacteriology, December 2004, p. 8193-8206, Vol. 186, No. 24
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.24.8193-8206.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Pediatric Dentistry, Goldman School of Dental Medicine, Boston University, Boston, Massachusetts
Received 2 July 2004/ Accepted 8 September 2004
|
|
|---|
|
|
|---|
The transition from a planktonic existence to sessile growth occurs primarily in response to environmental cues. Oral biofilms are highly structured, have distinct architecture, and are capable of adapting to abrupt changes in environmental conditions such as O2 levels, nutrient availability, and acidification (24, 57). For example, oxygen levels in the environment have been shown to affect biofilm formation of oral streptococci on abiotic surfaces (6).
Although often considered to be relatively anaerobic, oral biofilms have active oxygen metabolism and biofilm bacteria, including anaerobes, and have developed defenses against oxidative stress (30). In subgingival biofilms, the measured residual oxygen levels were sufficient to allow for oxygen metabolism by organisms considered to be extremely anaerobic, such as Treponema denticola, which metabolize oxygen by means of NAD (or NADH) oxidases and produce the protective enzymes superoxide dismutase and NADH peroxidase (30).
Oral streptococci are facultative anaerobes found mainly in supragingival biofilms. The oxidative capabilities of streptococci have been observed, such as the aerobic pathway for glucose oxidation in Streptococcus agalactiae (33). An unavoidable by-product of the aerobic lifestyle is oxidative stress, as O2 and H2O2 are generated by the auto-oxidation of components of the respiratory chain. Both aerobic and anaerobic bacteria have adaptive responses to elevated levels of oxidative stress, probably by sensing the increased levels of reactive oxygen species and by transducing the signal into increased expression of defense activities (50). Exposure to reactive oxygen intermediates can damage proteins, nucleic acids, and cells (50). To counter this, bacterial cell membranes constitutively express enzymes that detoxify the reactive oxygen species and repair the damage caused. Quinones are widely distributed in nature and play vital roles in management of oxidative stress and gene regulation (47). Ubiquinone is a bacterial respiratory quinone that functions as a redox mediator in aerobic respiration and retains antioxidant activity only in its reduced state. In Escherichia coli, a soluble quinone oxidoreductase (Qor) complexed with NADPH maintains ubiquinone in its reduced state, thereby promoting its antioxidant function (47).
A number of oxidative stress response systems have been identified in streptococci. In Streptococcus pyogenes, the PerR regulator, which is involved in the regulation of oxidative stress responses and iron homeostasis, also contributes to virulence (40). Two distinct oxygen-inducible NADH oxidases have been identified in Streptococcus mutans (17). LuxS-mediated quorum sensing in S. mutans has recently been shown to be involved in the regulation of oxidative stress and acid tolerance as well as biofilm formation (57). Inactivation of msrA in S. gordonii increased sensitivity to hydrogen peroxide, suggesting a role for streptococcal MsrA, a methionine sulfoxide reductase homolog, in protecting against oxidative stress (54).
This study reports the isolation and characterization of a S. gordonii Tn917-lac biofilm-defective mutant, which harbors a unique transposon insertion at a locus we designated nosX, part of a putative oxygen stress response (osr) operon. The osr operon consists of three genes, nosX and two Qor genes, the qor1 and qor2 genes. Results from the present study suggest that these genes are regulated by environmental oxygen levels, are likely to be involved in bacterial response to oxidative stress, and probably play a significant role in the development of biofilms.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Oligonucleotide primers used in this studya
|
Localization of transposon insertion site and sequence analyses. The location of the transposon insertion was determined by sequence analysis of the region flanking the transposon as described previously (27). Briefly, pBluescript vector and chromosomal DNA from the mutant were digested with HindIII, purified, ligated, and used as a PCR template to amplify the Tn917 junctional region. The sequence obtained from the PCR product was compared with sequences in GenBank using the BLASTX and TBLASTN programs (1) to identify homologous bacterial sequences. Amino acid sequence alignments and phylogenetic analyses were performed and analyzed with the AlignX program in Vector NTI (Informax, Inc., Bethesda, Md.).
Biofilm assays. The in vitro biofilm formation assays of S. gordonii Challis 2 and the biofilm-defective Challis::Tn917-lac mutant were performed with biofilm medium (BM) as previously described (27, 28). In addition to the microtiter plate biofilm assay, biofilm formation of S. gordonii Challis 2 and the biofilm-defective mutant was assayed on borosilicate glass coverslips suspended in BM in 50-ml Falcon tubes. The biofilm bacteria present on the glass coverslip were visualized directly by phase-contrast microscopy. Images were captured with a Nikon Coolpix 4500 digital camera, as described previously (28).
