This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lewis, L. A.
Right arrow Articles by Grindley, N. D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lewis, L. A.
Right arrow Articles by Grindley, N. D. F.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2004, p. 858-865, Vol. 186, No. 3
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.3.858-865.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

The Left End of IS2: a Compromise between Transpositional Activity and an Essential Promoter Function That Regulates the Transposition Pathway

Leslie A. Lewis,1,2* Edruge Cylin,1 Ho Kyung Lee,1 Robert Saby,1 Wilson Wong,1,{dagger} and Nigel D. F. Grindley3

Department of Biology, York College of the City University of New York, Jamaica, New York 11451,1 Program in Cellular, Molecular and Developmental Biology, Graduate Center, City University of New York, New York, New York 11016,2 Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut 065203

Received 23 June 2003/ Accepted 20 October 2003


arrow
ABSTRACT
 
Cut-and-paste (simple insertion) and replicative transposition pathways are the two classical paradigms by which transposable elements are mobilized. A novel variation of cut and paste, a two-step transposition cycle, has recently been proposed for insertion sequences of the IS3 family. In IS2 this variation involves the formation of a circular, putative transposition intermediate (the minicircle) in the first step. Two aspects of the minicircle may involve its proposed role in the second step (integration into the target). The first is the presence of a highly reactive junction formed by the two abutted ends of the element. The second is the assembly at the minicircle junction of a strong hybrid promoter which generates higher levels of transposase. In this report we show that IS2 possesses a highly reactive minicircle junction at which a strong promoter is assembled and that the promoter is needed for the efficient completion of the pathway. We show that the sequence diversions which characterize the imperfect inverted repeats or ends of this element have evolved specifically to permit the formation and optimal function of this promoter. While these sequence diversions eliminate catalytic activity of the left end (IRL) in the linear element, sufficient sequence information essential for catalysis is retained by the IRL in the context of the minicircle junction. These data confirm that the minicircle is an essential intermediate in the two-step transposition pathway of IS2.


arrow
INTRODUCTION
 
IS2 is a 1.3-kb transposable element which belongs to the IS3 family of insertion sequences, one of the largest of about 19 families of this group of mobile elements (3). Extensive studies of IS911 (5, 18, 26, 34), confirmed with IS2 (14, 15), have shown that transposition of IS3-family elements occurs by a variation of the cut-and-paste pathway, which involves the formation of novel intermediates—first, a figure eight and subsequently an IS minicircle (36) (Fig. 1A). Formation of the figure eight results from the transposase-mediated cleavage of one IS 3' end and the strand transfer of this end to a site on the same DNA strand a few nucleotides outside the other IS end. Replication and/or host repair systems convert the figure eight into an IS minicircle (and regenerate the initial replicon with the parental IS). The junction formed by the abutted IS ends in the minicircle, e.g., in IS150, IS3, and IS911, is a transpositionally hyperactive substrate (7, 29, 34). In this configuration, both IS ends are readily nicked by the transposase, forming a linear IS with free 3'-OH ends that can insert into a new DNA target in the manner of other cut-and-paste transposons such as Tn10 or Tn5 (25, 27). In several cases it has also been shown that formation of the IS end-to-end junction creates a novel hybrid promoter, composed of elements from both the right and left IS ends, that results in increased expression of transposase (5, 34). The presence of this promoter in IS911 improves the chance of reintegrating the excised IS before the nonreplicating minicircle is diluted from the dividing cells (5). Transpositionally reactive junctions, either in circles or in linear dimers, have also been reported for elements in families other than IS3, e.g., IS21 (22-24) IS30 (4, 13, 16), IS1 (31, 35), and IS186 (33). Some but not all of these junctions or those formed by IS3 family members are associated with the formation of hybrid promoters (5), and a generic role for a stronger promoter in their transposition pathways remains unclear.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 1. (A) The two-step transposition pathway of IS2, showing formation of figure eight (i) and minicircle (ii) intermediates and the second step or insertion reaction (iii). (i) Asymmetric single-stranded cleavage of the active IRR donor end and its intramolecular strand transfer to the inactive target end (IRL) creates a figure eight structure. (ii) DNA replication or host repair systems resolve the figure eight and produce the excised minicircle intermediate. (iii) In the second step the minicircle junction is the substrate for the IS2 transposase (Tnp) produced by a strong junction promoter, Pjunc (see below), which provides the levels of Tnp needed for the cleavage and strand transfer reactions. Both IRR and IRL, which function as active donors, are cleaved at the minicircle junction and participate in intermolecular strand transfer to the target. (B) Aligned sequences of the IRR and IRL of IS2. IRR (red, upper sequence) is 41 bp long and IR (blue, lower) is 42 bp. Sequences common to both ends are shown as large uppercase letters. Diverged sequences are in lowercase. The Tnp binding domain is indicated in yellow as sequences 10 to 41 for IRR and 11 to 42 for IRL. The basis for the asymmetry of the first-step reaction (14) and for the mechanistic aspects of the second step (this report) are dictated by the divergences in length, sequence, and the terminal dinucleotides seen in the catalytic domain of IRL (blue) relative to IRR (red). (C) Sequence of the IS2 minicircle junction showing the role of the terminal hexamer of the catalytic domain of IRL as the -10 motif of the minicircle junction promoter (Pjunc). The outwardly directed -35 hexamer in IRR contributes to the formation of this promoter.

