Journal of Bacteriology, March 2004, p. 1409-1414, Vol. 186, No. 5
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.5.1409-1414.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
A Dominant-Negative fur Mutation in Bradyrhizobium japonicum
Heather P. Benson,1 Kristin LeVier,2 and Mary Lou Guerinot1*
Department of Biological Sciences, Dartmouth College, Hanover, New Hampshire 03755,1
Pfizer Co., Ann Arbor, Michigan 481052
Received 13 August 2003/
Accepted 14 November 2003
 |
ABSTRACT
|
|---|
In many bacteria, the ferric uptake regulator (Fur) protein plays a central role in the regulation of iron uptake genes. Because iron figures prominently in the agriculturally important symbiosis between soybean and its nitrogen-fixing endosymbiont Bradyrhizobium japonicum, we wanted to assess the role of Fur in the interaction. We identified a fur mutant by selecting for manganese resistance. Manganese interacts with the Fur protein and represses iron uptake genes. In the presence of high levels of manganese, bacteria with a wild-type copy of the fur gene repress iron uptake systems and starve for iron, whereas fur mutants fail to repress iron uptake systems and survive. The B. japonicum fur mutant, as expected, fails to repress iron-regulated outer membrane proteins in the presence of iron. Unexpectedly, a wild-type copy of the fur gene cannot complement the fur mutant. Expression of the fur mutant allele in wild-type cells leads to a fur phenotype. Unlike a B. japonicum fur-null mutant, the strain carrying the dominant-negative fur mutation is unable to form functional, nitrogen-fixing nodules on soybean, mung bean, or cowpea, suggesting a role for a Fur-regulated protein or proteins in the symbiosis.
 |
INTRODUCTION
|
|---|
Rhizobia live in the soil or engage in symbiosis with a suitable legume. Each environment presents unique challenges with respect to iron acquisition. As free-living soil microorganisms, rhizobia must have a way to solubilize iron as well as a way to compete for this nutrient with other organisms present in the rhizosphere. As endosymbionts, rhizobia must have mechanisms for acquiring iron from the host plant.
In many microbes, including various species of rhizobia, iron deficiency induces a variety of high-affinity iron uptake systems that are involved in the solubilization and sequestration of Fe(III) (6). These systems are composed of siderophores, high-affinity Fe(III) chelators that are released by cells to scavenge Fe(III), and their specific uptake systems. In gram-negative bacteria, siderophore uptake requires a TonB-dependent outer membrane protein, a periplasmic binding protein, and a cytoplasmic membrane ATP-binding cassette (ABC) transporter system. Both siderophore biosynthetic genes and the genes for Fe(III)-siderophore uptake systems are only expressed under iron-limiting conditions and have been shown to be negatively controlled by the Fur repressor protein (reviewed in reference 16). Fur regulation appears to be highly conserved among most bacterial species. fur genes have been identified in numerous gram-positive or gram-negative bacteria, including Bradyrhizobium japonicum (14) and Rhizobium leguminosarum (5).
Although originally identified as a repressor of iron transport and siderophore biosynthesis, fur has also been reported to regulate genes involved in a wide variety of functions, including oxidative stress, energy metabolism, and virulence, suggesting that defects in Fur regulation could have serious consequences for a microorganism (16). Indeed, attempts to obtain fur mutants by gene replacement have been unsuccessful in a number of species, including Pseudomonas aeruginosa (33), Neisseria gonorrhoeae (4), and Vibrio anguillarum (39). However, it is possible to select for fur mutants by using manganese (8, 17, 24, 27). Manganese mimics iron by binding to the Fur protein and repressing iron uptake genes. As a result, bacteria with a wild-type copy of the fur gene repress iron uptake systems and starve for iron in the presence of manganese, whereas fur mutants fail to repress iron uptake systems and survive. The Fur protein from such mutants is thought to retain some function, which is why this particular class of mutations is not lethal.
Here we report on a fur mutant of B. japonicum selected for resistance to manganese and contrast its symbiotic phenotype with that of a B. japonicum fur-null mutant that had previously been shown to be derepressed for iron uptake in culture (14). The fur-null mutant forms an effective symbiosis, whereas the manganese-resistant fur mutant strain is unable to form functional, nitrogen-fixing nodules on soybean, mung bean, or cowpea, suggesting a role for a Fur-regulated protein or proteins in the symbiosis.
 |
MATERIALS AND METHODS
|
|---|
Materials.
Restriction enzymes and the Klenow fragment of DNA polymerase were purchased from New England Biolabs (Beverly, Mass). Ampli Taq DNA polymerase was obtained from Perkin-Elmer (Foster City, Calif.). T4 DNA ligase and calf intestinal alkaline phosphatase (CIAP) were purchased from GIBCO-BRL (Gaithersburg, Md.). All other chemicals were purchased from Sigma Chemical Co. (St. Louis. Mo.) unless otherwise stated.