Biofilm formation was also assessed with a flow cell system (36) and visualized by confocal scanning laser microscopy (CSLM). A glass flow cell (BioSurface Technologies Corp., Bozeman, Mont.) containing a flow channel, 0.2 mm deep by 11.4 mm wide by 40.6 mm long, was used. The substratum consisted of a microscope glass coverslip. An overnight BHI culture was washed twice and resuspended in BM. An inoculum from this suspension was introduced in a 250-µl volume (2 x 107 cells) and allowed to bind to the surface by inversion of the flow cell for 15 min without flow, after which BM was pumped through the flow cell channel at a rate of 200 µl per min. After bacteria were grown in the flow cell at 37°C for 18 h, CSLM was used to examine the spatial organization of the biofilm formed in situ. After staining with the LIVE/DEAD bacLight bacterial viability stain according to the manufacturer's instructions (Molecular Probes, Eugene, Oreg.), cells were visualized with an air objective (magnification, x20) with a TCS SP2 confocal microscope (Leica LaserTechnik GmbH, Heidelberg, Germany) equipped with an argon-krypton laser. Images were collected and analyzed with Image-Pro Plus computer software (Media Cybernetics, Silver Spring, Md.).
Image analysis of each strain was performed using five image stacks acquired from random positions of the flow channel, approximately 5 mm from the inlet. Images were acquired at 5-µm intervals down through the biofilm; therefore, the number of images in each stack varied according to the thickness of the biofilm. The data were processed using COMSTAT software (16). The parameters chosen to characterize the biofilm structures are total biomass, average thickness, area occupied, substratum coverage, and roughness coefficient of the biofilm.
Reverse transcription-PCR (RT-PCR) of S. gordonii Challis 2 RNA. To characterize the transcription of the S. gordonii nosX gene, RT-PCR was performed using total RNA extracted from S. gordonii Challis 2 grown to mid-log phase (A600 of 0.3 to 0.4). RNA was purified from bacterial cells with an RNeasy minikit (QIAGEN) and DNase I was treated as previously described (28). Primers O2P1 and OP2, specific for an intergenic region that spans nosX to qor2, were used (Table 1). RT-PCR was performed with the Access RT-PCR system (Promega) under the conditions described previously (28). The RT-PCR products were visualized after 1% agarose gel electrophoresis. Strain Challis 2 DNA was used as the positive control, and the negative controls without reverse transcriptase were used to ensure that there was no contaminating DNA in each DNase I-treated RNA sample.
Construction and characterization of nosX, qor1, and qor2 mutants. PCR ligation mutagenesis with vectorless intermediates was used to construct nosX, qor1, and qor2 deletion mutants (28). A kanamycin resistance gene, kan, amplified from plasmid pSF151 (51), was used as the antibiotic marker insert (Table 1). PCR products of the 5'- and 3'-flanking region and the kan cassette were ligated and used for transformation of S. gordonii Challis 2 as described previously (28). The segment of nosX which encodes residues 30 to 299 of the predicted 320-amino-acid NosX on the chromosome of S. gordonii was replaced with kan to generate a mutant with a nosX::Kanr allele. The two downstream genes, qor1 (residues 28 to 173 of the predicted 201-amino-acid sequence) and qor2 (residues 25 to 381 of the predicted 414-amino-acid sequence), were also replaced with kan to generate mutants with either a qor1::Kanr or qor2::Kanr allele, respectively. Transformants were plated on BHI agar containing 350 µg of kanamycin per ml and incubated at 37°C anaerobically for 3 to 5 days. RT-PCR was performed as described above with RNA isolated from nosX::Tn917-lac, nosX::Kanr, and qor1::Kanr mutants to determine whether these strains possessed a polar or a nonpolar mutation. S. gordonii Challis 2 RNA was used as a control.
The growth rates of S. gordonii Challis 2 strain and nosX::Tn917-lac, nosX::Kanr, qor1::Kanr, and qor2::Kanr mutants were assessed by inoculating the strains from an overnight THBYE culture into fresh THBYE (10 ml) and growing them at 37°C under anaerobic and static aerobic conditions. Bacterial growth was quantified by recording the absorbance at 600 nm at regular intervals over 24 h.
A disk diffusion assay modified from Vriesema et al. (54) was used to determine the susceptibility of bacteria to H2O2. Briefly, 100 µl of bacteria (106 CFU/ml) grown to exponential phase in BHI was added to 2 ml of liquid 0.7% BHI agar at 45°C and layered onto BHI plates (prewarmed to 37°C in an incubator). An 8-mm filter paper disk containing 10 µl of H2O and 1, 2, or 4 M H2O2 was placed on the plate. The plates were incubated overnight at 37°C, and the zone of growth inhibition was measured. All assays were performed in triplicate, and results were reproducible within a range of ±1 mm. No growth inhibition was seen in disks containing H2O. To assess the sensitivity of bacteria to the superoxide-generating agent paraquat, overnight cultures were inoculated in fresh BM containing 0.1 mM paraquat (40). After 72 h of incubation at 37°C, bacterial growth, recorded as absorbance at 575 nm, was expressed as a percentage of the growth in BM with no paraquat. The ability of S. gordonii Challis 2, nosX::Tn917-lac, nosX::Kanr, qor1::Kanr, and qor2::Kanr strains to form biofilms was assessed on a microtiter plate, on a glass surface using phase-contrast microscopy, and in a flow cell system with CSLM as described above.
