This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howard, M. B.
Right arrow Articles by Hutcheson, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howard, M. B.
Right arrow Articles by Hutcheson, S. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH

 Previous Article  |  Next Article 

Journal of Bacteriology, March 2004, p. 1297-1303, Vol. 186, No. 5
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.5.1297-1303.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Chitinase B of "Microbulbifer degradans" 2-40 Contains Two Catalytic Domains with Different Chitinolytic Activities

Michael B. Howard,1 Nathan A. Ekborg,1 Larry E. Taylor II,1 Ronald M. Weiner,1,2 and Steven W. Hutcheson1*

Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, Maryland 20742,1 National Science Foundation, Division of Molecular and Cellular Biosciences, Arlington, Virginia 222302

Received 25 September 2003/ Accepted 24 November 2003


arrow
ABSTRACT
 
Chitinase B of "Microbulbifer degradans" 2-40 is a modular protein that is predicted to contain two glycoside hydrolase family 18 (GH18) catalytic domains, two polyserine domains, and an acidic repeat domain. Each of the GH18 domains was shown to be catalytically active against chitin. Activity assays reveal that the amino-terminal catalytic domain (GH18N) releases methylumbelliferone from 4'-methylumbelliferyl-N,N'-diacetylchitobiose 13.6-fold faster than the carboxy-terminal catalytic domain (GH18C) and releases chitobiose from the nonreducing end of chitooligosaccharides, therefore functioning as an exochitinase. GH18C releases methylumbelliferone from 4'-methylumbelliferyl-N,N',N"-triacetylchitotriose 2.7-fold faster than GH18N and cleaves chitooligosaccharides at multiple bonds, consistent with endochitinolytic activity. Each domain was maximally active from 30 to 37°C and from pH 7.2 to 8.0 and was not affected by Mg2+, Mn2+, Ca2+, K+, EDTA, EGTA, or 1.0 M NaCl. The activity of each domain was moderately inhibited by Ni2+, Sr2+, and Cu2+, while Hg2+ completely abolished activity. When the specific activities of various recombinant portions of ChiB were calculated by using native chitin as a substrate, the polypeptide containing the endo-acting domain was twofold more active on native chitin than the other containing the exo-acting domain. The presence of both domains in a single reaction increased the amount of reducing sugars released from native chitin to 140% above the theoretical combined rate, indicating that the domains function cooperatively to degrade chitin. These data demonstrate that the GH18 domains of ChiB have different activities on the same substrate and function cooperatively to enhance chitin depolymerization.


arrow
INTRODUCTION
 
Chitin, a homopolymer of ß-1,4-linked N-acetylglucosamine, is the second most abundant polymer in the biome (15). Chitin is a difficult substrate for microbial degradation because it is usually crystalline and complexed with protein, salts, and other carbohydrates. However, many microorganisms have developed efficient strategies for the depolymerization, transport, and metabolism of chitin and its derivatives. These systems involve multiple enzyme activities, usually encoded on separate polypeptides. Pseudoalteromonas sp. strain S91 (24), Serratia marcescens (22), and Streptomyces coelicolor A3 (2, 20), for example, secrete several chitin-depolymerizing enzymes in the presence of chitin. Endo- and exochitinases that function cooperatively to depolymerize chitin have been described (3, 6, 22). Endochitinases randomly cleave glycosidic linkages, generating free ends and long chitooligosaccharides. These are then acted upon by exochitinases that release chitobiose from the nonreducing ends of each. While exo- and endochitinases are able to depolymerize chitin alone, the presence of both activities significantly increases the efficiency of chitinolytic systems.

The glycoside hydrolase family 18 (GH18) domain is the most common catalytic domain of microbial chitin depolymerases (7). Despite sharing a consensus sequence and a conserved catalytic glutamic acid residue, GH18 domains may differ in their activity toward polymeric chitin and chitooligosaccharides (i.e., endo- versus exo- activity) (19). Chitodextrinases, which depolymerize chitooligosaccharides but not chitin, also contain GH18 domains (11). Chitinolytic enzymes with GH18 domains have been isolated from organisms as diverse as psychrophilic eubacteria (12) and hyperthermophilic archaeons (23), demonstrating the wide range of conditions to which these domains have adapted. Because conserved residues are found in GH18 domains with divergent optima and substrate specificities, sequence analysis is insufficient to determine the enzymatic specificities of newly discovered chitinases.

"Microbulbifer degradans" 2-40, a marine {gamma}-subgroup proteobacterium isolated from the Chesapeake Bay watershed in coastal Virginia, is able to degrade 10 complex polysaccharides, including chitin (2). The chitinolytic system of 2-40 has recently been shown to include three chitin depolymerases (ChiA, ChiB, and ChiC), a noncatalytic chitin-binding protein (CbpA), a chitodextrinase (CdxA), and three N-acetylglucosaminidases (HexA, HexB, and HexC) (9). ChiA and ChiB include long polyserine domains that appear to separate functional groups. One of the chitin depolymerases, ChiB, was selected for further study in this work because of its unusual structural features.