Strains, plasmids, bacteria, phage, and bacterial growth conditions.
All strains and plasmids used in this study are listed in Table 1. Escherichia coli cultures were grown in Luria-Bertani broth at 37°C supplemented with ampicillin at 50 µg/ml, tetracycline at 20 µg/ml, or kanamycin at 30 µg/ml when necessary. E. coli cells grown for phage lambda plating were supplemented with maltose (0.2% final concentration) and MgSO4 (10 mM final concentration), and phage infections were performed by standard procedures (2). B. japonicum cells were grown at 30°C in arabinose-gluconate (AG) medium (34), yeast extract-mannitol (YEM) (41), or minimal medium (12). Media were supplemented with 40 mM MnCl2, 200-µg/ml tetracycline, or 30-µg/ml rifampin as needed. The pH of both YEM and minimal medium was adjusted to 6.8 before autoclaving. Cells were cultured initially in YEM or AG medium and then diluted into iron-free minimal medium. After 1 cycle of growth in minimal medium, cells were again diluted into iron-free minimal medium. Precautions were taken to minimize the iron content of both the culture vessels and the medium. Glassware was washed with 1 N HCl and then rinsed with double-distilled water. Plasmids were transferred to B. japonicum by using the helper plasmid pRK2013 (7).
Cloning the fur gene.
Degenerate primers Rfur1 [GA(A/G)GA(T/C)CA(T/C)CCIGA(T/C)GTIGA] and Rfur3rev [TCIATIA(A/G)(A/G)TG(A/G)TC(A/G)TG(A/G)TG] were constructed to conserved regions of the fur gene. A fragment of 157 bp was amplified and cloned into pBluescriptSK-. The fragment was used as a probe to screen a Lambda Zap II genomic library of B. japonicum 61A152. The library was constructed by digesting genomic DNA with Tsp509 and then cloning the DNA fragments into an EcoRI site of the Zap II lambda vector (Stratagene). A full-length copy of the fur gene was isolated from the library and sequenced. The mutant copy of the fur gene was PCR amplified from genomic DNA by using HLPfor (CGTGACTTGTCGTAACATTG) and HLPrev (CGACAGGAGATCACCTCGCTGT) primers. In order to isolate DNA sequence upstream of the fur gene carried by the Mnr mutant, a subgenomic DNA library was constructed. Genomic DNA from the Mnr mutant was isolated and digested with EcoRI and subcloned into CIAP-treated pBluescriptSK+. Probing colony lifts with a wild-type fur gene isolated a clone of 2.5 kb that contained the fur gene from the Mnr mutant.
Selection for Mnr Mutants.
Manganese selection was based on the protocol of Hantke (17), with the following modifications. Minimal medium with 15 g of agar per liter was used. Mannitol (0.2%), dipyridyl (0.1 mM), and various concentrations of MnCl2 were added as filter-sterilized stocks after autoclaving. Wild-type B. japonicum cells were diluted in 0.1% Tween 80 and spread plated onto selective plates containing 40 mM MnCl2. Growth of wild-type 61A152 cells was completely inhibited by 40 mM MnCl2. Only fresh plates were used as described by Silver et al. (35).
Protein preparation and SDS-PAGE.
Outer membrane proteins (OMPs) were isolated as described by LeVier and Guerinot (25). Twenty-five micrograms of protein per lane was run on 8.6% polyacrylamide sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels for separation of OMPs. Fifteen percent polyacrylamide SDS-PAGE gels were used to separate total bacterial proteins for Fur Western blots. Total bacterial protein was isolated from mid-log-phase cultures, and 1 ml of culture was pelleted and resuspended in 1x sample buffer and boiled for 5 min. All gels were run with the following running buffer: 3.03 g of Tris, 14.26 g of glycine, and 1 g of SDS per liter (pH 8.3), at 200 V with prestained protein molecular weight standards (Bio-Rad or GIBCO-BRL). After electrophoresis, gels were stained with Coomassie blue, destained, photographed, and stored between sheets of cellophane (Ann Arbor Plastics, Inc., Ann Arbor, Mich.). Protein concentrations were determined with the bicinchoninic acid assay (Pierce, Rockford, Ill.) using bovine serum albumin as a standard.
Immunoblotting.
Electrophoretic transfer of proteins to polyvinylidene difluoride membrane (0.45-µm pore size; Gelman Sciences, Ann Arbor, Mich.) was performed according to the manufacturer's instructions. The transfer was performed at constant voltage (20 V) for 25 min, using a semidry electroblotting device (Bio-Rad, Hercules, Calif.). After completion of the transfer, the blots were blocked in phosphate-buffered saline-Tween (PBST) with 5% nonfat dry milk, incubated overnight at 4°C with rabbit immunoglobulin G polyclonal antibodies directed against the E. coli Fur protein, and processed for detection with horseradish peroxidase-conjugated goat antirabbit secondary antibodies from the NEN chemiluminescence kit (NEN, Boston, Mass.).