Expression of nosX in different environmental conditions. To study the regulation of nosX expression, ß-galactosidase activity of the biofilm-defective S. gordonii nosX::Tn917-lac mutant was determined by a fluorimetric assay (28) using 4-methylumbelliferyl-ß-D-galactoside (MUG). The effect of growth phase on the expression of nosX was examined by measuring the ß-galactosidase activity of the nosX::Tn917-lac mutant grown in THBYE under anaerobic conditions over 24 h. To determine the effects of various substrates on nosX expression, cells were grown in BM under the conditions described previously (28), in BM under static aerobic conditions, and in BM under anaerobic conditions in the presence of oxidizing agents (paraquat and H2O2), reducing agents (cysteine hydrochloride and dithiothreitol), FeCl3, thiamine pyrophosphate, and thiamine monophosphate.
Real-time quantitative RT-PCR. To independently and directly assess transcriptional changes of nos, qor1, and qor2 genes in various environmental conditions, real-time quantitative RT-PCR was performed with the ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, Calif.) as described previously (14). The primer pairs used (Table 1) were developed from the S. gordonii genome database with Primer Express (Applied Biosystems) for uniformity in amplicon size (approximately 100 bp) and melting temperature. Expression levels of the nosX, qor1, qor2, nox (NADH oxidase), and ahpC (alkyl hydroperoxide peroxidase C) genes were examined. RNA was extracted from S. gordonii Challis 2 biofilm and planktonic cultures and from cells grown under aerated aerobic (on a shaker-incubator at 250 rpm), static aerobic, and anaerobic conditions. Total RNA was extracted from cells grown in BM to mid-log phase as described previously (28). RNA was also isolated from the four mutant strains and Challis 2 grown to mid-log phase in BM under anaerobic conditions. Three independent RNA preparations from three separate experiments of each particular growth condition were used for real-time PCR analysis. RNA concentrations were normalized by using amplification of the 23S rRNA gene of S. gordonii as an internal standard. For each RT-PCR, cDNA synthesis and PCR amplification were performed in a two-step reaction mixture. RT was performed with DNaseI-treated RNA with the Taqman RT reagent kit (Applied Biosystems). Each 50-µl reaction mixture containing 5.5 mM MgCl2, 500 µM each deoxynucleoside triphosphate, 0.4 U of RNase inhibitor/µl, 1.25 U of reverse transcriptase/µl, 2.5 µM reverse primer, and 10 ng of total RNA in a 1x RT buffer was incubated at 48°C for 30 min, followed by 95°C for 5 min. Real-time PCR amplifications were then performed in triplicate with the SYBR Green PCR master mix (Applied Biosystems) according to the manufacturer's instructions in 50-µl reaction mixtures that contained 1x SYBR Green I PCR master mix, 300 nM forward primer, 50 nM additional reverse primer, and 5 µl of cDNA template. PCR conditions included an initial denaturation at 95°C for 10 min, followed by a 50-cycle amplification, with each cycle consisting of denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Primer pairs were checked for primer-dimer formation by omitting the RNA template in the two-step RT-PCR. As an additional control for each primer pair and each RNA sample, the cDNA synthesis reaction was carried out without reverse transcriptase to identify contamination of RNA samples by residual genomic DNA.
Ten-fold serial dilutions of cDNA were employed to generate standard curves to determine the sensitivity of the assay for the detection of each gene. The value used for quantitation and comparison was the threshold cycle (CT), defined as the number of cycles required to cross the midpoint of the detectable amplification curve, which was normalized to a passive reference dye (carboxy-X-rhodamine) included in each reaction. Real-time PCR analysis was performed on three independent RNA preparations from three separate cultures. For each target gene, the CT values for RNA prepared from different growth conditions were compared. Expression levels for each gene in each environment are presented as relative fold induction. Student's t test with an alpha level of 0.05 was used to calculate the significance of the difference between the mean expression levels of a particular gene in two different growth conditions or strains.