ChiB is a modular, 1,271-amino-acid enzyme with a calculated molecular mass of 136.1 kDa (9). The amino terminus is predicted to contain a secretion signal that is separated from the remainder of the protein by a polyserine domain of 148 amino acids, 99 of which are serine residues. ChiB is predicted to include two complete GH18 domains (amino-terminal domain GH18N and carboxy-terminal domain GH18C) separated by a 180-amino-acid linker domain which includes an acidic region consisting of TE-(ET)10 and another polyserine domain containing 39 serine residues. Here we report that both GH18 domains of ChiB are catalytically active but differentially cleave glycosidic linkages, depending on their location within the chitin polymer. In addition, it was shown that chitin depolymerization is enhanced by the presence of both domains. The implications and advantages of encoding two catalytic domains on a single polypeptide are discussed.


arrow
MATERIALS AND METHODS
 
Chemicals and reagents. Standard reagents, chitooligosaccharides, methylumbelliferone (MUF) substrates, and chitin were obtained from Sigma (St. Louis, Mo.). Ethylene glycol chitin was purchased from Fisher Scientific (Pittsburgh, Pa.). Ni-nitrilotriacetic acid (Ni-NTA) agarose was obtained from Qiagen (Valencia, Calif.). Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs (Beverly, Mass.). Bugbuster NT and pETBlue2 were obtained from Novagen (Madison, Wis.).

Cloning and expression of GH18N and GH18C. Oligonucleotide primers were designed to amplify the nucleotide sequence corresponding to each catalytic domain by PCR with purified "M. degradans" genomic DNA as a template. Primer sequences were as follows: GH18N-F (468), CTTGGCGCGCCATGGTGTAGATGCCGAATTG; GH18N-R (1924), CCGGGTACCGTTGTCTTCGTAATTGCCTTC; GH18C-F (2512), CTTGGCGCGCCATGGCGAAACAGATTTAG; and GH18C-R (3800), CCGGGTACCCTGCTTTTCGTTGCCGAA (restriction sites are underlined, and the relative position of the 5' nucleotide start of each primer within the chiB sequence is shown in parentheses). GH18N+C was created by using primers GH18N-F (468) and GH18C-R (3800). Each amplified fragment was then digested with the appropriate restriction enzymes and ligated into the protein expression vector pETBlue2 by using T4 DNA ligase. Expression constructs were verified by sequencing and transformed into E. coli Tuner DE3(pLacI) cells. Protein expression was performed according to the manufacturer's protocol. Cells were lysed with Bugbuster NT lysis buffer and centrifuged, and the supernatant was collected. Supernatants containing recombinant enzymes were applied to an Ni-NTA agarose column and purified according to the manufacturer's protocol for native protein purification. Purified enzyme samples were quantified by using a bovine serum albumin protein quantification kit (Pierce, Rockford, Ill.).

Glycol chitin zymography. Ethylene glycol chitin was incorporated into the separating portion of a sodium dodecyl sulfate-polyacrylamide gel to a final concentration of 0.01%. After fractionation of the proteins, the zymogram was incubated in refolding buffer (50 mM Tris-Cl, 1 mM EDTA, 5 mM 2-mercaptoethanol [pH 7.5]) overnight at 4°C and subsequently analyzed for chitin depolymerase activity as described elsewhere (8, 25).

Enzyme assays with chitin analogs. Solutions of 4'-methylumbelliferyl-N,N'-diacetylchitobiose (MUF-diNAG) and 4'-methylumbelliferyl-N,N',N"-triacetylchitotriose (MUF-triNAG) were prepared in 50 mM sodium phosphate buffer (pH 7.0). Reaction mixtures contained 2 µg of purified enzyme and 30 µM analog solution. After incubation for 5 to 10 min at 37°C for GH18N or for 5 to 20 min at 30°C for GH18C, reactions were stopped by submersion in an ice water bath. Liberated methylumbelliferone was detected with a Hoefer TKO-100 fluorometer. The reaction was measured at multiple time points between 5 and 20 min and was found to be linear, with less than 10% of the substrate being degraded.

Oligosaccharide electrophoresis. Labeling and electrophoresis of chitooligosaccharides were performed as described previously (8). Briefly, the reactions were incubated with 2 volumes of labeling solution (1.0 M sodium cyanoborohydride, 0.2 M 2-aminobenzoic acid) and dried under vacuum. Each sample was mixed with standard 2x sodium dodecyl sulfate-polyacrylamide gel electrophoresis loading buffer and fractionated in a 15% polyacrylamide gel at a 45-mA constant current. Labeled oligosaccharides were visualized under UV light.