Elemental analysis.
Wild-type B. japonicum 61A152 and the Mnr mutant strain were grown in YEM medium and then diluted 1:100 into iron-free minimal medium. After 1 cycle of growth, the cells were again diluted 1:100 into either iron-free minimal medium or minimal medium supplemented with iron. Cells were pelleted, and the protein concentration was determined. Three hundred micrograms of cellular protein was dried and then digested in HNO3, and elemental analysis by inductively coupled plasma spectrometry (ICP) was performed with an inductively coupled plasma atomic emission spectroscope (Vista; Varian). The analysis was performed at The Scripps Research Institute. Yttrium was used as an internal standard.
H2O2 sensitivity assays.
Bacteria were grown to mid-log phase in AG medium. Cells (100 µl) were spread plated onto AG plates, AG plates supplemented with 40 mM MnCl2, or AG plates supplemented with 50 µg of tetracycline per ml for the transconjugants. Sterile 0.5-in. filters (no. 740-E; Schleicher & Schuell) were impregnated with 10 µl of 3% H2O2 and placed in the center of the plates, and zones of inhibition were recorded after 4 days of growth at 30°C.
Plant assays.
Glycine max soybeans (yellow butterbeans; Johnny's Selected Seeds, Albion, Maine), mung bean (Vermont Bean Seed Co., Fair Haven, Vt.), and cowpea (Pea Brown Crowder Miss Silver; Vermont Bean Seed Co.) seeds were inoculated with B. japonicum strain 61A152, the Mnr mutant, strain I110, or GEM4 as described by Guerinot and Chlem (11). Soybeans, cowpea, and mung bean plants were grown in modified Leonard jars with N-free medium. Soybeans were placed in a greenhouse with supplemental lighting. Cowpea and mung bean were grown in growth chambers at a temperature range of 25 to 28°C. Soybean plants were harvested 4, 5, 6, 7, and 8 weeks after germination. Mung bean and cowpea plants were harvested 5, 6, and 7 weeks postgermination. At each time point, the shoots and roots were separated, and the fresh weight of the shoots was determined. Acetylene reduction assays were conducted as described by Guerinot and Chelm (11). Chlorophyll extraction assays were performed with fresh leaf tissue. The protocol was adapted from Liscum et al. (26). Briefly, 0.1 g of fresh leaf tissue was collected, ethanol was added, and the tissue was ground, vortexed, and centrifuged. This extraction was repeated, the isolated supernatants were combined with ethanol and acetone, and the A664 and A647 were measured. Total chlorophyll was determined as described by Grann and Ort (10).
Nucleotide sequence accession number.
The nucleotide sequence of the B. japonicum 61A152 fur gene has been deposited in GenBank under accession no. AY357585.
 |
RESULTS AND DISCUSSION
|
|---|
Isolation of the fur mutant.
An Mnr strain of B. japonicum strain 61A152 was isolated on AG medium supplemented with 40 mM MnCl2. (Wild-type B. japonicum is unable to grow on 20 mM MnCl2.) In order to verify that this strain of B. japonicum contained a mutation in the fur gene, it was necessary to clone and sequence both the wild-type fur gene and the fur gene from the Mnr strain. We cloned the fur gene of B. japonicum strain 61A152 by degenerate PCR. The fur DNA fragment was then used as a probe to screen a lambda Zap II genomic library of B. japonicum 61A152. The mutant fur gene was isolated by creating a subgenomic library of the Mnr mutant and using the wild-type fur gene as a probe.
Figure 1 shows the amino acid alignment of the wild-type fur protein from B. japonicum 61A152 and the proteins from the manganese-resistant fur mutant and B. japonicum I110. There are 18 amino acid changes in the mutant fur protein relative to wild type; of these, 9 are conserved substitutions. Single point mutations and small insertions have been reported for other manganese-resistant fur mutants. Funahashi et al. (8) isolated Mnr fur mutants in Vibrio parahaemolyticus and identified four different point mutations that caused amino acid changes and altered protein function. Lam et al. (24) described point mutations and a small insertion in the Mnr fur gene of V. cholerae; the mutants contain a single point mutation in either of the conserved regions, the iron-binding domain or the helix-turn-helix domain, resulting in a nonfunctional Fur protein. Our mutant fur allele has many amino acid changes, yet the putative iron-binding domain and the helix-turn-helix domains are intact. The majority of the mutations are clustered at the N- and C-terminal regions of the protein. Due to the number and variety of mutations in the B. japonicum fur gene carried by the Mnr mutant, the rrn and sdh genes from the mutant were PCR amplified and sequenced to determine if other genes were also mutated in this strain. The rrn and sdh gene sequences were identical to wild-type sequences, suggesting that it is unlikely that we have isolated a mutator strain.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1. Amino acid alignment of Fur proteins from B. japonicum USDA I110, 61A152, and the Mnr 61A152 fur mutant. Amino acids that are different in the three strains are highlighted. Asterisks denote amino acid differences between the fur mutant and the two wild-type strains. The proposed iron-binding domain is underlined.
|
|
Characterization of a dominant-negative allele of fur from B. japonicum 61A152.