Sequences. DNA and protein sequences used in this study were retrieved from the National Center for Biotechnology Information genomic BLAST pages that contain sequences of completed and unfinished microbial genomes (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi).
|
|
|---|
![]() View larger version (38K): [in a new window] |
FIG. 1. (A) Southern hybridization of HindIII-digested DNA from Tn917-lac biofilm-defective S. gordonii nosX::Tn917-lac mutant. A digoxigenin-labeled pTV32-OK containing Tn917-lac (which has two HindIII sites) was used as the probe. Three hybridizing bands were produced in HindIII-digested DNA, demonstrating the presence of a single transposon insertion. (B) Biofilm phenotypes of S. gordonii Challis 2 and nosX::Tn917-lac mutant as determined by the polystyrene microtiter plate assay and direct observation of biofilms formed on borosilicate glass surfaces by phase-contrast microscopy. Cells were grown in BM for 24 h at 37°C under anaerobic conditions.
|
Genetic organization and phylogenetic analyses of the putative osr operon. Located downstream of the transposon insertion locus, nosX, are two ORFs that encode proteins homologous to Qors, which we designated qor1 and qor2 based on sequence homology. Immediately downstream of qor2 is a palindromic sequence (TAAGTAAAAAAAGAAT), which begins with the qor2 stop codon (TAA). Another palindrome (ACCTTTAAAATTTAATTTACCA) was identified 216 bp upstream from the start codon of nosX.
NosX. The 960-bp nosX ORF encodes a 320-amino-acid sequence with a predicted molecular mass of 35.7 kDa. The homologs to NosX that were found are NosX of R. eutropha (accession no. AAP86003), NosX of P. putida (58), NosX of Rhizobium meliloti (8), and ApbE of S. enterica serovar Typhimurium (3). NosX also has homology in the C-terminal domain with RnfF of Rhodobacter capsulatus, an iron-sulfur secretory membrane protein with a signal sequence of 44 amino acids involved in electron transport to nitrogenase (45). The N-terminal portion of R. capsulatus RnfF contains a cysteine motif (C-X3-C-X-C-X2-C) typical of 4Fe-4S proteins. In contrast, another homolog, NosX of R. meliloti, is a peripheral membrane protein involved in N2O reduction that contains only one cysteine residue, lacks cysteine motifs, and is not an iron-sulfur protein (8). Similarly, S. gordonii NosX does not contain any cysteine residues and therefore is probably not an Fe-S protein. S. gordonii NosX does not have a transmembrane helix, a secretory leader sequence, or a lipoprotein peptide signal cleavage sequence, indicating it is not a lipoprotein (Fig. 2). The N-terminal of NosX does not contain the conserved twin-arginine type of signal peptide found in the NosX of Paracoccus denitrificans (43), suggesting it is not a metalloprotein.
|
View larger version (35K): [in a new window] |
FIG. 2. Alignments of the deduced amino acid sequences of S gordonii nosX with homologs in R. eutropha (accession no. AAP86003) and S. enterica serovar Typhimurium (accession no. AAC46116) with the AlignX program of Vector NTI (Informax). Amino acids that are identical and conserved are highlighted in dark grey and light grey, respectively. A black arrow marks the position of the Tn917-lac insertion in the nosX::Tn917-lac mutant. Residues homologous to a NADH-ubiquinone oxidoreductase chain 2 (I) and NADH dehydrogenase (II) signature sequences are underlined.
|
Qor1. The two ORFs located downstream of nosX encode proteins that are homologous to the NAD(P)H Qor family of reductases. The 603-bp qor1 starts 20 bp downstream of the nosX stop codon and is predicted to encode a 201-amino-acid peptide with a predicted molecular mass of 22.6 kDa. The homologs of Qor1 found are YieF of E. coli, a hypothetical protein which contains an NADPH-dependent reductase protein motif, and two Qors, MdaB of Helicobacter pylori (55) and Nqr of the plant Arabidopsis thaliana (48).
Amino acid residues 2 to 167 of S. gordonii Qor1 were homologous to NADPH-dependent flavin mononucleotide (FMN) reductases. FMN reductases, such as SsuE of E. coli (53), catalyze the reaction NAD(P)H + FN = NAD(P) + FMNH (2). Also present are NAD(P)H dehydrogenase (quinone) motifs at residues 63 to 108 and 141 to 191 and a possible transmembrane helix at residues 83 to 100.
Qor2. The qor2 ORF was 1,242 bp in length, starting 18 bp downstream of the qor1 stop codon. It encodes a deduced 414-amino-acid peptide with a predicted molecular mass of 45.7 kDa. Qor2 also shares significant homology with the oxidoreductases Qor and YieF of E. coli and Nqr of A. thaliana. Amino acid residues 1 to 163 of S. gordonii Qor2 were homologous to the NADPH-dependent FMN reductases, whereas residues 181 to 371 were homologous to oxidoreductases.