Determination of reaction optima for each domain. MUF-diNAG or MUF-triNAG was added to 20 µg of purified enzyme and incubated at a given pH or temperature, and activity was detected as described above. The buffers used were sodium acetate (pH 4.0 to 5.5), MES (morpholineethanesulfonic acid) (pH 5.5 to 6.5), PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)] (pH 6.5 to 7.0), HEPES (pH 7.0 to 8.0), and Tris base (pH 8.0 to 9.5). For a given enzyme, the activity under reaction conditions that permitted maximum activity was assigned a value of 100%. Where indicated, EDTA, EGTA, KCl, NiCl2, SrCl2, MgCl2, MnCl2, CuCl2, CaCl2, or HgCl2 was added to reaction mixtures to a final concentration of 10 mM; NaCl was added at concentrations of up to 1.0 M. Reaction mixtures containing metal ions contained 200 pmol of enzyme and were incubated for 10 min at 37°C for GH18N or for 20 min at 30°C for GH18C.

Enzyme assays with chitin and chitin derivatives. Purified enzyme and substrate (2 mg of chitin or 10 nmol of chitooligosaccharide) were added to 50 mM HEPES (pH 7.5) and incubated at 30°C. The amount of reducing sugar generated was determined by the dinitrosalicylic acid assay as described elsewhere (14). Specific enzyme activity was estimated by comparison to a standard curve.

Protein sequence analysis. Analysis of protein domains was performed with the Simple Modular Architecture Research Tool (21). Similarity between proteins and protein domains was determined by the BLAST algorithm (1). The lipoprotein-anchoring site within ChiB was identified by using the database of bacterial lipoproteins (13).

Nucleotide sequence accession number. The nucleotide and protein sequences of ChiB have been placed in GenBank under accession number BK001042.


arrow
RESULTS
 
ChiB is predicted to contain two catalytic domains and a lipoprotein acylation site. ChiB was previously predicted to contain two catalytic sites (9). The first catalytic site, GH18N, was identified in the amino-terminal region of ChiB (residues 221 to 605) (Fig. 1). It consists of 385 amino acids and is most similar to the GH18 domain of the exochitinase ChiB of S. marcescens (S52422) (55% identity and 69% similarity). A second predicted catalytic site, GH18C, was present in the carboxy-terminal domain of ChiB (residues 860 to 1254). This domain is composed of 395 amino acids and is most similar to a chitinase from Vibrio sp. strain 5SM-1 (AAL46648) (49% identity and 66% similarity). The two GH18 domains of ChiB share only 29% identity and 42% similarity when aligned at the amino acid level. GH18N and GH18C include the motifs SVGGWAESN-X33-FDGIDIDWEYP and SIGGWTMSTPF-X26-FDGVDIDWEYP, respectively. These sequences are nearly identical to the consensus sequence that characterizes a GH18 domain, and each also includes the key catalytic Glu residue (underlined) (19).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. Comparison of the domain architectures of T. kodakaraensis KOD1 ChiA and "M. degradans" strain 2-40 ChiB. Gray boxes, type II secretion signal; black boxes, predicted lipobox; SSS, polyserine domains; hatched box, acidic repeat domain; crosshatched boxes, chitin binding domains. Black bars indicate the truncated portions of ChiB created for this work. GH18N is located between amino acids 221 and 605 of ChiB. GH18C is located between amino acids 860 and 1254.

ChiB was found to contain a predicted lipobox within amino acid residues 16 to 19, composed of L-S-A-C. In addition, two positively charged residues are found within the first five amino acids (N at position 2 and K at position 5) and are separated from the lipobox by a hydrophobic stretch of 10 amino acids. These characteristics satisfy the major criteria required for a lipoprotein secretion signal and acylation site (10, 13).

GH18N and GH18C independently depolymerize chitin. To determine whether the GH18 domains of ChiB are catalytically active against chitin, the sequence corresponding to each domain (GH18N, codons 156 to 641; GH18C, codons 837 to 1266) was amplified by PCR and ligated into pETBlue2 to create carboxy-terminal His6 fusions. The polypeptides were expressed in Escherichia coli and purified on Ni-NTA agarose columns. The chitinolytic activity of each GH18 domain was tested by using a glycol chitin zymogram. Consistent with their conserved sequence features, the ability of each catalytic domain to independently depolymerize chitin was apparent in zymograms (Fig. 2). Clear zones indicative of depolymerization were observed and corresponded to the predicted masses of the recombinant polypeptides (50.5 kDa for GH18N and 47.7 kDa for GH18C).