In order to begin characterization of the fur mutant, a wild-type clone of the fur gene was moved into the fur mutant by triparental mating. We anticipated that the plasmid-borne fur gene would complement the mutant and restore sensitivity to manganese. However, the resulting colonies were manganese resistant, indicating that the mutation may be dominant negative. To determine if the mutation was indeed dominant negative, the reciprocal experiment was performed. We introduced a copy of the mutant fur gene into the wild-type B. japonicum 61A152 strain and scored for manganese resistance. The resulting transconjugants were manganese resistant, suggesting that the mutant allele of the fur gene is dominant negative. In order to show that the mutated plasmid copy of the fur gene had not undergone further changes, the plasmid was prepared from B. japonicum 61A152 and used to transform E. coli DH5
cells. The plasmid copy of the fur gene was then sequenced. There were no additional mutations or reversions in the plasmid copy of the mutant fur gene (data not shown).
The fact that the fur allele from the mutant is dominant over the wild-type allele suggests that the Fur protein must be expressed. In order to demonstrate this, we performed a Western blot with anti-E. coli Fur serum. Total cellular protein was extracted from B. japonicum 61A152, the MLG100 fur mutant, and wild-type 61A152 carrying the Mnr fur gene on a plasmid, as well as protein from the wild type and a fur deletion mutant in E. coli as positive and negative controls. As expected, Fur is expressed in the wild-type E. coli and is absent in the deletion strain. Fur is also expressed in the Mnr fur mutant (data not shown).
Deregulation of the iron-regulated OMPs.
Having verified that the Mnr mutant did indeed carry a mutant version of the fur gene, we went on to examine some of the phenotypes normally associated with fur mutants. Wild-type B. japonicum and MLG100 were grown under iron-deficient and iron-sufficient conditions, and OMPs were isolated. The wild-type strain expresses certain OMPs only under iron-deficient growth conditions (Fig. 2). In MLG100, however, the OMPs are expressed under iron-sufficient and iron-deficient growth conditions, suggesting that the mutation in fur is causing the deregulation of the OMPs. Under iron-sufficient conditions, the wild-type strain of B. japonicum carrying the plasmid-borne Mnr fur allele also shows deregulation of the OMPs. One of the iron-regulated OMPs in B. japonicum 61A152 is a putative heme receptor with 60% similarity to hmuR (Fig. 2, 61A3). In the manganese-resistant fur mutant, the putative heme receptor, like the other iron-regulated OMPs, is deregulated, suggesting that fur is regulating expression of this gene. Nienaber et al. (30) had previously reported that expression of hmuR, the gene encoding the outer membrane receptor for heme, was not deregulated in a fur-null mutant. However, their results are based on an hmuR-lacZ fusion; protein levels were not examined. Wexler et al. (43) reported that both a tonB-lacZ fusion and an hmuS-lacZ fusion are iron regulated, but that these genes are not regulated by fur in R. leguminosarum. Instead, these genes are thought to be regulated by RirA. Interestingly, there is no RirA homolg in B. japonicum.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 2. Iron-regulated OMPs prepared from B. japonicum 61A152. Coomassie-stained 8.6% polyacrylamde SDS-PAGE gel of OMPs prepped from cells grown under iron-deficient and iron-sufficient conditions. The three OMPs that are overexpressed under iron-deficient conditions are labeled 61A1 (unknown), 61A2 (FegA, ferrichrome receptor), and 61A3 (putative heme receptor, homolog of hmuR). The wild-type strain is 61A152, the fur mutant is MLG100, and the pmrfur wild type is 61A152, with the Mnr fur gene in trans. M (marker) is the protein molecular mass standard, and the sizes (in kilodaltons) are indicated to the right.
|
|
Oxidative stress.
E. coli and P. aeruginosa fur mutants have been shown to be more sensitive to oxidative stress, presumably due to an increase in intracellular iron (18, 31). In order to test sensitivity to oxidative stress, cultures of wild-type and mutant B. japonicum strains were grown and spread plated, and filters with either sterile, distilled water or 3% H2O2 were added to the plates. Zones of inhibition were measured after 4 days. The results of four independent experiments showed that MLG100 (37 ± 1 mm) and 61A152 with pmrfur in trans (39 ± 0.8 mm) are significantly less sensitive to H2O2 than wild-type bacteria (51 ± 2 mm) (P < 0.05). There is no statistical difference between the zones of inhibition seen with the transconjugant and the MLG100 fur mutant.