In many bacteria, qor genes are unique in the genome, an exception being Staphylococcus aureus, which possesses two qor genes located adjacent to each other that share 26.2% identity (31). Two qor genes are also present in S. gordonii, which encode the highly homologous proteins Qor1 and Qor2. Qor1 and Qor2 share 19.0% identity and 28.2% similarity; however, this homology is limited to the N terminus of Qor2 (Fig. 3). Qor2 is homologous to YieF of E. coli and two Qors, MdaB of H. pylori (55) and Nqr of the plant A. thaliana (48). Similar to QOR of E. coli, Qor1 of S. gordonii contains the Qor nucleotide-binding fingerprint motif AXXGXXG (Fig. 3), which is the result of the insertion of an alanine residue in the fingerprint region of the nucleotide-binding domain (52). On the other hand, S. gordonii Qor2 contains an alcohol dehydrogenase-type NAD(P)H-binding motif, GXGXXG (37) but does not possess the Qor nucleotide-binding motif (Fig. 3). Likewise, one of the two Qors in S. aureus, QorA, contains an NAD(P)H-binding motif, while the second downstream Qor homolog contains an alcohol dehydrogenase-type NAD(P)H-binding motif sequence (31). A copper/zinc superoxide dismutase motif identified in Qor2 (residues 373 to 406) is not found in Qor1, suggesting that Qor2 may be involved in degradation of oxygen radicals. In addition, there are two His residues at the N-terminal of Qor2 that are absent from Qor1, which may be a putative metal-binding site (Fig. 3).
![]() View larger version (45K): [in a new window] |
FIG. 3. Alignments of the deduced amino acid sequences of S. gordonii oxidoreductases Qor1 and Qor2. Amino acids that are identical and conserved are highlighted in dark grey and light grey, respectively. A Qor nucleotide-binding motif present in Qor1 is boxed. In Qor2, an NAD(P)H binding motif (I) and an NADP binding motif (II) are underlined, while two His residues are marked with an asterisk.
|
![]() View larger version (29K): [in a new window] |
FIG. 4. Organization of the putative nos operon in different streptococci, as determined by sequences from their completed and unfinished microbial genome databases (http://www.ncbi.nih.gov). The nosX genes in the mitis group (S. gordonii, S. pneumoniae, and S. mitis), S. mutans, and S. agalactiae are contiguous with qor1 and qor2, whereas only the nosX gene was identified in S. pyogenes. In S. mutans, S. agalactiae, and S. pyogenes, an additional ORF located upstream of nosX is transcribed in the same direction and encodes an oxalocrotonate tautomerase. ORFs transcribed in the same direction as nosX are shown in grey.
|
AhpC. Another ORF oriented in the opposite direction was identified downstream of qor2, with a stop codon 53 bp from the stop codon of qor2. It encodes a 186-amino-acid protein homologous to the thiol-specific antioxidant protein/alky hydroperoxide peroxidase C (AhpC) family of proteins (7), and was therefore designated AhpC. The thiol-specific antioxidant/AhpC family is a type of peroxidase that provides defense against oxidative stress by reducing hydroperoxides, by using thioredoxin and other thiol-containing reducing agents (19, 38). The deduced S. gordonii AhpC amino acid sequence is homologous to AhpC of Bacillus cereus (GenBank accession no. NP_979929) and AhpC of S. mutans (38).
RT-PCR with RNA from the Challis 2 strain using primers O2P1 and O2P2 (Table 1), which are specific for a 1,018-bp region that spans the nosX and qor2 intergenic region produced a product of the predicted size (Fig. 5B, lane 3). Fidelity of the primers used was confirmed by PCR with Challis 2 DNA as the template (Fig. 5B, lane 2). These results demonstrate that nosX, qor1, and qor2 are cotranscribed as a single operon. The two adjacent genes, which are the putative nox and ahpC genes, are divergently transcribed. Therefore, the putative osr operon in S. gordonii consists of the three ORFs, nosX, qor1, and qor2.
![]() View larger version (64K): [in a new window] |
FIG. 5. RT-PCR analysis of RNA extracted from S. gordonii Challis 2 and nosX::Tn917-lac strains. (A) The organization of nos and adjacent genes, location of primers, and predicted size of successfully amplified RT-PCR products are shown. See Table 1 for all primers used. The black arrow denotes the position of the Tn917-lac insertion in the biofilm-defective mutant. (B) RT-PCR analysis of transcripts of the ORFs within the putative nos operon. The total RNA extracted from the Challis 2, nosX::Tn917-lac, nosX::Kanr, and qor1::Kanr strains was used as the template. Challis 2 DNA was used as the positive control to verify the fidelity of the primers used. Lanes: 1, 1-kb DNA marker; 2, Challis 2 DNA with primers O2P1 and O2P2 (spans nosX-qor2; 1,018 bp); 3, Challis 2 RNA with primers O2P1 and O2P2; 4, Challis 2 DNA with primers O1P3 and O1P4 (spans qor1-qor2; 858 bp); 5, Challis 2 RNA with primers O1P3 and O1P4; 6, nosX::Kanr RNA with primers O1P3 and O1P4; 7, nosX::Tn917-lac RNA with primers O1P3 and O1P4; 8, Challis 2 DNA with primers O2RT5' and O2RT3' (within qor2; 111 bp); 9, Challis 2 RNA with primers O2RT5' and O2RT3'; 10, qor1::Kanr RNA with primers O2RT5' and O2RT3'; 11, nosX::Tn917-lac RNA with primers O2RT5' and O2RT3'.