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 2. The predicted GH18 domains of ChiB are catalytically active against chitin. The nucleotide sequence corresponding to each predicted catalytic domain and some flanking sequence (GH18N, codons 156 to 641; GH18C, codons 837 to 1266) was amplified by PCR, ligated into the pETBlue2 expression vector, induced by IPTG (isopropyl-ß-D-thiogalactopyranoside), and purified from cell lysates on an Ni-NTA agarose column. Equal amounts of each recombinant protein (20 µg) were fractionated by electrophoresis in a glycol chitin zymogram and refolded as described in Materials and Methods. After staining with Calcofluor, zones of activity appear as dark bands against a bright background. The sizes of the active bands are in good agreement with the predicted masses of the recombinant proteins.

GH18N and GH18C differentially degrade chitin analogs. One possible explanation for the presence of two catalytic domains within ChiB is that each has a different role in the degradation of chitin, as was observed in an archaeal chitinase from Thermococcus kodakaraensis KOD1 (23). The chitin analogs MUF-diNAG and MUF-triNAG consist of chitobiose or chitotriose linked to an MUF moiety at the reducing end that fluoresces under UV light only when cleaved from the saccharide (16). In theory, both exochitinases and endochitinases will hydrolyze the second glycosidic linkage from the nonreducing end of MUF-diNAG, thus releasing fluorescent MUF. Exochitinase activity on MUF-triNAG will result in the formation of chitobiose and nonfluorescent MUF-GlcNAc, while endochitinolytic activity can hydrolyze both the second and third glycosidic linkages of MUF-triNAG, thus releasing MUF.

Purified enzyme samples were added to solutions of either analog, and the release of MUF was monitored fluorometrically during the period of linear accumulation of product. When incubated with MUF-diNAG, the rate of MUF release by GH18N was 13.6-fold higher than that observed when GH18C was utilized. However, when GH18C was incubated with MUF-triNAG, the rate of MUF release was 2.7-fold higher than when it was incubated with GH18N (Table 1). These results suggest that GH18N may have exochitinase activity whereas GH18C may have endochitinase activity.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Activities of polypeptides containing ChiB catalytic domains on different MUF analogs

The GH18 domains have similar reaction optima. The presence of two catalytic domains for the same substrate within a single polypeptide of an enzyme is rare. If the dual domains of ChiB act together to degrade chitin, it would follow that these domains are most active under similar physical conditions. Ionic, pH, and temperature optima were determined for each domain. Purified samples of each enzyme were incubated with the optimal MUF substrate as identified above. GH18N had a pH optimum of between 7.2 and 8.0, while GH18C was most active from pH 7.2 to 7.8 (Fig. 3, top panel). The temperature optimum of GH18N was determined to be 37°C, with retention of 80% of its activity at 30°C. GH18C was most active at 30°C and retained only 67% of its activity at 37°C (Fig. 3, bottom panel). A significant loss of activity was observed for each domain at temperatures of above 40°C. Each domain was most active on its optimal MUF substrate regardless of temperature or pH (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 3. GH18N and GH18C have similar pH and temperature optima. To determine the pH optimum (top panel) and temperature optimum (bottom panel) for each catalytic domain, GH18N (triangles) and GH18C (squares) were purified as described in Materials and Methods and incubated with MUF-diNAG or MUF-triNAG, respectively, as described in footnote a of Table 1. The activity under reaction conditions that permitted maximum activity was assigned a value of 100%. The data are the means from three replicates, and each experiment was repeated three times with similar results. Standard errors are indicated by error bars.

To examine the effect of ionic conditions on each domain, various chloride salts were added to reaction mixtures. The addition of Mg2+, Mn2+, Ca2+, K+, EDTA, and EGTA to 10 mM, and NaCl up to 1.0 M had no effect on the activity of either domain. The activity of GH18N was reduced 36% by Ni2+, 8% by Sr2+, and 41% by Cu2+, while the activity of GH18C was reduced 14% by Ni2+, 5% by Sr2+, and 53% by Cu2+. Hg2+ completely inhibited the activities of both domains (data not shown).

The GH18 domains have different activities on chitooligosaccharides. The products formed from the activities of GH18N and GH18C on native chitooligosaccharides were determined. Native chitooligosaccharides (GlcNAc4, GlcNAc5, and GlcNAc6) were incubated with purified samples of each polypeptide, and degradation products were labeled with 2-aminobenzoic acid and fractionated by gel electrophoresis. Consistent with exochitinase activity, the sole degradation product of GH18N activity on GlcNAc4 was chitobiose (Fig. 4A). Further, GH18N released chitobiose primarily from GlcNAc5, and GlcNAc4 was not observed (Fig. 4B). When incubated with GlcNAc6, GH18N produced chitobiose and GlcNAc4 but did not produce GlcNAc3 or GlcNAc5 (Fig. 4C). In contrast, GH18C produced a mixture of chitooligosaccharides when acting on GlcNAc4, GlcNAc5, and GlcNAc6 (Fig. 4), consistent with the ability of an endochitinase to cleave a chitooligosaccharide at any glycosidic linkage after the first bond at the nonreducing end. When incubated with 2-aminobenzoic acid-labeled chitohexose, GH18N produced an increasing amount of labeled chitobiose over time, consistent with degradation from the nonreducing end. GH18C activity on prelabeled chitohexose produced labeled GlcNAc2, GlcNAc3, and GlcNAc4 (data not shown). The absence of labeled GlcNAc5 suggests that the first glycosidic bond at the nonreducing end cannot be cleaved by this enzyme.