Nunoshiba et al. (31) suggest that the increased sensitivity to oxidative stress found in an E. coli fur mutant is due to a 2.5-fold increase in the amount of intracellular iron. This excess iron is thought to participate in Fenton chemistry, catalyzing the formation of damaging hydroxyl radicals in the presence of hydrogen peroxide. However, there have been conflicting reports about the levels of iron in fur mutants in E. coli. Abdul-Tehrani et al. (1) described an E. coli fur mutant that has 2.5-fold less iron than the wild-type parental strain. The discrepancies may be due to the form of iron measured in different experiments (40). We wondered if the intracellular levels of iron were increased in the Mnr fur mutant because the siderophore receptors are not repressed under iron-sufficient conditions. However, the mutant is resistant to oxidative stress, suggesting that the intracellular iron levels may be lower than those in the wild type. We examined the intracellular levels of iron in the wild-type, fur mutant, and transconjugant strains by ICP analysis. ICP analysis showed that the MLG100 fur mutant (1.8-fold increase) and 61A152 with pmrfur in trans (1.2-fold increase) had modest increases in iron content compared to the wild-type strain. Interestingly, the manganese-resistant fur mutant and 61A152 with pmrfur in trans each contain more manganese than the wild-type strain. Recent studies have suggested that manganese accumulation may play a role in peroxide and superoxide defense in bacteria (20). Perhaps the accumulation of manganese renders these strains more resistant to oxidative stress.
Symbiotic phenotype of the fur mutant.
Perhaps the most dramatic phenotype of the dominant-negative fur mutant is the symbiotic defect. The Mnr fur mutant is not able to form an effective symbiosis with soybean, cowpea, or mung bean plants. Cowpea and mung bean plants did not develop nodules when the plants were inoculated with MLG100. However, plants inoculated with the wild-type bacteria developed functional, effective nodules by week 4 (data not shown). Soybean plants inoculated with MLG100 showed two different phenotypes. Some of the plants developed small, white, ineffective nodules on the lower lateral roots, while other soybean plants did not develop nodules. Six weeks postgermination, the nodules were immature or absent, and there was no nitrogen fixation, as determined by the acetylene reduction assay. Plants inoculated with MLG100 contained less chlorophyll, had fewer nodules, and had a smaller nodule biomass than plants inoculated with wild-type bacteria (Fig. 3). Results with the dominant-negative, manganese-resistant fur mutant are in stark contrast to those with the B. japonicum fur-null strain GEM4. GEM4 did not show any significant differences from the wild-type strain, I110, in terms of numbers of nodules, nodule weight, shoot weight, or nitrogen fixation when these strains were inoculated on soybeans (data not shown). The fur-null strain is able to form an effective symbiosis despite the fact that the Fur protein is not expressed. These data suggest that the mutant Fur protein is either negatively or positively affecting a gene or genes necessary in the symbiosis.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3. Soybean plants inoculated with 61A152 or the 61A152 fur mutant or mock inoculated without bacteria. Plants were harvested six weeks post germination and assayed for the total nodule weight per soybean plant (A), the total number of nodules per plant (B), and the total chlorophyll extracted from soybean leaves (C). The standard error is shown.
|
|
We wondered if strain variations between 61A152 and I110 might explain some of the differences in the fur phenotypes. In order to address this concern, we expressed the manganese resistant fur allele from strain MLG100 in trans in the I110 wild-type strain. The resulting transconjugant strain was able to grow on higher levels of manganese than wild type (50 mM versus 20 mM for wild type). These data suggest that the Mnr fur mutation behaves as a dominant-negative mutation in strain I110 as well as in 61A152. Interestingly, GEM4 is able to grow at 20 mM manganese, but it does not grow at higher levels of manganese. We also tested the I110 fur-null mutant GEM4 and GEM4 with the 61A152 fur gene in trans by using a swarm plate assay. A Bacillus subtilis fur mutant was reported to have an altered swarm phenotype on low-agar plates (John Helmann, personal communication). We wondered if GEM4 and the Mnr fur mutant MLG100 also showed altered motility phenotypes relative to the wild type on low-agar plates. Both strains have very small swarms (GEM4, 6.1 ± 0.6 mm; and MLG100, 4.9 ± 0.2 mm). Complementing GEM4 with the wild-type 61A152 fur gene in trans resulted in a strain with a wild-type swarm phenotype (20 ± 2.1 mm compared with 18.1 ± 0.2 mm for 61A152 and 15.3 ± 0.6 for I110). These results suggest that the 61A152 fur gene can complement a fur mutation in strain USDA I110.