|
![]() View larger version (33K): [in a new window] |
FIG. 6. Effect of different growth conditions on nosX expression. The biofim-deficient nosX::Tn917-lac mutant was grown at 37°C under anaerobic conditions unless otherwise specified. The ß-galactosidase activities of the nosX-lacZ transcriptional fusion were quantified with MUG (28). All assays were performed in triplicate, and mean values and standard deviations of the ß-galactosidase activities are shown. MU, 4-methyl-umbelliferone. (A) Relation between growth phase and nosX expression. The nosX::Tn917-lac mutant was grown in THBYE. Growth and ß-galactosidase activity at various times over 24 h are shown. (B) Effects of different concentrations of various substrates on nosX expression. The nosX::Tn917-lac mutant was grown in BM with different substrates or under static anaerobic conditions as indicated.
|
RT-PCR with primers spanning the qor1 and qor2 intergenic region successfully obtained a PCR product of the predicted size from RNA isolated from S. gordonii Challis 2 but not from nosX::Tn917-lac RNA (Fig. 5B, lanes 5, 7, and 11), indicating that the transposition resulted in a polar nosX::Tn917-lac mutation. RT-PCR results confirmed that the nosX and qor1 mutations constructed were nonpolar (Fig. 5B, lanes 6 and 10). Fidelity of the primers used was confirmed by PCR with Challis 2 DNA as the template (Fig. 5B, lanes 4 and 8). RT-PCR with Challis 2 RNA as the template (Fig. 5B, lanes 5 and 9) verified the presence of the transcript in S. gordonii under the conditions used for RNA extraction.
Biofilm formation of nosX::Tn917-lac (A575 ± standard deviation, 0.72 ± 0.32), nosX::Kanr (A575 ± standard deviation, 1.05 ± 0.12), qor1::Kanr (A575 ± standard deviation, 2.90 ± 0.18) and qor2::Kanr (A575 ± standard deviation, 1.64 ± 0.83) mutants were at levels all lower than that of the Challis 2 strain (A575 ± standard deviation, 4.63 ± 0.05). When compared to the Challis 2 strain, the polar mutation in nosX::Tn917-lac resulted in a 84% reduction in biofilm formation, while inactivation of nosX, qor1, and qor2 resulted in 77, 37, and 65% reduction in biofilm formation, respectively. The most significant reductions in biofilm formation were observed when either the whole operon or nosX was inactivated. These results suggest that all three genes may be involved in biofilm formation of S. gordonii.
Growth assays. Under static aerobic conditions, two of the mutant strains, nosX::Tn917-lac and nosX::Kanr, grew at a slower rate than the Challis 2 strain (Fig. 7A), indicating that nosX and qor1 probably play a role in the growth of S. gordonii in the presence of higher levels of O2. However, the final growth yields of both mutants after 24 h were not significantly different from that of Challis 2. It is likely that there is minimal oxygen diffusion during static growth into the cultures and that the culture may become relatively anaerobic. Therefore, the differences observed in the growth rate of these two mutants appear to be an extension of the lag period.
![]() View larger version (56K): [in a new window] |
FIG. 7. Oxidative stress assays. (A) Growth curves of S. gordonii Challis 2, nosX::Tn917-lac, nosX::Kanr, qor1::Kanr, and qor2::Kanr strains in 10 ml of THBYE broth over 24 h at 37°C under static aerobic conditions. Growth was measured as absorbance at 600 nm. All assays were performed in triplicate, and mean values and standard deviations are shown. (B) A disk diffusion assay was performed to compare the H2O2 sensitivity of S. gordonii Challis 2, nosX::Tn917-lac, nosX::Kanr, qor1::Kanr, and qor2::Kanr mutant strains. All assays were performed in triplicate, and mean values and standard deviations are shown. (C) A growth assay was performed to compare the sensitivity of S. gordonii Challis 2 and nosX::Tn917-lac, nosX::Kanr, qor1::Kanr, and qor2::Kanr mutant strains to paraquat. Cells were grown in 100 µl of BM under anaerobic conditions in the presence of 1 mM paraquat. The bacterial growth (A575) at 72 h was measured and expressed as the percentage of growth relative to BM without paraquat. Strains marked with an asterisk (nosX::Kanr and qor1::Kanr) denote significant difference and when compared to the Challis 2 strain were significantly lower than Challis 2 (P < 0.05). All assays were performed in triplicate, and mean values and standard deviations are shown. (D) Biofilm phenotypes of S. gordonii nosX::Kanr, qor1::Kanr, and qor2::Kanr strains were determined by the polystyrene microtiter plate assay; direct observation of biofilms formed on borosilicate glass surfaces was compared by phase-contrast microscopy. Cells were grown in BM for 24 h at 37°C under anaerobic conditions.