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 4. GH18N and GH18C exhibit exo- and endochitinase activities, respectively. GH18N and GH18C were purified as described in Materials and Methods and incubated with GlcNAc4 (A), GlcNAc5 (B), and GlcNAc6 (C). Standards and reaction products were labeled with 2-aminobenzoic acid and fractionated by electrophoresis in a 15% polyacrylamide gel (8). Labeled chitooligosaccharides were visualized by using a UV transilluminator. Standards, from bottom, are chitobiose, chitotriose, chitotetrose, and chitopentose.

GH18N and GH18C function cooperatively to degrade native chitin. The impact of the differential activities in a single reaction mixture, both when the catalytic domains are linked on a single polypeptide and when they are expressed as separate enzymes, was examined. Equivalent amounts (250 pmol) of GH18N or GH18C were added individually to native chitin to determine the rate at which each could release reducing sugars, an indication of depolymerization. GH18N released 0.0158 µmol of reducing sugar/min when added to native chitin, whereas GH18C released 0.0340 µmol/min (Table 2). A similar rate was measured at multiple time points during the initial 30 min of each reaction.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Activities of polypeptides containing ChiB catalytic domains on native chitin

To determine if the active domains function cooperatively to degrade chitin, equivalent amounts of each polypeptide were added to native chitin in a single reaction. If the domains act independently of each other, the theoretical combined rate of degradation should be greater than the sum of the two independent activities calculated above, i.e., 0.0498 µmol of reducing sugar/min/500 pmol of total protein. Consistent with the proposed endo- and exo- activities of each domain, the actual rate was 140% higher than the theoretical rate (Table 2).

Because in their native state the domains are linked on a single polypeptide, the rate of depolymerization was also measured when both catalytic domains were present and attached with their native linkage (Fig. 1). Full-length enzyme could not be used in these experiments because of difficulties in expressing the complete protein, possibly due to the serine-rich, 150-residue linker region at the amino terminus. The truncated form of ChiB lacking the postulated lipoprotein-anchoring site and linker region, GH18N+C, was used instead (residues 156 to 1266). GH18N+C released 0.0645 µmol of reducing sugar/min when 250 pmol of polypeptide (and therefore 250 pmol of each active domain) was added, an increase of 23% over the theoretical combined rate.


arrow
DISCUSSION
 
"M. degradans" strain 2-40 is known to efficiently metabolize chitin and many other insoluble complex polysaccharides (4). Analysis of the chitinolytic system of 2-40 revealed an unusual chitin depolymerase, ChiB, which appeared to include two catalytic domains. One of the catalytic domains of ChiB was shown here to function as an endochitinase, while the other functions as an exochitinase. ChiB is the first eubacterial chitinase demonstrated to contain two functional GH18 catalytic domains (9). The lack of carbohydrate binding domains and typical accessory domains (e.g., fibronectin type III domains or polycystic kidney disease domains) (19), coupled with the discrete activities of each catalytic domain, emphasizes the novelty of this enzyme.

When expressed as separate polypeptides, each GH18 domain of ChiB was able to depolymerize chitin in zymograms and was most active under similar temperature, pH, and ionic conditions. GH18N was more active on MUF-diNAG than on MUF-triNAG and displayed a pattern of activity typical of an exochitinase on chitooligosaccharides. Chitobiose was released from the nonreducing end of GlcNAc4, GlcNAc5, and GlcNAc6. Conversely, GH18C released MUF most rapidly from MUF-triNAG and was able to cleave chitooligosaccharides at multiple linkages, demonstrating endochitinase activity. GH18C was more than twice as active on native chitin as GH18N; because native chitin has a paucity of free, exposed ends, exochitinases have far fewer sites at which they can act than do random-cutting endochitinases, which can cleave virtually any glycosidic linkage in the polymer. The synergistic degradation of chitin observed when both domains were present further supports their proposed function. The presence of both domains on separate polypeptides increased the release of reducing sugars 140% over the theoretical combined rate calculated if the domains were only to act additively. This synergism would not be observed if both domains had the same activity.