In E. coli, more than 90 genes have been found to be regulated by Fur and iron (16). Fur has also been shown to indirectly regulate iron uptake by regulating other regulators, such as AraC-like regulators, two-component signal transduction regulators, and extracytoplasmic function sigma factors (16). Fur has also been shown to repress transcription of a small regulatory RNA that in turn inhibits expression of several genes, including sodB, the transcription of which initially appeared to be activated by Fur (28). In B. japonicum, Fur has been shown to regulate irr, an iron regulator that is involved in regulating the heme biosynthesis pathway (15). Interestingly, R. leguminosarum, the pea microsymbiont, has a fur gene, a homolog of irr, and a third iron regulator, rirA (5, 38). The RirA protein, not Fur, appears to be the major iron regulator in R. leguminosarum (42). The transcription of iron-responsive genes, such as those involved in the synthesis and uptake of the siderophore vicibactin and in heme uptake, is unaffected in R. leguminosarum fur mutants. However, these iron-responsive genes are deregulated in a rirA mutant, suggesting that RirA is the primary iron regulator in R. leguminosarum (38). Thus, there appear to be significant differences in regulation of iron-responsive genes between B. japonicum and R. leguminosarum. There is no obvious homolog of rirA in the B. japonicum genome. There is a homolog of the fur-like gene zur, which has been shown to be a zinc regulator in a number of bacterial species, including E. coli (32) and B. subtilis (9).
It is clear from our results that the absence of the Fur protein has a very different effect on downstream targets than does a dominant-negative mutant Fur protein. We do not, however, know all of the gene targets of the Fur protein or how the mutant protein may affect these targets. The B. japonicum Fur protein has been shown to regulate the hemA gene (13). There are likely to be many other as yet unidentified targets for the Fur protein. Now that the B. japonicum genome has been sequenced, it will soon be possible to carry out DNA microarray experiments to determine which genes are regulated by Fur or misregulated in each of the fur mutants (21, 22). Several recent studies have used a similar approach to define the fur regulon in a number of bacterial species, including E. coli, B. subtilis, and Shewanella oneidensis (3, 29, 37).
 |
ACKNOWLEDGMENTS
|
|---|
We would like to thank Justin Genant for help in screening for manganese-resistant mutants, Eric Bonconpagni for PCR amplification of a portion of the fur gene from 61A152, David Westenberg for providing primers specific for the rrn and sdh genes of B. japonicum, Mark O'Brian for providing the fur-null strain GEM4, and Michael Vasil for providing antibodies raised against the E. coli Fur protein. David Eide, Suzanne Clark, and Jeff Harper carried out the ICP analysis.
This work was supported by USDA grant 99-03686 to M.L.G. H.B. was supported in part by Host-Microbe training grant T32AI07519.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Department of Biological Sciences, 6044 Gilman, Dartmouth College, Hanover, NH 03755. Phone: (603) 646-2527. Fax: (603) 646-1347. E-mail: guerinot{at}dartmouth.edu. 
 |
REFERENCES
|
|---|
- Abdul-Tehrani, H., A. J. Hudson, Y.-S. Chang, A. R. Timms, C. Hawkins, J. M. Williams, P. M. Harrison, J. R. Guest, and S. C. Andrews. 1999. Ferritin mutants of Escherichia coli are iron deficient and growth impaired, and fur mutants are iron deficient. J. Bacteriol. 181:1415-1428.[Abstract/Free Full Text]
- Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 2003. Current protocols in molecular biology. Greene Publishing Associates and John Wiley & Sons, Inc., New York.
- Baichoo, N., T. Wang, R. Ye, and J. Helmann. 2002. Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Mol. Microbiol. 45:1613-1629.[CrossRef][Medline]
- Berish, S. A., S. Subbarao, C.-Y. Chen, D. L. Trees, and S. A. Morse. 1993. Identification and cloning of a fur homolog from Neisseria gonorrhoeae. Infect. Immun. 61:4599-4606.[Abstract/Free Full Text]
- De Luca, N. G., and A. W. B. Johnston. 1998. Is the fur gene of Rhizobium leguminosarum essential? FEMS Microbiol. Lett. 168:289-295.[Medline]
- Faraldo-Gomez, J., and M. Sansom. 2003. Acquisition of siderophores in gram-negative bacteria. Nat. Rev. 4:105-116.
- Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652.[Abstract/Free Full Text]
- Funahashi, T., C. Fujiwara, M. Okada, S. Miyoshi, S. Shinoda, S. Narimatsu, and S. Yamamoto. 2000. Characterization of Vibrio parahaemolyticus manganese-resistant mutants in reference to the function of the ferric uptake regulatory protein. Microbiol. Immunol. 44:963-970.[Medline]
- Gaballa, A., and J. D. Helmann. 1998. Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis. J. Bacteriol. 180:5815-5821.[Abstract/Free Full Text]
- Grann, T., and D. R. Ort. 1984. Quantitation of the rapid electron donors to P700, the functional plastoquinone pool, and the ratio of the photosystems in spinach chloroplasts. J. Biol. Chem. 259:14003-14010.[Abstract/Free Full Text]
- Guerinot, M. L., and B. K. Chelm. 1986. Bacterial aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis. Proc. Natl. Acad. Sci. USA 83:1837-1841.[Abstract/Free Full Text]
- Guerinot, M. L., E. J. Meidl, and O. Plessner. 1990. Citrate as a siderophore in Bradyrhizobium japonicum. J. Bacteriol. 172:3298-3303.[Abstract/Free Full Text]
- Hamza, I., S. Chauhan, R. Hassett, and M. R. O'Brian. 1998. The bacterial Irr protein is required for coordination of heme biosynthesis with iron availability. J. Biol. Chem. 273:21669-21674.[Abstract/Free Full Text]
- Hamza, I., R. Hassett, and M. R. O'Brian. 1999. Identification of a functional fur gene in Bradyrhizobium japonicum. J. Bacteriol. 181:5843-5846.[Abstract/Free Full Text]
- Hamza, I., Z. Qi, N. D. King, and M. R. O'Brian. 2000. Fur-independent regulation of iron metabolism by Irr in Bradyrhizobium japonicum. Microbiology 146:669-676.[Abstract/Free Full Text]
- Hantke, K. 2001. Iron and metal regulation in bacteria. Curr. Opin. Microbiol. 4:172-177.[CrossRef][Medline]
- Hantke, K. 1987. Selection procedure for deregulated iron transport mutants (fur) in Escherichia coli K12: fur not only affects iron metabolism. Mol. Gen. Genet. 210:135-139.[CrossRef][Medline]
- Hassett, D. J., P. A. Sokol, M. L. Howell, J.-F. Ma, H. T. Schweizer, U. Oschner, and M. L. Vasil. 1996. Ferric uptake regulator (Fur) mutants of Pseudomonas aeruginosa demonstrate defective siderophore-mediated iron uptake, altered aerobic growth and decreased superoxide dismutase and catalase activities. J. Bacteriol. 178:3996-4003.[Abstract/Free Full Text]
- Holmes, R. P., and R. R. B. Russell. 1972. Mutations affecting amino sugar metabolism in Escherichia coli K-12. J. Bacteriol. 111:290-291.[Abstract/Free Full Text]
- Horsburgh, M., S. Wharton, M. Karavolos, and S. Foster. 2002. Manganese: elemental defence for a life with oxygen? Trends Microbiol. 10:496-501.[CrossRef][Medline]
- Kaneko, T., Y. Nakamura, S. Sato, K. Minamisawa, T. Uchiumi, S. Sasamoto, A. Watanabe, K. Idesawa, M. Iriguchi, K. Kawashima, M. Kohara, M. Matsumoto, S. Shimpo, H. Tsuruoka, T. Wada, M. Yamada, and S. Tabata. 2002. Complete genomic sequence of nitrogen-fixing symbiotic bacterium Bradyrhizobium japonicum USDA110. DNA Res. 9:189-197.[Abstract]
- Kaneko, T., Y. Nakamura, S. Sato, K. Minamisawa, T. Uchiumi, S. Sasamoto, A. Watanabe, K. Idesawa, M. Iriguchi, K. Kawashima, M. Kohara, M. Matsumoto, S. Shimpo, H. Tsuruoka, T. Wada, M. Yamada, and S. Tabata. 2002. Complete genomic sequence of nitrogen-fixing symbiotic bacterium Bradyrhizobium japonicum USDA110. DNA Res. 9(Suppl.):225-256.[CrossRef][Medline]
- Kuykendall, L. D., and G. H. Elkan. 1976. Rhizobium japonicum derivatives differing in nitrogen-fixing efficiency and carbohydrate utilization. Appl. Environ. Microbiol. 32:511-519.[Abstract/Free Full Text]
- Lam, M. S., C. M. Litwin, P. A. Carroll, and S. B. Calderwood. 1994. Vibrio cholerae fur mutations associated with loss of repressor activity: implications for the structural-functional relationships of Fur. J. Bacteriol. 176:5108-5115.[Abstract/Free Full Text]
- LeVier, K., and M. L. Guerinot. 1996. The Bradyrhizobium japonicum fegA gene encodes an iron-regulated outer membrane protein with similarity to hydroxamate-type siderophore receptors. J. Bacteriol. 178:7265-7275.[Abstract/Free Full Text]
- Liscum, E., and R. P. Hangarter. 1991. Arabidopsis mutants lacking blue light-dependent inhibition of hypocotyl elongation. Plant Cell 3:685-694.[Abstract/Free Full Text]