|
Phase-contrast and confocal microscopy analysis of biofilms. In addition to the microtiter plate biofilm assay, biofilm formation of nosX::Kanr, qor1::Kanr, and qor2::Kanr on borosilicate glass coverslips was examined 24 h after inoculation. The ability of these strains to form biofilms was confirmed by direct visualization of the biofilm formation on the glass surfaces using phase-contrast microscopy (Fig. 7D). After incubation for 24 h, the Challis 2 strain formed large clusters of cells that were interspersed with sparsely covered areas. A number of dense microcolonies were also observed. In contrast, significantly fewer cells from the nosX, qor1, and qor2 mutant strains had attached, forming a scattered pattern that was markedly different from that of the Challis 2 biofilm, with large areas that were devoid of cells. The biofilm phenotypes of the nosX, qor1, and qor2 mutants suggest that these genes are important for biofilm formation.
Confocal microscopy was carried out to assess whether the mutant strains could form biofilms in a flow cell system and how these biofilms differ when compared to the S. gordonii Challis 2 strain. The biofilms formed by the mutant strains appeared to contain significantly fewer cells than biofilms formed by Challis 2 (Fig. 8). The Challis 2 biofilm was characterized as a thick, compact biofilm containing dense clusters of cells. In contrast, the mutant biofilms contained sparse clusters made up of a much smaller number of cells. Similar amounts of live (green) to dead (red) bacteria were observed in the biofilms of all the S. gordonii strains examined.
![]() View larger version (115K): [in a new window] |
FIG. 8. Confocal scanning laser microscopic analysis of S. gordonii biofilms in a flow-cell system. S. gordonii Challis 2 (A), nosX::Tn917-lac (B), nosX::Kanr (C), qor1::Kanr (D), and qor2::Kanr (E) strains were grown in BM in a BST FC71 flow cell unit (flow rate, 180 µl/min; initial inoculum, A660 = 0.1) over 18 h at 37°C. Live cells were stained with SYTO-9 (green), and dead cells were stained with propidium iodide (red); cells were then examined by confocal microscopy. A representative image from a set of randomly selected x-y stacks is shown for each strain. Bars, 100 µm. The small inset in each panel represents a 10x magnification of the panel.
|
|
View this table: [in a new window] |
TABLE 2. COMSTAT analysis of CSLM images of biofilms formed by S. gordonii strains in a flow cell systema
|
|
View this table: [in a new window] |
TABLE 3. Quantification of nosX, nox, and ahpC transcript levels by real-time RT-PCRa
|
|
View this table: [in a new window] |
TABLE 4. Quantification of nosX, nox, and ahpC transcript levels by real-time RT-PCRa
|
These results suggest that expression of nosX, qor1, qor2, nox, and ahpC genes are tied to oxygen levels whereas expression of nosX, qor1, qor2, and nox genes are tied to a sessile mode of growth. The relative increases in the expression of nosX, qor1, qor2, nox, and ahpC genes observed during aerobic conditions suggest that this region constitutes an island responsible for dealing with oxidative stress that may also be associated with biofilm formation. As real-time quantitative RT-PCR is based on the amplification of mRNA, results obtained will only reflect transcriptional processes; extension of the results to the protein level is beyond the scope of this study.
|
|
|---|
Qors found in bacteria are involved in the respiratory chain and are important factors in the response to oxidative stress (18, 52). The expression of QorA, an NADPH-dependent Qor in S. aureus, which catalyzes a one-electron reduction of quinone, is enhanced by oxidative stress (31). MdaB, an NADPH quinone reductase in H. pylori, has been shown to play an important role in managing oxidative stress and colonization of the mouse stomach (55).
Mutagenesis of each of the three ORFs, nosX, qor1, and qor2, resulted in biofilm-defective phenotypes when examined in a polystyrene microtiter plate biofilm assay, on borosilicate glass, and in a flow cell system. Quantitative analysis of the biofilm structure also confirmed that the biofilms formed by nosX, qor1, and qor2 mutants were significantly different than those formed by the Challis 2 biofilm.
The expression of nosX in S. gordonii is growth phase dependent and induced by aerobic growth and paraquat. Paraquat isa redox compound that is reduced by low-potential electron donors inside the bacterial cell and then oxidized by molecular oxygen, thereby generating superoxide in the cytoplasm (15). The toxicity of paraquat depends upon its entry into cells, which leads to increased intracellular production of the superoxide radical O2. The observation that the nosX::Tn917-lac fusion was induced by paraquat but not H2O2 suggests that external H2O2 has no significant effect on nosX expression in S. gordonii. This heterogeneity in oxidative stress susceptibility has also been observed in a S. pyogenes mutant where the perR gene, which is involved in oxidative stress response and iron homeostasis, was inactivated (40). It may be due to the cells producing enough superoxide dismutase to handle moderate levels of oxidative stress in the form of intracellular O2 generated by paraquat.
In this study, significant increases were observed in the abundance of mRNA encoding NosX in RNA derived from biofilm cells grown on both glass and plastic surfaces. When flanking genes of the osr operon were examined, the expression of nox was increased in biofilm cells, but ahpC expression levels were similar in both biofilm and planktonic cells. These results provide further evidence that the osr operon and nox gene play a role in biofilm formation. A Nox homolog in S. pneumoniae is involved in modulating the level of genetic transformability and virulence of S. pneumoniae in response to oxygen concentration (11). A recent study that examined S. mutans protein expression during the initial stage of biofilm formation identified an NADH oxidase as being enhanced 2.1-fold in biofilm cells compared to planktonic cells (56). Examination of the S. mutans UA159 genome identified two NADH oxidases, which correspond to the H2O2-forming oxidase (Nox1) that functions as part of an alkyl hydroperoxide reductase system and the H2O-forming NADH oxidase (Nox2), which plays an important role in aerobic energy metabolism in S. mutans (17).
Expression of both nox and ahpC was significantly increased in cells grown under aerated and static aerobic conditions when compared to anaerobic conditions. Most thiol peroxidase genes, such as the bcp gene of E. coli, are inducible by oxidative stress (19), and results from this study also indicate that the ahpC gene is inducible in response to oxygen stress. The nosX, nox, and ahpC genes responded to oxidative stress, lending support to the postulated role of the putative osr operon, nox, and ahpC in oxidative stress response.
When nosX or the osr operon was inactivated, aerobic growth was significantly reduced. Growth was not significantly affected when either qor1 or qor2 was inactivated, which may be due to compensation by other proteins involved in oxygen stress resistance function. In S. mutans, the antioxidant Dpr had increased production upon mutation of other antioxidant-encoding genes (59). We observed that inactivation of qor1 increased the expression of nosX, nox, and ahpC in S. gordonii, lending support to the hypothesis that compensatory interactions exist among S. gordonii genes involved in oxidative stress response.
The transition from a planktonic to a sessile existence may have to respond and adapt to changes in environmental factors, such as oxygen gradients. Genes involved in resistance to oxygen are regulated by environmental oxygen levels and appear to be important in bacterial biofilm formation. Disruption of the genes in the putative osr operon also affected the biofilm formation of S. gordonii. In S. mutans, both oxidative stress tolerance and biofilm formation are regulated by LuxS-mediated quorum sensing (57). A recent study found that the transcriptional regulator SinR controls the maturation of Agrobacterium tumefaciens and proposed that a signal cascade responsive to oxygen limitation activates sinR expression in response to decreased oxygen levels and influences the biofilm formation of A. tumefaciens (39). Schembri et al. (44), in a study of the global gene in E. coli biofilms using microarray analysis, reported that putative genes encoding oxidoreductases and cytochrome terminal oxidases were up-regulated in biofilm cells when compared to planktonic cells. In S. gordonii, the putative osr operon, nox, and ahpC appear to be part of an island responsible for dealing with oxidative stress. These genes might modulate biofilm formation by playing a role in maintaining a reduced environment. Taken together, these observations support the hypothesis that a number of S. gordonii genes involved in bacterial defense against oxidative stress are linked in biofilm formation. In contrast, oral streptococcal biofilm cells grown in tryptone-yeast extract-sucrose broth had demonstrated repressed respiration and NADH oxidase activity when compared with cells from aerobic culture (35). These differences may be due to the differences in the media used. On the other hand, both respiration and NADH oxidase activity of S. mutans were greatly enhanced in aerobic growth, while minor effects were observed for S. gordonii (35).
The mechanism by which inactivation of the putative osr operon affects S. gordonii biofilm formation is not entirely clear. Although oral biofilms are often considered relatively anaerobic, active oxygen metabolism is present in both supragingival and subgingival biofilms, which necessitates the development of defenses against oxidative stress (30). In summary, the present study specifically implicates the transcription of nosX, qor1, and qor2 in S. gordonii biofilm formation. Results from this study suggest genes involved in bacterial defense against oxidative stress also play a significant role in the development of biofilms. Further characterization of the putative osr operon will provide insight into the molecular mechanisms of biofilm formation and oxygen tolerance of oral streptococci.
Special thanks go to Z. Skobe and Elke Pravda at the Biostructure Core Facility in The Forsyth Dental Institute for assistance with confocal microscopy.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»