Carbohydrases with two catalytic domains are rare among prokaryotes. Only a small number have been characterized, mostly from ruminants and thermophiles. For example, Ruminococcus flavefaciens 17 (5) and Fibrobacter succinogenes S85 (17), produce xylanases with two catalytic domains, although the latter appears to encode a xylanase with two domains of the same function. Two extreme thermophiles, Anaerocellum thermophilum (a {gamma}-subgroup proteobacterium) and T. kodakaraensis KOD1 (an archaeon), produce enzymes with two catalytic domains (23, 26). A. thermophilum produces a cellulase with separate GH9 and GH48 domains that encode endo- and exoglucanase activities, respectively. A chitinase from T. kodakaraensis, Tk-ChiA, was shown to have an amino-terminal exochitinase domain, while the carboxy terminus contains an endochitinase domain. Unlike ChiB of "M. degradans," this enzyme also contains chitin binding domains and is not predicted to anchor to the cell surface. Further, the exolytic domain of Tk-ChiA is able to weakly cleave the third glycosidic linkage from the nonreducing ends of free chitin chains (23), an activity not observed in experiments with GH18N.

The dual catalytic domains of ChiB function cooperatively to degrade chitin to chitobiose. Although maximal depolymerization was achieved when the catalytic domains of ChiB were on separate polypeptides, there are clear benefits to their presence as a single unit. First, a single promoter region is able to regulate the expression of two enzymatic activities. This permits two essential components of the chitinolytic system to be simultaneously regulated from a single locus, much like an operon regulating genes encoding a polycistronic mRNA. However, unlike for an operon, where several individual proteins are produced, a single enzyme is encoded. The amount of energy and secretion machinery needed to deliver two enzymatic functions to the exterior of the cell is therefore decreased. Second, encoding both activities on a single polypeptide ensures the proximity of the two domains during the in situ depolymerization of chitin. This allows for a synergistic and focused degradation of the polymer. In the environment, secreted enzymes may diffuse away from their intended targets and not be available to assist other components of a degradative system. This is partially solved by the presence of carbohydrate binding domains (which appear to be lacking from ChiB), but there is no assurance that both endo- and exo-acting enzymes will bind to the same location and have the opportunity to act in concert to achieve the full potential of the system unless they are linked on a single polypeptide.

When both domains were present on the same polypeptide, the synergism between the domains was less obvious. The activity detected when the domains are joined was only modestly increased over the theoretical activity when compared to the activities of the two catalytic domains as separate entities. The decreased activity of the domains when linked may be the result of the domains then moving as a single protein as each encounters substrate. For example, as the exolytic domain is cleaving soluble chitooligosaccharides, perhaps away from the insoluble polymer, the endolytic domain is unable to contact, and therefore degrade, its primary substrate. One can envision that the amount of reducing sugars released would increase if the domains were free to act at different locations. However, such an arrangement may not be of benefit in nature, where substrate is much more limited and less often encountered than in a laboratory reaction.

Based upon the data presented in this work and on the known properties of chitinases, a model of ChiB activity can be proposed (Fig. 5). Each catalytic site has been shown to be independently active, so the linkage between the domains may prevent interference between them during the degradation of chitin. The significance of the repetitive sequence in this region is unclear. The processive cutting nature of exochitinases and random cutting behavior of endochitinases have been described (18) and can be applied to the activity model of ChiB. As GH18C releases chitooligosaccharides from the polymer, they can be immediately acted upon by GH18N, which processively cleaves chitobiose from the nonreducing end. The lipoprotein acylation site present at the amino terminus of ChiB likely functions to anchor the enzyme to the outer membrane. This notion is strengthened by the observation that chitinase activity has been associated with outer membrane preparations of "M. degradans" (L. A. Whitehead and R. M. Weiner, unpublished observations). The membrane anchorage would keep two critical enzymatic activities in close proximity to the cell and perhaps eliminate the necessity of chitin binding domains. If this is the case, the importance of the catalytic domain arrangement within ChiB becomes apparent; chitooligosaccharides released by the activity of the distal GH18C can be transferred to the exo-acting domain, which is in close proximity to the outer membrane where newly formed chitobiose can be taken up by the cell. The outer membrane localization of ChiB and other carbohydrases produced by "M. degradans" is currently being evaluated.



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 5. Model of chitin depolymerization by ChiB. ChiB is likely to attach to the surface of the cell via a lipoprotein anchor (black box). Activity of the endochitinolytic GH18C releases chitooligosaccharides from polymeric chitin (stippled box). Free chitooligosaccharides (circles) are then acted upon by the exochitinolytic GH18N that processively releases chitobiose from the nonreducing end. Free chitobiose would then be taken up by the cell and metabolized. The polyserine linkers (SSS) may provide flexibility to the enzyme and optimize interaction with substrates.


arrow
ACKNOWLEDGMENTS
 
This work was funded by grants from the Maryland Sea Grant College (SA7528051E) and the National Science Foundation (DEB0109869).