- Loprasert, S., R. Sallabhan, W. Whangsuk, and S. Mongkolsuk. 2000. Characterization and mutagenesis of fur gene from Burkholderia pseudomallei. Gene 254:129-137.[CrossRef][Medline]
- Masse, E., and S. Gottesman. 2002. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 99:4620-4625.[Abstract/Free Full Text]
- McHugh, J., F. Rodriguez-Quinones, H. Abdul-Tehrani, D. Svistunenko, R. Poole, C. Cooper, and S. Andrews. 2003. Global iron-dependent gene regulation in Escherichia coli. J. Biol. Chem. 278:29478-29486.[Abstract/Free Full Text]
- Nienaber, A., H. Hennecke, and H. M. Fischer. 2001. Discovery of a haem uptake system in the soil bacterium Bradyrhizobium japonicum. Mol. Microbiol. 41:787-800.[CrossRef][Medline]
- Nunoshiba, T., F. Obata, A. Boss, S. Oikawa, T. Mori, S. Kawanishi, and K. Yamamoto. 1999. Role of iron and superoxide for generation of hydroxyl radical oxidative DNA lesions, and mutagenesis in Escherichia coli. J. Biol. Chem. 274:34832-34837.[Abstract/Free Full Text]
- Patzer, S., and K. Hantke. 2000. The zinc-responsive regulator Zur and its control of the znu gene cluster encoding the ZnuABC zinc uptake system in Escherichia coli. J. Biol. Chem. 275:24321-24332.[Abstract/Free Full Text]
- Prince, R. W., C. D. Cox, and M. L. Vasil. 1993. Coordinate regulation of siderophore and exotoxin A production: molecular cloning and sequencing of the Pseudomonas aeruginosa fur gene. J. Bacteriol. 175:2589-2598.[Abstract/Free Full Text]
- Sadowsky, M. J., R. E. Tully, P. B. Cregan, and H. H. Keyser. 1987. Genetic diversity in Bradyrhizobium japonicum serogroup 123 and its relation to genotype-specific nodulation of soybean. Appl. Environ. Microbiol. 53:2624-2630.[Abstract/Free Full Text]
- Silver, S., P. Johnseine, E. Whitney, and D. Clark. 1972. Manganese-resistant mutants of Escherichia coli: physiological and genetic studies. J. Bacteriol. 110:186-195.[Abstract/Free Full Text]
- Staskawicz, B., D. Dahlbeck, N. Keen, and C. Napoli. 1987. Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J. Bacteriol. 169:5789-5794.[Abstract/Free Full Text]
- Thompson, D. K., A. Beliaev, C. Giometti, S. Tollaksen, T. Khare, D. P. Lies, K. H. Nealson, H. Lim, J. Yates III, C. C. Brandt, J. M. Tiedje, and J. Zhou. 2002. Transcriptional and proteomic analysis of a ferric uptake regulator (fur) mutant of Shewanella oneidensis: possible involvement of Fur in energy metabolism, transcriptional regulation, and oxidative stress. Appl. Environ. Microbiol. 68:881-892.[Abstract/Free Full Text]
- Todd, J. D., M. Wexler, G. Sawers, K. Yeoman, P. Poole, and A. Johnston. 2002. RirA, an iron-responsive regulator in the symbiotic bacterium Rhizobium leguminosarum. Microbiology 148:4059-4071.[Abstract/Free Full Text]
- Tolmasky, M. E., A. M. Wertheimer, L. A. Actis, and J. H. Crosa. 1994. Characterization of the Vibrio anguillarum fur gene: role in regulation of expression of the FatA outer membrane protein and catechols. J. Bacteriol. 176:213-220.[Abstract/Free Full Text]
- Touati, D. 2000. Iron and oxidative stress in bacteria. Arch. Biochem. Biophys. 373:1-6.[CrossRef][Medline]
- Vincent, J. M. 1970. A manual for the practical study of root nodule bacteria, vol. 15. Blackwell Scientific Publications, Oxford, United Kingdom.
- Wexler, M., J. D. Todd, O. Kolade, D. Bellini, A. Hemmings, G. Sawers, and A. Johnston. 2003. Fur is not the global regulator of iron uptake genes in Rhizobium leguminosarum. Microbiology 149:1357-1365.[Abstract/Free Full Text]
- Wexler, M., K. Yeoman, J. Stevens, N. de Luca, G. Sawers, and A. Johnston. 2001. The Rhizobium leguminosarum tonB gene is required for the uptake of siderophore and haem as sources of iron. Mol. Microbiol. 41:801-816.[CrossRef][Medline]
Journal of Bacteriology, March 2004, p. 1409-1414, Vol. 186, No. 5
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.5.1409-1414.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Haraszthy, V. I., Jordan, S. F., Zambon, J. J.
(2006). Identification of Fur-regulated genes in Actinobacillus actinomycetemcomitans.. Microbiology
152: 787-796
[Abstract]
[Full Text]
-
Gao, T., O'Brian, M. R.
(2005). Iron-Dependent Cytochrome c1 Expression Is Mediated by the Status of Heme in Bradyrhizobium japonicum. J. Bacteriol.
187: 5084-5089
[Abstract]
[Full Text]