IS2 is a typical IS3 family member, both in its mechanism of transposition (15) and in the formation of a junction promoter (32). However, while IS911 and other typical IS3-family elements, e.g., IS150 and IS3 (7, 30), use each IS end equally well as the donor or target in the initial cleavage and strand transfer step, IS2 uses only its right end, IRR, as the donor and its left end, IRL, as the target. Furthermore, even as targets, IRL and IRR (which can act as a target if it is artificially paired with an IRR donor) differ from one another—targeting IRL results in a 1- or 2-bp spacer between the abutted IS ends in the minicircle, whereas targeting IRR results in a 2- or 3-bp spacer (14).

We have previously shown that the distinct target characteristics of IRL and its inability to act as a donor in the initial step of transposition result largely from two DNA sequence differences between IRL and IRR—an extra base pair between the conserved transposase binding sequences and the IRL terminus and a change of the terminal dinucleotide from the CA-3' typical of all IS3 family members to TA-3' (14) (Fig. 1B). We have hypothesized that these differences between IRL and IRR (and the asymmetry of the initial strand transfer event that results from them) have been selected because they optimize the minicircle junction promoter, Pjunc (Fig. 1C). Here, we have further characterized Pjunc, shown that its activity indeed depends on these two sequence differences, and demonstrated that Pjunc activity is essential for the efficient transposition of IS2. In addition we show that IRL has retained sufficient critical terminal sequences to function in catalysis of minicircle insertion reactions, despite its inactivity as a donor in minicircle formation.


arrow
MATERIALS AND METHODS
 
Bacterial strains and media. The strains of Escherichia coli used in these experiments were essentially as previously described (14, 15).

IS2 constructs. (i) Wild-type and mutant linear IS2 elements. pLL17 and pLL18, elements with the frame-fused orfAB sequence, have been described in detail (15), as have pLL40 (with the minitransposon in which the orfA and orfB sequences have been replaced by a Kan resistance gene), pLL44 (containing the wild-type element with its native overlapping orfA and orfB genes), and pLL49 (with the end-less orfAB frame-fused gene in a pACYC vector).

(ii) IS2 elements with mutations of the left-end terminal dinucleotide. These constructs, pLL46, pLL50, pLL80-84, and pLL86-93 (see Table 4), were created by mutating the left end of pLL18, which has the frame-fused orfAB gene as described earlier (14).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Effects of IRL terminal mutations on the overall transposition frequency of IS2

(iii) lacZ fusion constructs. The lacZ gene from pSV-ß-galactosidase (Promega Corp.) was cloned into pUC19 as a HindIII-BamHI fragment. An XhoI/NcoI cassette was created by PCR site-directed mutagenesis at the HindIII end of the fragment, with the NcoI site corresponding to the translational start site of the lacZ gene (pLL132). Promoters were created by in vitro site-directed PCR mutagenesis and cloned into the cassette. The 3' ends of the promoters were created with the primer NCOP1, which contained the NcoI site and the ribosomal binding site. The lac operator sequence was also included in this primer (1). The sequence was 5'-CATGGTCCATGGTTCTCC[AATTGTGAGCGGATAACAATT]CCAATGACTAGTC-3'. The NcoI and ribosomal binding site sequences are in bold, and lacO is shown in brackets. The 5' end of each promoter was created using a primer that contained an XhoI site; the primer varied with the specific lacZ fusion construct created. For pLL148, which contained the hexamers of the lacUV5 promoter, this primer was 5'-CTTAAGTGATCTCGAGATGTCTTTACATATAGCCGCAAATCCACTATAATGGCCCCCTGAAT-3'. The XhoI site and the PlacUV5 -35 and -10 hexamers are shown in bold. The DNA template used in the PCR protocol to create this promoter was a cloned minicircle with a wild-type minicircle junction formed from the abutted IRLTA and IRRCA ends separated by a 1-bp spacer (pLL186). To create PIRL, the indigenous IS2 promoter in the left end (pLL135), pLL17 was used as the DNA template and a primer with an XhoI site which hybridized upstream of the left end of IS2 was employed: 5'-CTATTACTCGAGCTGGCGAAAGGGGGAT-3'. For wild-type and mutant junction promoters, (pLL136, -138, and -143), a primer containing the IRR sequence which hybridized just upstream of the -35 hexamer of the promoter at the minicircle junction was used with different templates. Its sequence was 5'-ACGGGACGGCTCGAGTCCTTAAGTGATAACAG-3'. For pLL136 (wild type Pjunc), the DNA template was pLL186; for Pjunc with the mutant -10 hexamer TGGACT (pLL143), the DNA template was a cloned minicircle isolated from pLL46, the construct with the IRLCA mutation; for Pjunc with the mutant -10 hexamer CAGACT (pLL138), the cloned minicircle isolated from pLL50, the construct with the IRLTG mutation was used. Junction promoters with 18 bp (pLL144), 19 bp (pLL145), and 22 bp (pLL146) between the -35 and -10 hexamers (Table 1) were created with a primer composed of the minicircle junction sequence containing 2, 3, or 6 bp in the minicircle junction spacer. For example, the sequence with a 2-bp spacer was 5'-CTTAAGTGACTCGAGATGTCTGGAAATATAGGGGCAAATCCA]CT[TAGACTGGCCCCCTGAATCTCC-3'. The abutted ends of IS2 are indicated by brackets. The XhoI sequence and the -35 and -10 Pjunc hexamers are shown in bold.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Promoter strength assayed by ß-galactosidase expression from lacZ fusions

(iv) Constructs designed to test the relative efficiencies of Pjunc and PIRL promoters in promoting autonomous transposition in IS2. pLL440 was created by replacing the wild-type left end of IS2 (IRLTA), an EcoRI-AvaI fragment of pLL44 (15), with the mutant left end (IRLCA) of pLL46.

(v) Constructs with cloned minicircle junctions. The creation of constructs with closed minicircle junctions, which is achieved by cloning BspEI-digested minicircles into the AvaI site of pUC19, has been previously described in detail (14). Cloned minicircle constructs pLL181 and pLL460 (see Table 5) were derived from minicircles produced by pLL18 and pLL46 (14), respectively, both of which possess the frame-fused orfAB gene. Cloning of their minicircles disrupted the orfAB gene but left orfA intact. Cloned minicircles in constructs pLL1838, -1508, -1592, and -1676 (see Table 5) were generated from elements created by mutation of the left end of pLL18 (see Table 4). It should be noted that all of these constructs, with the exception of pL181, lacked a functional minicircle junction promoter. Constructs identified as components of the pLL400 series and the pLL600 series (see Table 3) were derived from minicircles produced by the minitransposons pLL40 and pLL48 (14), respectively, from which the orfA and orfB genes were deleted. Cloned minicircles of the 400 series were pLL407, -408, -412, and -413. Those of the 600 series were pLL602, -605, -608, and -609. The constructs identified as pLL538, -610, -617, and -619 were also derived from minicircles produced by pLL48.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Effects of IRL terminal mutations on the transposition of preformed IS2 minicircles


View this table:
[in this window]
[in a new window]
 
TABLE 3. Effect of IS2 minicircle junction spacer size on the frequency of transposition

ß-Galactosidase assays. lacZ fusion constructs were transformed into the JM105 strain of E. coli and grown overnight in Luria-Bertani broth plus 300 µM isopropyl-ß-D-thiogalactopyranoside. Overnight cultures were diluted 1/50 into the same medium and grown to an optical density of 0.4 to 0.5. One-milliliter aliquots were assayed for ß-galactosidase as described by Sambrook et al. (28).

Primer extension reactions. Total RNA preparations were made from 20-ml log-phase cultures grown to an optical density of 0.2 to 0.3. RNA was prepared using a Qiagen RNeasy kit combined with the RNAprotect stabilization solution (Qiagen Inc.) RNA concentrations of 2 to 4 µg/µl were obtained in 40-µl preparations. mRNA was enriched from total RNA preparations with the MICROBExpress kit from Ambion Inc. Preparations started with 15 µg of total RNA yielded on average 4.5 µg of mRNA in a 20-µl preparation. Concentrations were determined spectrophotometrically at 260 nm, and purity was assessed from 260-nm/280-nm optical density ratios, which gave a value of 2.0, and by analysis on formaldehyde-1.0% agarose gels. Primer extension reactions utilized the Omniscript reverse transcriptase kit of Qiagen Inc. With their protocol we used 1.6 pmol of a 5'-end 33P-labeled primer, specific to the lacZ gene for use with lacZ fusion constructs (e.g., pLL136), and 1.25 pmol of the RNA template in a 20-µl reaction mixture. Eighteen microliters of Stop Buffer (U.S. Biochemical) was added to the mixture at the end of the reaction, and the whole was dried down to 8.0 µl. Two microliters of the reaction mixture was loaded onto a denaturing polyacrylamide gel along with a control sequencing reaction mixture which used the same primer employed in the primer extension reaction but without the 5'-end-labeled PO43-. Trial runs of oligonucleotides with and without the 5'PO4 indicated that those with the phosphate migrate one nucleotide faster than those without it, presumably because of the presence of the extra charge. This adjustment was made in analyzing the data shown in Fig. 2. Quantification of the runoff products was carried out on a Storm 840 PhosphorImager (Molecular Dynamics, Inc.).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2. Results of primer extension reactions using total RNA preparations from five strains containing lacZ fusion constructs. (A) Minicircle junction promoters (Pjunc) are shown in lines 1 and 4 (wild type) and lines 3 and 5 (mutated) with their transcriptional start sites. The indigenous wild type promoter (PIRL) is shown in line 2. * and {dagger}, primary and secondary transcriptional start sites, respectively. IRR sequences are in black, and IRL sequences are in red. Square brackets indicate the outside termini of IRR and IRL. The curved bracket in line 2 identifies the inside end of IRL (base 42). The red (positions 1 to 20 and 21 to 42) and the purple (positions 43 to 79) sequences in lines 1 and 2 are contiguous and show Pjunc and PIRL 25 bp apart in the minicircle. The purple sequence which begins at base 43 at the inside end of IRL joins PIRL to the orfA gene. The -10 and -35 hexamers of Pjunc are in blue as is the extended -10 motif of PIRL; the -10/-35 spacer sizes for Pjunc (17 to 22 bp) are indicated below the sequences. Uppercase letters identify the minicircle junction spacer sequences. The mutation in Pjunc in line 3 is the A-to-G transition in the second position of the -10 hexamer (TA-3' to CA-3'). The mutation in line 5 was created by the addition of 5 bp to the minicircle junction spacer. The five constructs shown are (see also Table 1) as follows: 1, pLL136; 2, pLL135; 3, pLL143; 4, pLL144; and 5, pLL146. (B) Sequencing (GATC) and primer extension (lanes 1 to 5) reactions. Both utilized the same primer, LacRI, located 90 bases downstream of PIRL. Reactions in lanes 1 to 5 were carried out with the correspondingly labeled constructs described in panel A. The template used for the sequencing reaction was pLL136 (panel A, line 3) with the IRLCA dinucleotide mutation. The black horizontal arrow identifies the Pjunc runoff products; the red arrow identifies the PIRL runoff product.

Transposition assays. Overall transposition frequencies were determined using a mating-out assay (15). This was based on the transfer of the mini-F-factor pCJ105 (11) from a RecA strain (LL2535) to a naladixic acid-resistant F- strain (14R525). For autonomous transposition the RecA strain also contained the IS2 construct cloned into a pUC19 plasmid. For nonautonomous transposition with constructs containing cloned minicircles, the frame-fused transposase OrfAB was provided by the addition of the compatible pACYC derivative pLL49 to the F+ strain (15).

DNA manipulations. In vitro site-directed PCR-based mutagenesis, PCR protocols, DNA sequencing, plasmid DNA preparations, cloning reactions, and the specific cloning of minicircles were all carried out essentially as described previously (14, 15).


arrow
RESULTS
 
Analysis of Pjunc, the promoter that spans the IS2 minicircle junction. To analyze the two proposed IS2 promoters, we made promoter-lacZ reporter gene constructs in pUC19. We determined the precise locations of the Pjunc and PIRL transcription start sites by using a primer extension assay with a 5'-end 33P-labeled primer annealed about 90 bases downstream of the candidate PIRL promoter (Fig. 2A, line 2). As shown in Fig. 2B, lane 1, two distinct transcripts were detected from the strain with pLL136 (which carries the wild-type junction containing 1 bp between its abutted ends). The longer, more abundant product identifies Pjunc: this transcript starts with either C (position 12 of IRL) or the T two bases away (position 14) (Fig. 2A, line 1), with a 2.5-fold preference for the C (Fig. 2B, lane 1). The shorter, less abundant primer extension product, visible in all lanes in Fig. 2B, identifies the PIRL transcript, which starts with the A at AGTTTTT, as was shown earlier by Hu et al. (9). From the relative intensities of the primer extension products, we conclude that Pjunc is 14-fold more active than PIRL.

Analysis of ß-galactosidase expression from the same plasmids confirmed and extended the primer extension results (Table 1). These data show that Pjunc is nearly (90%) as strong as PlacUV5 and is 14-fold more efficient than PIRL (compare pLL136, pLL148, and pLL135). Pjunc is inactivated by mutations in either the first or second position of IRL, supporting the hypothesis that positions 1 to 6 of IRL form the conserved -10 element of this strong promoter (pLL138 and -143). The inactivity of the A-to-G substitution at position 2 is particularly instructive, since this corresponds to a change of the 3' end of IRL from -TA to -CA, which is the usual 3' end of IS3-family elements. Finally, both sets of data show that Pjunc is surprisingly sensitive to the size of the minicircle junction spacer. An increase from 1 bp (the most frequently observed spacer in vivo [15]) to 2 bp, corresponding to a change in the length of the -35 to -10 spacer from 17 to 18 bp, eliminates Pjunc activity (Fig. 2B, lane 4), as do larger increases (Fig. 2B, lane 5; Table 1, pLL144, pLL145, and pLL146).

Pjunc is critical for IS2 transposition in vivo. To determine the importance of Pjunc for the transposition of IS2 in a normal "wild-type" situation, we compared the transposition frequencies of a pair of marked IS2 derivatives (Table 2). Both derivatives contained the normal arrangement of orfA and orfB genes, requiring the natural translational frameshift (19, 30, 37) to produce the active OrfAB transposase. pLL44 contains the Kanr-marked, but otherwise wild-type, IS2, in which transposase is initially expressed from PIRL but, following IS2 minicircle formation, can be expressed from the minicircle junction promoter, Pjunc. pLL440 contains the A-to-G substitution at position 2 of the IS2 IRL but is otherwise identical to pLL44; this mutation, which changes IRLTA to IRLCA, eliminates Pjunc activity (Table 1 and Fig. 2B, lane 3) but affects neither the efficiency of forming minicircles (14) nor the substrate activity of preformed minicircle junctions (see the discussion of spacer and sequence requirements below). Thus, in pLL440, transposase expression depends on PIRL both before and after IS2 minicircle formation.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Transposition frequencies of IS2-kan constructs that assemble active versus inactive Pjunc promoters

The results of mating-out experiments shown in Table 2 indicate that for the construct lacking a functional Pjunc, pLL440, the frequency of transposition (3.6 x 10-9) was about 10% of that for the wild-type construct (pLL44) (3.7 x 10-8). These results are comparable to the relative efficiencies of PIRL and Pjunc and show that Pjunc plays an important role in maximizing the reinsertion of excised IS2 minicircles; indeed, in the absence of the Pjunc promoter about 90% of the excised IS2 minicircles fail to reinsert.

Spacer and sequence requirements for transpositional activity of IRL in the IS2 minicircle junction. The IRL of IS2 is completely inactive in the initial strand transfer step that creates the figure eight intermediate (and the minicircle junction) (14). Nevertheless, subsequent IS2 insertion implies that in the context of the minicircle junction, IRL becomes active. What are the constraints on this activation? Specifically, is activation dependent on a particular spacer size and the sequence of the IRL terminal dinucleotide?

The effects of minicircle junction spacer size on transposition were determined using mating-out assays with a transposon-less F plasmid (pCJ105) and a series of Kmr pUC19-derived plasmids with different minicircle junctions (Table 3). IS2 transposase was provided by the chromosomal copies of IS2 present in the donor strain. The results showed that junctions with spacers of 1 or 2 3 bp were highly active (even with the low endogenous levels of IS2 transposase). However, an increase in spacer size to 6 or 8 bp was strongly inhibitory to transposition. DNA sequences of several insertions revealed the 5-bp target duplications characteristic of IS2 transposition, showing that the events which were scored indeed resulted from the transposition of the entire plasmid into the F factor.

In an earlier study we compared the effects of all possible 16 terminal dinucleotides at the left end on minicircle formation (14). None of the mutations had any effect on the efficiency of minicircle formation, a result that is in accord with the exclusive role of IRL as a target in the initial strand transfer reaction. We have now examined the effects of these same mutations of IRLTA on the frequency of autonomous transposition (Table 4). Note that in these transposition assays the transposase is provided by the fused orfAB gene carried by IS2 (15). The mutants fell roughly into two groups. Those in which only the T was replaced transposed with normal or modestly reduced frequency, while those in which the 3'-terminal A was replaced transposed at frequencies of 0.03 to 1% of the IRLTA control. The results suggest that the 3'-terminal A is the critical residue and that the penultimate T plays little or no role in the cleavage and joining reactions of minicircle integration, unlike the penultimate C of IRR in first-step reactions (14).

Since mutations at the left end of IS2 also alter the sequence of Pjunc, diminishing the levels of transposase and thereby reducing the overall frequencies of transposition, the specific effects of the mutations of IRLTA on cleavage and joining reactions during the final insertional step are better evaluated by examining transposition frequencies of cloned minicircles generated from the mutant elements, with transposase provided in trans at a constant level (Table 5). These data confirmed that IRLTA and IRLCA are essentially equivalent whereas mutations which replace the terminal A have drastic effects on cleavage of the IS2 minicircle junction and/or its strand transfer to a target DNA independent of any effects on the Pjunc promoter.


arrow
DISCUSSION
 
Previous studies have shown that formation of the IS2 minicircle junction creates a promoter, Pjunc, with each of the abutted ends providing essential and functional promoter elements (5, 32). Here we have confirmed this, showing that Pjunc is nearly as strong as the PlacUV5 promoter and about 14-fold stronger than the indigenous transposase promoter, PIRL. We have precisely identified the initiation sites of Pjunc and PIRL and have provided strong evidence that the -10 conserved region of Pjunc is the terminal 6 bp of IRL. In addition, we have shown that the increased activity of Pjunc is very important for maximizing the efficiency with which IS2 minicircles are cleaved and transferred into new target sites. This work provides strong evidence that the minicircle is an essential intermediate in IS2 transposition and extends earlier reports of IS3-family transposition mechanisms (14, 26).

The minicircle junction is a hyperactive target for the IS2 transposase. We have identified the IS2 minicircle junction itself as the target for the transposase by showing that mutations which increase the size of the junction spacer diminish its innate hyperactivity when transposase is provided merely by endogenous chromosomal copies of the element (Table 3). Similar results are observed when frame-fused OrfAB is provided in trans to cloned constructs with wild-type and mutated ends in preformed junctions (Table 5).

Comparison of the PIRL and Pjunc promoters. From a comparison of Pjunc and PIRL sequences (Fig. 3), it is clear that the increased activity of Pjunc is the result of a closer match to the promoter consensus sequence. Not only does the weak promoter, PIRL, appear to lack a recognizable -35 region but its -10 hexamer is also far from ideal, with only the three most important positions matching the consensus. From its sequence, PIRL may well belong to the group of promoters that rely on an "extended -10 motif," with a TG sequence located 1 bp upstream of the -10 hexamer (12, 20). Pjunc, by contrast, has an improved -10 region with a four out of six match to the -10 consensus, a reasonable -35 hexamer (with four consensus bases), and an optimal 17-bp spacer between these elements. Pjunc is somewhat unusual in its sensitivity to a 1-bp spacer change and its pyrimidine initiation sites (8). The outwardly directed -35 hexamer at the right end of IS2 has long been implicated in the creation of new hybrid promoters, formed following the insertion of the element at an appropriate distance from a sequence resembling a -10 hexamer in target DNA (6, 10). It is now evident that this -35 hexamer exists so that a strong regulatory promoter can be assembled at the IS2 minicircle junction.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. Comparison of the indigenous (PIRL) and minicircle junction (Pjunc) promoters of IS2. The top line presented in uppercase lettering shows the consensus sequences for the -10, extended -10, and -35 promoter motifs. PIRL lacks a recognizable -35 motif and appears to rely on an extended -10 motif (uppercase letters; bases which match the consensus sequence are underlined). Pjunc with its -10 and -35 motifs is created by the formation of the minicircle junction. The abutment of the right and left ends of IS2 is indicated by square brackets. The -10 hexamer is of IRL origin, and the -35 hexamer is of IRR origin. The junction contains a 1-bp spacer of vector origin. Transcriptional start sites for both promoters are indicated by uppercase letters with hooked arrows.

Balancing Pjunc activity with strand transfer activity: the evolution of IRL. The strength of the Pjunc promoter is dependent on two features of IRL, each of which compromises its strand transfer activity. First, Pjunc activity depends upon the unusual 3' end of IRL, which is TA-3' rather than the CA-3' that terminates IS2 IRR and the vast majority of the ends of other IS3-family elements (3). If the terminal -CA-3' of IRR is replaced with TA, its donor activity in the initial asymmetric strand transfer step (that forms the figure eight and IS2 minicircle intermediates) is virtually eliminated (14). However, introducing the preferred CA at the 3' end of IRL destroys Pjunc activity (Fig. 2B, lane 3) and, consequently, nearly eliminates IS2 transposition for lack of sufficient transposase for the second strand transfer step.

Secondly, Pjunc activity depends upon the formation of a 1-bp spacer between IRR and IRL. This spacer size provides the optimal 17-bp spacer between the -35 and -10 regions of Pjunc, and remarkably, increasing this to 18 bp also eliminates Pjunc activity (Fig. 2B, lane 4). The 1-bp interend spacer size is very strongly dependent on the "extra" base pair in IRL that increases the distance between the IRL terminus and the transposase binding subdomain (Fig. 1B). The extra base pair in IRL (relative to IRR) not only is responsible for reducing the minicircle junction spacer from 2 or 3 bp (the size that results from using IRR as a target) to 1 bp but also, like the terminal TA, inactivates IRL donor activity in figure eight and minicircle formation (14).

Although the evolution of Pjunc has come at the cost of reducing IRL strand transfer, the overall transposition of IS2 is clearly enhanced by the formation of Pjunc. This is because the initial asymmetric strand transfer step is not compromised by IRL donor inactivity (since IRR donor activity suffices for this step), while for the second strand transfer step the initial IRL inactivity is overcome by its juxtaposition with IRR across the IS2 minicircle junction.

The transposase binding activity of IRL is not sufficient for the activation of IRL strand transfer from the IS2 minicircle intermediate—additional sequences directly involved in the catalytic steps are also needed. Our earlier study of the role of IRL in IS2 minicircle formation showed that sequences from positions 11 to 42, the presumed transposase binding domain (see Fig. 1B), were sufficient to provide target function (14). Here we have shown that additional sequences at the tip of IRL, particularly a 3'-terminal A, are required for efficient cleavage and strand transfer of the minicircle junction. Thus, activation of an IS end in the context of the transpositionally hyperactive minicircle junction requires that the features most essential for both binding and catalysis remain intact. Nevertheless, the juxtaposition of ends in the minicircle junction is able to counteract both the CA-to-TA terminal substitution and the increased separation between the binding and catalytic subdomains found in IRL.

The role of Pjunc in regulating transposase levels during the transposition cycle. Our data show that the IS2 Pjunc promoter, like that of IS911, plays an important role in transposition. In the case of IS2 this is most clearly illustrated by the behavior of a derivative in which IRL contains a CA-3' end. This mutant end inactivates Pjunc and reduces transposition by more than 10-fold (to an approximate background level of 4 x 10-9) when present in a marked linear IS2 that provides its own transposase. Note, however that, the IRL CA-3' end has no effect on the efficiency of minicircle formation (a step requiring PIRL) (14) or any significant effect on minicircle integration when transposase is provided in trans (Table 5, pLL460). Thus, the transposition defect of this IRL mutation is entirely due to inactivation of Pjunc.

Why have the ends of IS2, IS911, and many other IS elements that form reactive IRR-IRL junctions such as IS21, IS30, and IS492 (2, 5, 13, 17, 21) evolved to form a strong junction-spanning promoter that elevates transposase expression? For transposons such as IS10 and IS50 that transpose via the classical cut-and-paste process, both excision and insertion of an individual element are catalyzed by the same transpososome complex (i.e., a protein-DNA synaptic complex with transposase and two paired transposon ends), with no dissociation between the steps (25, 27). By contrast, in the transposition pathway proposed for IS911 and IS2, transpososomes are required to assemble on two temporally separable occasions. The first transpososome, which catalyzes the initial strand transfer to form the figure eight, must be disassembled in order to process the figure eight into the IS2 minicircle. Once it is formed, the nonreplicating minicircle then has only a limited window of opportunity to assemble a new transpososome and insert into a target before it is lost by dilution or degradation. The strong Pjunc promoter provides a burst of transposase gene expression just when it is most needed to maximize reinsertion and minimize loss. Without the elevated induction of transposase that results from forming the Pjunc promoter, at least 90% of the IS2 minicircles formed fail to reinsert. The induction is temporary, however, since integration of the minicircle into a target separates the two IS ends, destroying Pjunc and returning transposase expression to the control of the weak PIRL promoter.

The importance of Pjunc provides strong evidence that IS2 transposition proceeds via a minicircle intermediate most and perhaps all of the time, since Pjunc is created only by covalent linkage of IRR and IRL. Further support is provided by the strand transfer properties of IRL, which is inactive in a linear IS2 insertion but becomes active when abutted to IRR once a minicircle is formed.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Public Health Service grants NIH/NIGMS R15GM57686 and MBRS/SO6GM08153 to L.A.L. and R01GM28470 to N.D.F.G. and by PSC-CUNY Research Award 61199-00-03 and York College FDSP Award 990110 to L.A.L.

We thank V. Greene and A. Savage for excellent technical assistance and M. Cintino and N. D. Smith for superb help in the preparation of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, York College of the City University of New York, Jamaica, NY 11451. Phone: (718) 262-2706. Fax: (718) 262-2369. E-mail: lewis_l{at}york.cuny.edu. Back

{dagger} Present address: Graduate Program in Biology, Queens College, City University of New York, Flushing, NY 11365. Back


arrow
REFERENCES
 
    1
  1. Amann, E., J. Brosius, and M. Ptashne. 1983. Vectors bearing a hybrid trp-lac promoter useful for regulated expression of cloned genes in Escherichia coli. Gene 25:167-178.[CrossRef][Medline]
  2. 2
  3. Berger, B., and D. Haas. 2001. Transposase and cointegrase: specialized transposition proteins of the bacterial insertion sequence IS21 and related elements. Cell. Mol. Life Sci. 58:403-419.[CrossRef][Medline]
  4. 3
  5. Chandler, M., and J. Mahillon. 2002. Insertion sequences revisited, p. 305-366. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington, D.C.
  6. 4
  7. Dalrymple, B. 1987. Novel rearrangements of IS30 carrying plasmids leading to the reactivation of gene expression. Mol. Gen. Genet. 207:413-420.[CrossRef][Medline]
  8. 5
  9. Duval-Valentin, G., C. Normand, V. Khemici, B. Marty, and M. Chandler. 2001. Transient promoter formation: a new feedback mechanism for regulation of IS911 transposition. EMBO J. 20:5802-5811.[CrossRef][Medline]
  10. 6
  11. Galas, D. J., and M. Chandler. 1989. Bacterial insertion sequences, p. 109-162. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
  12. 7
  13. Haas, M., and B. Rak. 2002. Escherichia coli insertion sequence IS150: transposition via circular and linear intermediates. J. Bacteriol. 184:5833-5841.[Abstract/Free Full Text]
  14. 8
  15. Hawley, D. K., and W. R. McClure. 1983. Compilation and analysis of Escherichia coli promoter DNA sequences.Nucleic Acids Res. 11:2237-2254.[Abstract/Free Full Text]
  16. 9
  17. Hu, S. T., J. H. Hwang, L. C. Lee, C. H. Lee, P. L. Li, and Y. C. Hseih. 1994. Functional analysis of the 14 kDa protein of insertion sequence 2. J. Mol. Biol. 236:503-513.[CrossRef][Medline]
  18. 10
  19. Jaurin, B., and S. Normark. 1983. Insertion of IS2 creates a novel ampC promoter in Escherichia coli. Cell 32:809-816.[CrossRef][Medline]
  20. 11
  21. Joyce, C. M., and N. D. Grindley. 1984. Method for determining whether a gene of Escherichia coli is essential: application to the polA gene. J. Bacteriol. 158:636-643.[Abstract/Free Full Text]
  22. 12
  23. Keilty, S., and M. Rosenberg. 1987. Constitutive function of a positively regulated promoter reveals new sequences essential for activity. J. Biol. Chem. 262:6389-6395.[Abstract/Free Full Text]
  24. 13
  25. Kiss, J., and F. Olasz. 1999. Formation and transposition of the covalently closed IS30 circle: the relation between tandem dimers and monomeric circles. Mol. Microbiol. 34:37-52.[CrossRef][Medline]
  26. 14
  27. Lewis, L. A., N. Gadura, M. Greene, R. Saby, and N. D. Grindley. 2001. The basis of asymmetry in IS2 transposition. Mol. Microbiol. 42:887-901.[CrossRef][Medline]
  28. 15
  29. Lewis, L. A., and N. D. Grindley. 1997. Two abundant intramolecular transposition products, resulting from reactions initiated at a single end, suggest that IS2 transposes by an unconventional pathway. Mol. Microbiol. 25:517-529.[CrossRef][Medline]
  30. 16
  31. Olasz, F., R. Stalder, and W. Arber. 1993. Formation of the tandem repeat (IS30)2 and its role in IS30-mediated transpositional DNA rearrangements. Mol. Gen. Genet. 239:177-187.[CrossRef][Medline]
  32. 17
  33. Perkins-Balding, D., G. Duval-Valentin, and A. C. Glasgow. 1999. Excision of IS492 requires flanking target sequences and results in circle formation in Pseudoalteromonas atlantica. J. Bacteriol. 181:4937-4948.[Abstract/Free Full Text]
  34. 18
  35. Polard, P., and M. Chandler. 1995. An in vivo transposase-catalyzed single-stranded DNA circularization reaction. Genes Dev. 9:2846-2858.[Abstract/Free Full Text]
  36. 19
  37. Polard, P., M. F. Prere, M. Chandler, and O. Fayet. 1991. Programmed translational frameshifting and initiation at an AUU codon in gene expression of bacterial insertion sequence IS911. J. Mol. Biol. 222:465-477.[CrossRef][Medline]
  38. 20
  39. Ponnambalam, S., C. Webster, A. Bingham, and S. Busby. 1986. Transcription initiation at the Escherichia coli galactose operon promoters in the absence of the normal -35 region sequences. J. Biol. Chem. 261:16043-16048.[Abstract/Free Full Text]
  40. 21
  41. Prudhomme, M., C. Turlan, J. P. Claverys, and M. Chandler. 2002. Diversity of Tn4001 transposition products: the flanking IS256 elements can form tandem dimers and IS circles. J. Bacteriol. 184:433-443.[Abstract/Free Full Text]
  42. 22
  43. Reimmann, C., and D. Haas. 1990. The istA gene of insertion sequence IS21 is essential for cleavage at the inner 3' ends of tandemly repeated IS21 elements in vitro. EMBO J. 9:4055-4063.[Medline]
  44. 23
  45. Reimmann, C., and D. Haas. 1987. Mode of replicon fusion mediated by the duplicated insertion sequence IS21 in Escherichia coli. Genetics. 115:619-625.[Abstract/Free Full Text]
  46. 24
  47. Reimmann, C., R. Moore, S. Little, A. Savioz, N. S. Willetts, and D. Haas. 1989. Genetic structure, function and regulation of the transposable element IS21. Mol. Gen. Genet. 215:416-424.[CrossRef][Medline]
  48. 25
  49. Reznikoff, W. S. 2003. Tn5 as a model for understanding DNA transposition. Mol. Microbiol. 47:1199-1206.[CrossRef][Medline]
  50. 26
  51. Rousseau, P., C. Normand, C. Loot, C. Turlan, R. Alazard, G. Duval-Valentin, and M. Chandler. 2002. Transposition of IS911, p. 367-383. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington, D.C.
  52. 27
  53. Sakai, J. S., N. Kleckner, X. Yang, and A. Guhathakurta. 2000. Tn10 transpososome assembly involves a folded intermediate that must be unfolded for target capture and strand transfer. EMBO J. 19:776-785.[CrossRef][Medline]
  54. 28
  55. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  56. 29
  57. Sekine, Y., K. Aihara, and E. Ohtsubo. 1999. Linearization and transposition of circular molecules of insertion sequence IS3. J. Mol. Biol. 294:21-34.[CrossRef][Medline]
  58. 30
  59. Sekine, Y., N. Eisaki, and E. Ohtsubo. 1994. Translational control in production of transposase and in transposition of insertion sequence IS3. J. Mol. Biol. 235:1406-1420.[CrossRef][Medline]
  60. 31
  61. Shiga, Y., Y. Sekine, and E. Ohtsubo. 1999. Transposition of IS1 circles. Genes Cells 4:551-561.[Abstract]
  62. 32
  63. Szeverenyi, I., T. Bodoky, and F. Olasz. 1996. Isolation, characterization and transposition of an (IS2)2 intermediate. Mol. Gen. Genet. 251:281-289.[Medline]
  64. 33
  65. Szeverenyi, I., Z. Nagy, T. Farkas, F. Olasz, and J. Kiss. 2003. Detection and analysis of transpositionally active head-to-tail dimers in three additional Escherichia coli IS elements. Microbiology 149:1297-1310.[Abstract/Free Full Text]
  66. 34
  67. Ton-Hoang, B., M. Betermier, P. Polard, and M. Chandler. 1997. Assembly of a strong promoter following IS911 circularization and the role of circles in transposition. EMBO. J. 16:3357-3371.[CrossRef][Medline]
  68. 35
  69. Turlan, C., and M. Chandler. 1995. IS1-mediated intramolecular rearrangements: formation of excised transposon circles and replicative deletions. EMBO. J. 14:5410-5421.[Medline]
  70. 36
  71. Turlan, C., and M. Chandler. 2000. Playing second fiddle: second-strand processing and liberation of transposable elements from donor DNA. Trends Microbiol. 8:268-274.[CrossRef][Medline]
  72. 37
  73. Vogele, K., E. Schwartz, C. Welz, E. Schiltz, and B. Rak. 1991. High-level ribosomal frameshifting directs the synthesis of IS150 gene products. Nucleic Acids Res. 19:4377-4385.[Abstract/Free Full Text]


Journal of Bacteriology, February 2004, p. 858-865, Vol. 186, No. 3
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.3.858-865.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lo, T.-C., Chen, H.-W., Tsai, Y.-K., Kuo, Y.-C., Lin, C.-F., Kuo, S.-Y., Lin, T.-H. (2008). Formation of an inverted repeat junction in the transposition of insertion sequence ISLC3 isolated from Lactobacillus casei. Microbiology 154: 1047-1058 [Abstract] [Full Text]  
  • Prosseda, G., Latella, M. C., Casalino, M., Nicoletti, M., Michienzi, S., Colonna, B. (2006). Plasticity of the Pjunc Promoter of ISEc11, a New Insertion Sequence of the IS1111 Family. J. Bacteriol. 188: 4681-4689 [Abstract] [Full Text]  
  • Tuffin, I. M., de Groot, P., Deane, S. M., Rawlings, D. E. (2005). An unusual Tn21-like transposon containing an ars operon is present in highly arsenic-resistant strains of the biomining bacterium Acidithiobacillus caldus. Microbiology 151: 3027-3039 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lewis, L. A.
Right arrow Articles by Grindley, N. D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lewis, L. A.
Right arrow Articles by Grindley, N. D. F.