We thank the Joint Genome Institute of the United States Department of Energy (JGI/DOE) for their efforts in sequencing the "M. degradans" genome and J. Bretz for valuable discussions.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742. Phone: (301) 405-5498. Fax: (301) 314-9489. E-mail: sh53{at}umail.umd.edu. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. 2
  3. Andrykovich, G., and I. Marx. 1988. Isolation of a new polysaccharide digesting bacterium from a salt marsh. Appl. Microbiol. Biotechnol. 54:1061-1062.
  4. 3
  5. Brurberg, M. B., I. F. Nes, and V. G. Eijsink. 1996. Comparative studies of chitinases A and B from Serratia marcescens. Microbiology 142:1581-1589.[Abstract/Free Full Text]
  6. 4
  7. Ensor, L., S. Stosz, and R. Weiner. 1999. Expression of multiple complex polysaccharide-degrading enzyme systems by marine bacterium strain 2-40. J. Ind. Microbiol. Biotechnol. 23:123-126.[CrossRef][Medline]
  8. 5
  9. Flint, H. J., J. Martin, C. A. McPherson, A. S. Daniel, and J. X. Zhang. 1993. A bifunctional enzyme, with separate xylanase and beta(1, 3-1,4)-glucanase domains, encoded by the xynD gene of Ruminococcus flavefaciens. J. Bacteriol. 175:2943-2951.[Abstract/Free Full Text]
  10. 6
  11. Gao, J., M. W. Bauer, K. R. Shockley, M. A. Pysz, and R. M. Kelly. 2003. Growth of hyperthermophilic archaeon Pyrococcus furiosus on chitin involves two family 18 chitinases. Appl. Environ. Microbiol. 69:3119-3128.[Abstract/Free Full Text]
  12. 7
  13. Henrissat, B. 1999. Classification of chitinases modules. EXS 87:137-156.[Medline]
  14. 8
  15. Howard, M., N. Ekborg, R. Weiner, and S. Hutcheson. 2003. Detection and characterization of chitinases and other chitin modifying enzymes. J. Ind. Microbiol. Biotechnol. 30:627-635.
  16. 9
  17. Howard, M. B., N. A. Ekborg, L. E. Taylor, R. M. Weiner, and S. W. Hutcheson. 2003. Genomic analysis and initial characterization of the chitinolytic system of Microbulbifer degradans strain 2-40. J. Bacteriol. 185:3352-3360.[Abstract/Free Full Text]
  18. 10
  19. Inouye, S., S. Wang, J. Sekizawa, S. Halegoua, and M. Inouye. 1977. Amino acid sequence for the peptide extension on the prolipoprotein of the Escherichia coli outer membrane. Proc. Natl. Acad. Sci. USA 74:1004-1008.[Abstract/Free Full Text]
  20. 11
  21. Keyhani, N., and S. Roseman. 1996. Molecular cloning, isolation, and characterization of a periplasmic chitodextrinase. J. Biol. Chem. 271:33414-33424.[Abstract/Free Full Text]
  22. 12
  23. Lonhienne, T., K. Mavromatis, C. E. Vorgias, L. Buchon, C. Gerday, and V. Bouriotis. 2001. Cloning, sequences, and characterization of two chitinase genes from the Antarctic Arthrobacter sp. strain TAD20: isolation and partial characterization of the enzymes. J. Bacteriol. 183:1773-1779.[Abstract/Free Full Text]
  24. 13
  25. Madan Babu, M., and K. Sankaran. 2002. DOLOP—database of bacterial lipoproteins. Bioinformatics 18:641-643.[Abstract/Free Full Text]
  26. 14
  27. Miller, G. 1959. Use of dinitrosalicylic acid reagent for detection of reducing sugar. Anal. Chem. 31:426-428.[CrossRef]
  28. 15
  29. Muzzarelli, R. 1999. Native, industrial, and fossil chitins. In P. Jollès and R. A. A. Muzzarelli (ed.), Chitin and chitinases. Birkhauser, Basel, Switzerland.
  30. 16
  31. O'Brien, M., and R. R. Colwell. 1987. A rapid test for chitinase activity that uses 4-methylumbelliferyl-N-acetyl-beta-D-glucosaminide. Appl. Environ. Microbiol. 53:1718-1720.[Abstract/Free Full Text]
  32. 17
  33. Paradis, F. W., H. Zhu, P. J. Krell, J. P. Phillips, and C. W. Forsberg. 1993. The xynC gene from Fibrobacter succinogenes S85 codes for a xylanase with two similar catalytic domains. J. Bacteriol. 175:7666-7672.[Abstract/Free Full Text]
  34. 18
  35. Robbins, P. W., C. Albright, and B. Benfield. 1988. Cloning and expression of a Streptomyces plicatus chitinase (chitinase-63) in Escherichia coli. J. Biol. Chem. 263:443-447.[Abstract/Free Full Text]
  36. 19
  37. Robertus, J. D., and A. F. Monzingo. 1999. The structure and action of chitinases. EXS 87:125-135.[Medline]
  38. 20
  39. Saito, A., T. Fujii, T. Yoneyama, M. Redenbach, T. Ohno, T. Watanabe, and K. Miyashita. 1999. High-multiplicity of chitinase genes in Streptomyces coelicolor A3(2). Biosci. Biotechnol. Biochem. 63:710-718.[CrossRef][Medline]
  40. 21
  41. Schultz, J., R. R. Copley, T. Doerks, C. P. Ponting, and P. Bork. 2000. SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res. 28:231-234.[Abstract/Free Full Text]
  42. 22
  43. Suzuki, K., N. Sugawara, M. Suzuki, T. Uchiyama, F. Katouno, N. Nikaidou, and T. Watanabe. 2002. Chitinases A, B, and C1 of Serratia marcescens 2170 produced by recombinant Escherichia coli: enzymatic properties and synergism on chitin degradation. Biosci. Biotechnol. Biochem. 66:1075-1083.[CrossRef][Medline]
  44. 23
  45. Tanaka, T., T. Fukui, and T. Imanaka. 2001. Different cleavage specificities of the dual catalytic domains in chitinase from the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1. J. Biol. Chem. 276:35629-35635.[Abstract/Free Full Text]
  46. 24
  47. Techkarnjanaruk, S., and A. E. Goodman. 1999. Multiple genes involved in chitin degradation from the marine bacterium Pseudoalteromonas sp. strain S91. Microbiology 145:925-934.[Abstract/Free Full Text]
  48. 25
  49. Trudel, J., and A. Asselin. 1989. Detection of chitinase activity after polyacrylamide gel electrophoresis. Anal. Biochem. 178:362-366.[CrossRef][Medline]
  50. 26
  51. Zverlov, V., S. Mahr, K. Riedel, and K. Bronnenmeier. 1998. Properties and gene structure of a bifunctional cellulolytic enzyme (CelA) from the extreme thermophile ‘Anaerocellum thermophilum ’ with separate glycosyl hydrolase family 9 and 48 catalytic domains. Microbiology 144:457-465.[Abstract/Free Full Text]


Journal of Bacteriology, March 2004, p. 1297-1303, Vol. 186, No. 5
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.5.1297-1303.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Ekborg, N. A., Morrill, W., Burgoyne, A. M., Li, L., Distel, D. L. (2007). CelAB, a Multifunctional Cellulase Encoded by Teredinibacter turnerae T7902T, a Culturable Symbiont Isolated from the Wood-Boring Marine Bivalve Lyrodus pedicellatus. Appl. Environ. Microbiol. 73: 7785-7788 [Abstract] [Full Text]  
  • Taylor, L. E. II, Henrissat, B., Coutinho, P. M., Ekborg, N. A., Hutcheson, S. W., Weiner, R. M. (2006). Complete Cellulase System in the Marine Bacterium Saccharophagus degradans Strain 2-40T. J. Bacteriol. 188: 3849-3861 [Abstract] [Full Text]  
  • Babu, M. M., Priya, M. L., Selvan, A. T., Madera, M., Gough, J., Aravind, L., Sankaran, K. (2006). A Database of Bacterial Lipoproteins (DOLOP) with Functional Assignments to Predicted Lipoproteins.. J. Bacteriol. 188: 2761-2773 [Abstract] [Full Text]  
  • Lim, J.-M., Jeon, C. O., Lee, J.-C., Song, S.-M., Kim, K.-Y., Kim, C.-J. (2006). Marinimicrobium koreense gen. nov., sp. nov. and Marinimicrobium agarilyticum sp. nov., novel moderately halotolerant bacteria isolated from tidal flat sediment in Korea.. Int. J. Syst. Evol. Microbiol. 56: 653-657 [Abstract] [Full Text]  
  • Adams, B., Musiyenko, A., Kumar, R., Barik, S. (2005). A Novel Class of Dual-family Immunophilins. J. Biol. Chem. 280: 24308-24314 [Abstract] [Full Text]  
  • LeCleir, G. R., Buchan, A., Hollibaugh, J. T. (2004). Chitinase Gene Sequences Retrieved from Diverse Aquatic Habitats Reveal Environment-Specific Distributions. Appl. Environ. Microbiol. 70: 6977-6983 [Abstract] [Full Text]  
  • Liu, L., Wilson, T., Hastings, J. W. (2004). Molecular evolution of dinoflagellate luciferases, enzymes with three catalytic domains in a single polypeptide. Proc. Natl. Acad. Sci. USA 101: 16555-16560 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howard, M. B.
Right arrow Articles by Hutcheson, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howard, M. B.
Right arrow Articles by Hutcheson, S. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH