Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) A retraction has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kossykh, V. G. Articles by Lloyd, R. S. Search for Related Content PubMed PubMed Citation Articles by Kossykh, V. G. Articles by Lloyd, R. S.

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2004, p. 2061-2067, Vol. 186, No. 7
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.7.2061-2067.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

A DNA Adenine Methyltransferase of Escherichia coli That Is Cell Cycle Regulated and Essential for Viability

Valeri G. Kossykh^* and R. Stephen Lloyd

Sealy Center for Molecular Science and Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch at Galveston, Galveston, Texas 77555-1071

Received 9 June 2003/ Accepted 17 December 2003

Top Abstract Introduction Materials and Methods Results Discussion References

 
DNA sequence analysis revealed that the putative yhdJ DNA methyltransferase gene of Escherichia coli is 55% identical to the Nostoc sp. strain PCC7120 gene encoding DNA methyltransferase AvaIII, which methylates adenine in the recognition sequence, ATGCAT. The yhdJ gene was cloned, and the enzyme was overexpressed and purified. Methylation and restriction analysis showed that the DNA methyltransferase methylates the first adenine in the sequence ATGCAT. This DNA methylation was found to be regulated during the cell cycle, and the DNA adenine methyltransferase was designated M.EcoKCcrM (for "cell cycle-regulated methyltransferase"). The CcrM DNA adenine methyltransferase is required for viability in E. coli, as a strain lacking a functional genomic copy of ccrM can be isolated only in the presence of an additional copy of ccrM supplied in trans. The cells of such a knockout strain stopped growing when expression of the inducible plasmid ccrM gene was shut off. Overexpression of M.EcoKCcrM slowed bacterial growth, and the ATGCAT sites became fully methylated throughout the cell cycle; a high proportion of cells with an anomalous size distribution and DNA content was found in this population. Thus, the temporal control of this methyltransferase may contribute to accurate cell cycle control of cell division and cellular morphology. Homologs of M.EcoKCcrM are present in other bacteria belonging to the gamma subdivision of the class Proteobacteria, suggesting that methylation at ATGCAT sites may have similar functions in other members of this group.

Top Abstract Introduction Materials and Methods Results Discussion References

 
DNA methylation plays an important role in the expression of genetic information. Methylation of DNA is carried out by DNA methyltransferases (MTases), which are widespread in prokaryotes and eukaryotes (8, 2). In eukaryotes, this process is essential for controlling transcription, genomic imprinting, developmental regulation, mutagenesis, DNA repair, and chromatin organization (4). In prokaryotes, methylation is primarily found in the context of restriction-modification systems, where it allows an organism to distinguish foreign DNA from its own DNA (3). DNA methylation also regulates chromosome replication, transcription, repair, and most likely other fundamental processes (17). The two best-studied orphan DNA MTases (DNA MTases without apparent cognate restriction enzymes) are the Escherichia coli Dam and Caulobacter crescentus CcrM enzymes (14).

Dam DNA MTase regulates several cell functions, including chromosome replication (7, 6), the direction of strand-specific mismatch repair (1), and the transcription of certain genes (12). A good example of methylation-influenced transcription is transcription of the pyelonephritis-associated pilus, or pap, operon in uropathogenic E. coli (5). Methylation also regulates phase variation of two other surface proteins: the plasmid-encoded fimbriae of the enteric bacterium Salmonella enterica serovar Typhimurium, which mediate adhesion to mouse intestinal epithelium, and the nonfimbrial E. coli outer membrane protein Ag43 (11, 19).

CcrM (for "cell cycle-regulated MTase") is an essential DNA MTase of the dimorphic aquatic bacterium C. crescentus and is the next-best-characterized orphan MTase after Dam (25). The properties of the CcrM DNA MTase and emerging evidence suggest that differential DNA methylation controls multiple aspects of the cell cycle in C. crescentus, Rhizobium meliloti, Brucella abortus, Agrobacterium tumefaciens, and other members of the alpha subdivision of the class Proteobacteria (23).

Both CcrM and Dam catalyze the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the N⁶ position of adenine in a specific target sequence. However, these enzymes belong to separate MTase groups, since their catalytic and AdoMet-binding domains are organized in different linear orders (16). Their target sequences also differ (GATC for Dam and GANTC for CcrM). While CcrM is widely distributed in the alpha subdivision of the class Proteobacteria (23), Dam is found primarily in the enteric bacteria and other members of the gamma subdivision of the Proteobacteria (14).

DNA MTases are reasonable antimicrobial drug targets. Dam methylation has been shown to influence the transcription of a growing number of genes important in the pathogenesis of bacterial diseases. Dam from E. coli and Dam from Salmonella spp. are not essential for viability, but the Dam gene is an essential gene in Vibrio cholerae and Yersinia pseudotuberculosis (13). Unlike Dam, CcrM is essential for viability in multiple bacteria (23), suggesting that inhibitors of methylation may be bactericidal in some cases.

We describe here cloning and characterization of a novel E. coli DNA adenine MTase. Characterization of the role of this MTase in bacteria having different ecological niches and growth cycles should allow a better understanding of the physiological importance of this enzyme and its potential as a target for novel antibacterial agents.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials. AdoMet was obtained from Sigma. Restriction endonucleases (REases), N⁶-adenine-free lambda DNA, and chitin beads were obtained from New England BioLabs, Beverly, Mass. Percoll and [-³²P]dCTP (6,000 Ci/mmol) were obtained from Amersham-Pharmacia, Piscataway, N.J.

Bacterial growth conditions and media. Strains and plasmids used in this study are listed in Table 1. E. coli was grown at 37°C in Luria-Bertani (LB) medium. LB medium was supplemented with glucose or arabinose when genes were expressed from the araBAD promoter and with 5% sucrose when the medium was used for sacB counterselection (see below). For solid media, 15 g of agar per liter was added. Antibiotics were used at the following concentrations: ampicillin, 50 µg/ml; spectinomycin, 30 µg/ml; streptomycin 30 µg/ml; and chloramphenicol, 20 µg/ml. Plasmids were introduced into E. coli either by transformation or by electroporation.

View this table: [in this window] [in a new window]

TABLE 1. Strains and plasmids

Enzyme purification. The E. coli gene encoding DNA adenine MTase (ccrM) was cloned into the pTYB4 vector (New England BioLabs) by PCR by using genomic DNA of E. coli WA802. To overexpress CcrM in E. coli, plasmid pTYB4 with the ccrM gene was introduced into E. coli ER2566, which allowed transcription from the vector T7 promoter. After induction with 0.5 mM isopropyl-ß-D-thiogalactoside, the cells were harvested by centrifugation, resuspended in 20 mM Tris-HCl (pH 7.5)-1 mM EDTA-500 mM NaCl with 0.1% Triton X-100, and disrupted by sonication. Cell debris was removed by centrifugation at 15,000 x g for 30 min at 4°C. The CcrM protein was isolated from the supernatant by using chitin beads (New England BioLabs) and the manufacturer's protocol; 50 mM cysteine was used to cleave CcrM fused with the chitin-binding domain. After dialysis and concentration, CcrM was used for DNA methylation.

DNA methylation and cleavage by REases. DNA methylation assays were carried out by using previously described procedures (18). The methylation mixture (50 µl) contained 20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 7 mM 2-mercaptoethanol, 1 mM EDTA, 1 µg of N⁶-adenine-free lambda DNA, CcrM MTase, and 50 µM AdoMet. After 1 h of incubation at 37°C, the reaction was stopped by heat inactivation of the MTase at 65°C for 15 min, followed by addition of 5 to 10 U of each REase. The concentrations of Tris, MgCl₂, NaCl, and bovine serum albumin were preadjusted for optimum cleavage conditions, and the reaction mixture was incubated for an additional 1 h at the temperature recommended by the enzyme supplier.

Comparative reverse transcription (RT)-PCR. E. coli WA802 synchronized cells were grown in LB medium at 37°C to an A₆₀₀ of 0.5, and samples were removed at 5-min intervals. Total RNA was isolated from the samples by using a RiboPure-Bacteria kit (Ambion) and was subjected to DNase treatment with a Turbo DNA-free kit (Ambion). For ccrM cDNA synthesis, total RNA (2 µg), an upstream primer (5'GTGACCATGAGAACAGGATGTGAAC), and a downstream primer (3'CTTTGTAATGAGATCGGGGTCAACT) were used with an mRNA selective PCR kit (version 1.1; Takara Bio Inc.). All procedures were performed as recommended by the supplier. Quantification of PCR was tested at various cycles (10, 20, 30, and 40 cycles). For 20 cycles, 10 µl of PCR product was applied to a 1% agarose gel. After electrophoresis the gel was stained with ethidium bromide, and the density of the bands was quantified by using a FluorChem 8900 imaging system (Alpha Innotech Corp.).

Construction of the E. coli ccrM null mutant. To determine whether ccrM is essential in E. coli, we used the suicide vector pRE112 bearing a chloramphenicol resistance marker (Cam^r), as well as the sacB gene of Bacillus subtilis (9). The levansucrase encoded by sacB produces a toxic metabolite when cells are grown on sucrose (5%), allowing counterselection against the presence of the plasmid. The plasmid used in these experiments was constructed in two steps. First, a fragment encoding the ccrM gene was obtained by PCR amplification and cloned between the XbaI and XmaI sites of pRE112. Next, the BamHI fragment from the pHP45 plasmid (21), which contained the spectinomycin-streptomycin (Spc^r Str^r) resistance cassette, was cloned into a BglII site 180 bp downstream of the N terminus of ccrM in the construct pRE112-ccrM. The resulting plasmid, pRE112-ccrMSpm^rStr^r, was used to obtain null mutants.

Conditional expression of ccrM. To allow regulation of CcrM expression, the promoterless ccrM gene was placed downstream of the araBAD promoter, replacing an NcoI-PmeI fragment in the pBAD/ThioE vector (Invitrogen) and generating plasmid pBAD-ccrM. When this plasmid was introduced into WA802 and induced with arabinose, a protein of the appropriate size (33 kDa) was observed on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel. The araBAD promoter is maximally repressed by growth on 0.2% glucose in the absence of arabinose (10). To obtain a strain lacking chromosomal ccrM with regulatable expression of CcrM from plasmid pBAD-ccrM, plasmid pRE112-ccrMSpm^rStr^r was introduced into E. coli WA802/pBAD-ccrM with selection for spectinomycin-streptomycin resistance. Recombinants that were sucrose and spectinomycin-streptomycin resistant and chloramphenicol sensitive and that had the inactivated wild-type ccrM chromosomal locus were isolated as described above. Arabinose was added at a final concentration of 0.001% to all plates during isolation of this strain to induce expression of CcrM from pBAD-ccrM.

Percoll gradient centrifugation of E. coli cultures. Fractions of synchronously dividing cells of E. coli were obtained with a Percoll density gradient (20) by using a procedure described by Makinoshima et al. (15). E. coli strains were grown in LB medium at 37°C with shaking until the A₆₀₀ reached 0.6 (2 x 10⁸ to 3 x 10⁸ cells/ml). The cells were harvested by centrifugation and resuspended in appropriate volumes of phosphate-buffered saline (PBS). A 0.5-ml cell suspension (1 x 10⁹ cells) was layered on top of 9.5 ml of the preformed Percoll gradient, which was prepared by centrifugation of a mixture containing 8 ml of Percoll and 1.5 ml of PBS for 1 h at 20,000 rpm and 4°C with a Beckman SW41Ti rotor. After centrifugation for 45 min at 20,000 rpm and 4°C with a Beckman L8-70 M centrifuge, the Percoll gradient was fractionated by using a gradient fractionator. Aliquots (approximately 100 µl) were collected from the top to the bottom, diluted, washed two times with PBS, and used as the starting material for preparation of synchronized cultures.

Microscopy and flow cytometry. For analyses of synchronized cell cultures, E. coli cells were grown to the exponential phase (A₆₀₀, 0.5) and then treated with 0.01 volume of fixative (12.5% formaldehyde, 150 mM sodium phosphate; pH 7.5) for 15 min at room temperature. Cells were then washed twice in growth medium and stored at 4°C. For flow cytometry, cold ethanol was added to a final concentration of 70%, and cells were gently recentrifuged and resuspended in TMS buffer (10 mM Tris-HCl [pH 7.2], 1.5 mM MgCl₂, 150 mM NaCl) containing SYBR Green nucleic acid stain at a 10,000-fold dilution from a stock solution (S-7563; Molecular Probes, Eugene, Oreg.). The DNA of 20,000 cells from each sample was analyzed by using a Becton-Dickinson FACStar flow cytometer with excitation at 458 nm, and fluorescence was measured at 530 nm. Small-angle forward light scattering was used to estimate cell size. The data were collected and analyzed by using the Cell Quest software (Becton-Dickinson, San Jose, Calif.).

For microscopy, the fixed, washed cells were placed under a coverslip. Samples were photographed by using an Axiovert 200 M microscope with a x63 differential interference contrast objective and a PMT camera controlled by an image analysis system (Axiovision 2 Multichannel; Zeiss).

Southern blot analysis. Total E. coli genomic DNA was prepared by using the QIAGEN Genomic-tip system under the conditions specified by the supplier (QIAGEN Inc., Valencia, Calif.). DNA samples were digested with REases, and fragments were separated by electrophoresis in 1.5% agarose gels. For Southern blot analysis we employed Hybond+ membranes (Amersham, Piscataway, N.J.), UV light cross-linking (Stratalinker; Stratagene), and the hybridization and wash conditions described previously for blot hybridization (22). [³²P]DNA probes were labeled with [-³²P]dCTP (6,000 Ci/mmol; Amersham) by using a Rad Prime DNA labeling kit (Invitrogen, Carlsbad, Calif.).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Sequence comparison. Table 2 shows the results of a GenBank database search which showed that the amino acid sequence of an E. coli K-12 putative yhdJ MTase (accession number NP_417728) has 55% identity with the sequence of the Nostoc sp. strain PCC7120 DNA adenine MTase AvaIII, which recognizes the sequence ATGCAT (Fig. 1). The amino acid sequence is also 80 to 100% identical to putative MTases from pathogenic E. coli strain O157, Salmonella enterica serovar Typhimurium LT2, and Shigella flexneri (Table 2). The putative E. coli yhdJ DNA adenine MTase was designated M.EcoKCcrM (for "cell cycle-regulated MTase"), as it has a function similar to the function of a group of DNA adenine MTases from members of the alpha subdivision of the Proteobacteria (see below) and 50% homology to these MTases (Table 2), which are essential enzymes whose expression is controlled by conserved cell cycle dependence and a regulatory mechanism (23).

View this table: [in this window] [in a new window]

TABLE 2. Sequences with significant identity to M.EcoKCcrM

View larger version (56K): [in this window] [in a new window]

FIG. 1. Comparison of the amino acid sequences of the E. coli CcrM protein and the cyanobacterial Nostoc sp. strain PCC7120 DNA adenine MTase AvaIII.

Enzyme purification. To overexpress CcrM in E. coli, the ccrM gene was cloned into the vector pTYB4 to create pTYB4-ccrM, which allowed transcription by T7 RNA polymerase in E. coli ER2566. After induction and purification with chitin beads, the CcrM protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which resulted in a single protein band at molecular mass of ca. 33 kDa. N-terminal analysis of the protein revealed that the Met due to the start codon (GTG) was removed. Purified CcrM was used for methylation of phage lambda DNA.

Identification of the recognition sequence for CcrM. To identify a specific DNA MTase recognition site, N⁶-adenine-free phage lambda DNA was incubated with CcrM MTase and used for REase digestions (Fig. 2). For these analyses, we used REases whose cognate MTases exhibited a high degree of homology with CcrM. Methylated DNA exhibited protection from digestion with NsiI and BfrI, which are isoschizomers of AvaIII. To provide resistance to restriction by both NsiI and BfrBI, the first adenine residue was predicted to be methylated (24).

View larger version (51K): [in this window] [in a new window]

FIG. 2. Methylation by CcrM MTase alters the sensitivity of phage lambda DNA to REases BfrBI and NsiI. Methylation and the cleavage assay were performed as described in Materials and Methods. The REases used are indicated at the top. Phage lambda DNA was (+) or was not (-) methylated with CcrM MTase and incubated with REases.

DNA methylation states. To determine the methylation state of DNA during the cell cycle, total genomic DNA was isolated from samples taken from a synchronized culture of E. coli WA802 at the exponential growth phase. The results shown in Fig. 3 demonstrate that the DNA methylation state of DNA changed during the cell cycle. The methylation state of DNA was assessed by the restriction enzyme digestion assay, as shown in Fig. 3. The degree of DNA methylation varied over the course of the cell cycle at about 25-min intervals. After the completion of replication, the DNA became fully methylated. As the cells began to replicate their DNA, the amount of hemimethylated DNA increased again.

View larger version (44K): [in this window] [in a new window]

FIG. 3. Southern blot analysis of the chromosomal methylation state of the ccrM site upstream of the rspA gene of E. coli as a function of the cell cycle. (A) A 706-bp PvuII-PvuII fragment with the upstream region and N terminus of the rspA gene containing a ccrM site at position 135 was chosen for determining the methylation state of the ccrM site by cleavage with BfrBI REase. Genomic DNA isolated at 5-min intervals from a population of synchronized E. coli WA802 cells was digested with PvuII and BfrBI, and fragments were separated by electrophoresis and blotted onto Hybond paper. A radioactively labeled 571-bp BfrBI-PvuII PCR fragment was used as a probe for hybridization with genomic DNA as described in Materials and Methods. The positions of the 706-bp uncut (fully methylated) and 571-bp cut (hemimethylated) fragments are indicated on the left. (B) The Southern blot shown in panel A was scanned densitometrically, and the ratio of the intensity of the band representing cleaved DNA to the combined intensity of the bands representing both cleaved and uncleaved bands was determined.

Comparative RT-PCR of ccrM mRNA. In order to clarify the expression of CcrM during the cell cycle, we performed a comparative RT-PCR analysis of ccrM mRNA (Fig. 4). Total RNA isolated from a synchronized culture of E. coli WA802 at various times during the exponential growth phase was used for synthesizing the ccrM cDNA. A 0.9-kb band was obtained by RT-PCR, and the size of this band corresponded to the expected length of ccrM mRNA. It was clear that the amount ccrM mRNA changed cyclically during the cell cycle at 20- to 25-min intervals.

View larger version (65K): [in this window] [in a new window]

FIG. 4. Comparative RT-PCR of ccrM mRNA. E. coli WA802 synchronized cells were grown in LB medium at 37°C, and samples were removed at 5-min intervals. (A) Total RNA was isolated, and ccrM cDNA was amplified and analyzed as described in Materials and Methods. Lane M contained a molecular size standard (X174 DNA HaeIII digest). (B) Relative levels of mRNA as represented by the intensities of the bands in the gel scanned densitometrically as described in Materials and Methods. The bars and error bars indicate the means and standard deviations for three experiments, respectively.

E. coli ccrM is essential for viability. To determine if CcrM is essential for viability in E. coli, we attempted to inactivate the ccrM gene using a sacB counterselection technique (9). First, ccrM was cloned in pRE112, and then the ccrM gene was disrupted by inserting a fragment with Spm^r Str^r selectable markers, as described in Materials and Methods. The resulting plasmid, pRE112-ccrMSpm^rStr^r, was then used for transformation into E. coli. Subsequent growth of the strains on 5% sucrose selected for excision of the sacB gene and recombination between the homologous regions of ccrM on the plasmid and the E. coli ccrM chromosomal locus. Cells retaining the wild-type ccrM gene and cells with the disrupted gene were distinguished by sensitivity to chloramphenicol. It was not possible to obtain Spc^r Str^r Cam^s strains containing the disrupted chromosomal ccrM gene. To confirm that ccrM was essential, we showed that the chromosomal ccrM locus could be inactivated when a functional copy of E. coli ccrM was provided on a plasmid. To do this, the ccrM coding sequence and 142 bp of the 5' upstream region were cloned into the high-copy-number vector pUC18, and the resulting plasmid, pUC18-ccrM, was used for transformation of E. coli WA802. The resulting plasmid, pRE112-ccrMSpm^rStr^r, was introduced into strain WA802/pUC18-ccrM to obtain null mutants. As a control, we used WA802 with the vector alone. Recombinants that were sucrose and spectinomycin-streptomycin resistant and chloramphenicol sensitive and had lost the wild-type ccrM locus from the chromosome were isolated only with a strain which contained pUC18-ccrM. No transformants were obtained in the presence of the pUC18 vector alone. Thus, the chromosomal copy of ccrM could be disrupted in the presence of CcrM, which was supplied in trans from pUC18-ccrM. These data demonstrated that ccrM is required for E. coli viability under normal growth conditions.

Conditional expression of ccrM. Since a strain that completely lacked CcrM could not be isolated, we constructed a strain in which the level of CcrM could be regulated. A copy of ccrM was put under control of an arabinose-inducible araBAD promoter (10). Promoterless ccrM was cloned into plasmid pBAD/ThioE (Invitrogen) to obtain pBAD-ccrM. This plasmid was used to transform E. coli WA802. Ampicillin was used to maintain control of the complementing plasmid. Strain WA802 containing plasmid pBAD-ccrM was used for introduction of plasmid pRE112-ccrMSpm^rStr^r to isolate recombinants with a disrupted chromosomal ccrM gene. To address the question of whether selective elimination of the ccrM MTase function was sufficient to stop bacterial growth, strain WA802 with plasmid pBAD-ccrM and nonfunctional ccrM was shifted from growth in LB medium with 0.001% arabinose to growth in LB medium with 0.2% glucose (Fig. 5). When the expression of ccrM was shut off, bacterial growth stopped after 4 h, and the number of viable cells in the culture declined. There was a 10-fold difference in viability between the cultures that were grown for 4 h with arabinose and the cultures that were grown for 4 h with glucose. These data demonstrated that CcrM is necessary for viability of E. coli and that the lack of CcrM had a detrimental effect on the growth of E. coli.

View larger version (16K): [in this window] [in a new window]

FIG. 5. Conditional expression of ccrM from the araBAD promoter in ccrM null mutant cells. ccrM was induced in cells grown in LB medium with 0.001% arabinose (line 1) or was repressed in LB medium with 0.2% glucose (line 2) in the presence of a nonfunctional chromosomal ccrM gene. (A) Optical density at 600 nm (OD600). (B) CFU. Samples were platted on LB agar containing ampicillin (50 mg/ml) and arabinose (0.001%).

Overexpression of ccrM alters cell division. To test the effects of overexpression of the ccrM gene on the growth of E. coli, the WA802/pBAD-ccrM strain with a wild-type chromosomal ccrM gene was grown in the presence of 0.2% arabinose or glucose. The inducible araBAD promoter is repressed in the absence of arabinose and the presence of glucose (10). Cell growth with arabinose was slowed during overexpression of CcrM in E. coli with a wild-type chromosomal copy of ccrM. In the presence of glucose, the growth and viability of these cells did not differ from the growth and viability of the control strain with the pBAD vector alone. Genomic DNA was isolated from synchronized cultures grown in the presence of 0.2% arabinose or glucose and was analyzed by restriction digestion with the BfrBI REase to determine the methylation state of the DNA. In this assay (Fig. 6A), genomic DNA from cells grown in the presence of 0.2% glucose was not fully methylated, but genomic DNA from the cells overexpressing CcrM from the araBAD promoter was fully methylated. The cells exhibited a strikingly aberrant morphology; light microscopy showed that the majority of the cells were elongated and that they were single cells with an atypical morphology, not several attached daughter cells (Fig. 6C). The short rods were typical for the control cells (Fig. 6B). To analyze the effects of constitutive methylation on cell size and DNA content, flow cytometric analyses were performed with a fluorescence-activated cell sorter. As shown in Fig. 6D, the average size of the cells grown in the presence of 0.2% arabinose with excess CcrM was three times greater than the average size of the cells of a control strain grown in the presence of 0.2% glucose. Most of the cells with excess CcrM contained two to four genome equivalents of DNA per cell (Fig. 6F), but a control strain grown in the presence of 0.2% glucose contained predominantly one or two genome equivalents per cell (Fig. 6E). The results suggested that cell division was inhibited or delayed in the presence of excess CcrM protein. The observed aberration could be also attributed to disruption of the cellular septation process.

View larger version (45K): [in this window] [in a new window]

FIG. 6. Effects of overexpression of E. coli ccrM on DNA methylation, DNA replication, and cell morphology. E. coli WA802 with pBAD-ccrM carried the ccrM gene under control of the araBAD promoter. Synchronized cells were grown in LB medium to an A600 of 0.5 with 0.2% glucose (culture 1) or with 0.2% arabinose (culture 2). (A) Assay of the methylation state of DNA. Genomic DNA was isolated and cleaved with BfrBI, and the fragments were separated by electrophoresis in a 1.5% agarose gel. Southern blot analysis was performed as described in the legend to Fig. 4. Lane 1, culture 1; lane 2, culture 2. (B and C) Nomarski light microscopy of culture 1 (B) and culture 2 (C). Cells under a coverslip were photographed by using a light microscope. Bars = 5 µm. (D to F) Flow cytometric analyses. The vertical axis shows the relative number of cells measured by fluorescence intensity, and the horizontal axis shows the DNA content expressed as genome equivalents (E and F) or the light scatter representing the relative cell size (D).

To determine whether the inhibition of cell division was specific for CcrM overexpression, exponential-phase cells of strain WA802 with pUC18-ccrM were assayed by cytometric analysis and light microscopy. The ccrM present on high-copy-number plasmid pUC18 could provide moderately large amounts of CcrM protein compared to the amount in a strain with only a single chromosomal copy of the ccrM gene. It has been shown that WA802/pUC18-ccrM cells have an anomalous size distribution and DNA content (data not shown) similar to the size distribution and DNA content of cells with excess CcrM protein overexpressed from the araBAD promoter.

We found that E. coli ccrM is a chromosomally encoded gene that is cell cycle regulated and essential for viability. Overexpression of this gene results in a significant increase in the level of DNA methylation, which correlates with aberrations in cell division and DNA content.

Top Abstract Introduction Materials and Methods Results Discussion References

 
In bacteria, DNA methylation has been thought to function primarily in restriction-modification systems. However, characterization of the Dam MTase in E. coli showed that methylation also plays a regulatory role in the cell, including control of DNA replication and transcription (17). Studies of the cell cycle-regulated CcrM MTases of Caulobacter, Rhizobium, Agrobacterium, and Brucella suggest that bacteria belonging to the alpha subdivision of the Proteobacteria also use adenine methylation as a regulatory mechanism (23).

Here, we studied an E. coli DNA adenine MTase from a member of the gamma subdivision of the Proteobacteria. This enzyme is an essential, cell cycle-regulated orphan MTase that plays a similar role in regulating cell cycle events and exhibits 50% homology with a group of ortholog MTases from members of the alpha subdivision of the Proteobacteria. These MTases methylate the recognition sequence GANTC, as shown by the resistance of chromosomal DNA to HinfI digestion (25). An E. coli CcrM DNA MTase that methylates the first adenine moiety of the DNA sequence ATGCAT has now been identified. This conclusion is based on the observation that phage lambda DNA, after methylation by CcrM, is resistant to cleavage by NsiI and BfrBI, which recognize the ATGCAT sequence but have different digestion sensitivities, depending on methylation at the first or second adenine. A cognate REase is not encoded by the gene adjacent to the ccM gene. Furthermore, we showed that the activity of a cognate REase is not present in E. coli, because it was possible to detect unmethylated DNA during the cell cycle (Fig. 3).

The methylation status of ATGCAT sites in the E. coli DNA was found to change cyclically during the cell cycle. The observed cell cycle changes in the methylation state can be attributed to the temporal transcriptional regulation of ccrM in E. coli cells. Our data show that the cellular level of ccrM mRNA also changed cyclically during the cell cycle. This suggests that the CcrM protein level changes during the cell cycle.

Evidence that expression of CcrM may affect DNA replication and cell division was obtained by analysis of E. coli cultures in which the ccrM gene was represented by many copies or overexpressed. The numbers of genome equivalents in these cultures were more than twice the numbers of genome equivalents when the expression of ccrM is normal. Overexpression of ccrM had an unexpected effect on cell morphology; many of the cells were elongated, and the cell size was irregular. A similar phenotype was observed with bacteria belonging to the alpha subdivision of the Proteobacteria with ccrM orthologs when excess amounts of the CcrM proteins were present in the cells (25). In these bacteria, the phenotype correlated with disrupted cell division. Methylation of the promoter region in bacteria could alter the expression of genes that affect cell division. Overexpression of CcM can repress the expression of genes involved in the cell cycle and cause a delay in cell division. Such a delay may lead to the elongated appearance of the cells. The disturbing effects caused by aberrant temporal expression of the ccrM gene suggest that CcrM has an important role in regulating the cell cycle.

It has already been established that cell cycle-regulated DNA MTase is widespread in members of the alpha subdivision of the Proteobacteria, including Caulobacter, Agrobacterium, Rhizobium, and Brucella (23). Here we present evidence that a temporally constrained DNA methylation activity may be a conserved means of regulating fundamental aspects of the cell cycle and that this mechanism is found in another group of bacteria, the gamma subdivision of the Proteobacteria. It is likely that undiscovered DNA MTases in other groups of bacteria play comparable roles in regulating the cell cycle. Thus, CcrM appears to be an orphan MTase which, like Dam, provides important regulatory information in members of the gamma subdivision of the Proteobacteria. We have found that the M.EcoKCcrM MTase has a striking degree of similarity with putative DNA MTases of pathogenic members of the gamma subdivision of the Proteobacteria, such as E. coli O157:H7, S. enterica serovar Typhimurium LT2, and S. flexneri (Table 2). Thus, inhibition of the ccrM function may prove to be lethal to such bacteria, through disruption of an essential regulatory function. CcrM may be an attractive candidate target for the development of MTase inhibitors as novel antibacterial agents for use against pathogenic bacteria. To further determine the functions of the CcrM adenine MTase in E. coli, we are currently investigating its role in the regulation of gene expression.

 
We thank Steve Smith for protein sequence analysis, Mark Griffin of the Flow Cytometry Core Facility and Eugene Knutson of the Optical Imaging Core for technical assistance, and David Konkel for editing the manuscript.

This work was supported by NIH grant P30 ES 06676 (to R.S.L.). R.S.L. is the holder of the Mary Gibbs Jones Distinguished Chair in Environmental Toxicology from the Houston Endowment.

 
* Corresponding author. Mailing address: Sealy Center for Molecular Science, University of Texas Medical Branch at Galveston, Galveston, TX 77555-1071. Phone: (409) 772-4906. Fax: (409) 747-6869. E-mail: vakossyk{at}utmb.edu.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Au, K. G., K. Welsh, and P. Modrich. 1992. Initiation of methyl-directed mismatch repair. J. Biol. Chem. 267:12142-12148.[Abstract/Free Full Text]
2
2. Bestor, T. H. 2000. The DNA methyltransferases of mammals. Hum. Mol. Genet. 9:2395-2402.[Abstract/Free Full Text]
3
3. Bickle, T. A., and D. H. Kruger. 1993. Biology of DNA restriction. Microbiol. Rev. 57:434-450.[Abstract/Free Full Text]
4
4. Bird, A. P., and A. P. Wolffe. 1999. Methylation-induced repression-belts, braces, and chromatin. Cell 99:451-454.[CrossRef][Medline]
5
5. Blyn, L. B., B. A. Braaten, and D. A. Low. 1990. Regulation of pap pilin phase variation by a mechanism involving differential Dam methylation states. EMBO J. 9:4045-4054.[Medline]
6
6. Boye, E., and A. Lobner-Olesen. 1990. The role of dam methyltransferase in the control of DNA replication in E. coli. Cell 62:981-989.[CrossRef][Medline]
7
7. Campbell, J. L., and N. Kleckner. 1990. E. coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the passage of the chromosomal replication fork. Cell 62:967-979.[CrossRef][Medline]
8
8. Cheng, X., and R. J. Roberts. 2001. AdoMet-dependent methylation, DNA methyltransferases and base flipping. Nucleic Acids Res. 29:3784-3795.[Abstract/Free Full Text]
9
9. Edwards, R. A., L. H. Keller, and D. M. Schifferli. 1998. Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene 207:149-157.[CrossRef][Medline]
10
10. Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P_BAD promoter. J. Bacteriol. 177:4121-4130.[Abstract/Free Full Text]
11
11. Haagmans, W., and M. van der Woude. 2000. Phase variation of Ag43 in Escherichia coli: Dam-dependent methylation abrogates OxyR binding and OxyR-mediated repression of transcription. Mol. Microbiol. 35:877-887.[CrossRef][Medline]
12
12. Heithoff, D. M., R. L. Sinsheimer, D. A. Low, and M. J. Mahan. 1999. An essential role for DNA adenine methylation in bacterial virulence. Science 284:967-970.[Abstract/Free Full Text]
13
13. Julio, S. M., D. M. Heithoff, D. Provenzano, K. K. Klose, R. L. Sinsheimer, D. A. Low, and M. J. Mahan. 2001. DNA adenine methylase is essential for viability and plays a role in the pathogenesis of Yersinia pseudotuberculosis and Vibrio cholerae. Infect. Immun. 69:7610-7615.[Abstract/Free Full Text]
14
14. Low, D. A., N. J. Weyand, and M. J. Mahan. 2001. Roles of DNA adenine methylation in regulating bacterial gene expression and virulence. Infect. Immun. 69:7197-7204.[Free Full Text]
15
15. Makinoshima, H. A., A. Nishimura, and A. Ishihama. 2002. Fraction of Escherichia coli cell populations at different stages during growth transition to stationary phase. Mol. Microbiol. 43:269-279.[CrossRef][Medline]
16
16. Malone, T., R. M. Blumenthal, and X. Cheng. 1995. Structure-guided analysis reveals nine sequence motifs conserved among DNA amino-methyltransferases, and suggests a catalytic mechanism for these enzymes. J. Mol. Biol. 253:618-632.[CrossRef][Medline]
17
17. Marinus, M. G. 1996. Methylation of DNA, p. 782-791. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
18
18. Minko, I., S. Hattman, S., R. S. Lloyd, and V. G. Kossykh. 2001. Methylation by a mutant T2 DNA [N(6)-adenine] methyltransferase expands the usage of RecA-assisted endonuclease (RARE) cleavage. Nucleic Acids Res. 29:1484-1490.[Abstract/Free Full Text]
19
19. Nicholson, B., and D. A. Low. 2000. DNA methylation-dependent regulation of pef expression in Salmonella typhimurium. Mol. Microbiol. 35:728-742.[CrossRef][Medline]
20
20. Pertoft, H. 2000. Fraction of cells and subcellular particles with Percoll. J. Biochem. Biophys. Methods 44:1-30.[CrossRef][Medline]
21
21. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-331.[CrossRef][Medline]
22
22. Reed, K. C., and D. A. Mann. 1985. Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res. 13:7207-7221.[Abstract/Free Full Text]
23
23. Reisenauer, A., L. S. Kahng, S. McCollum, and L. Shapiro. 1999. Bacterial DNA methylation: a cell cycle regulator? J. Bacteriol. 181:5135-5139.[Free Full Text]
24
24. Roberts, R. J., T. Vincze, J. Posfai, and D. Macelis. 2003. REBASE: restriction enzymes and methyltransferases. Nucleic Acids Res. 31:418-420.[Abstract/Free Full Text]
25
25. Stephens, C., A. Reisenauer, R. Wright, and L. Shapiro. 1996. A cell cycle-regulated bacterial DNA methyltransferase is essential for viability. Proc. Natl. Acad. Sci. 93:1210-1214.[Abstract/Free Full Text]
26
26. Yanish-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.[CrossRef][Medline]

---

Journal of Bacteriology, April 2004, p. 2061-2067, Vol. 186, No. 7
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.7.2061-2067.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Broadbent, S. E., Balbontin, R., Casadesus, J., Marinus, M. G., van der Woude, M. (2007). YhdJ, a Nonessential CcrM-Like DNA Methyltransferase of Escherichia coli and Salmonella enterica. J. Bacteriol. 189: 4325-4327 [Abstract] [Full Text]  
• Mashhoon, N., Carroll, M., Pruss, C., Eberhard, J., Ishikawa, S., Estabrook, R. A., Reich, N. (2004). Functional Characterization of Escherichia coli DNA Adenine Methyltransferase, a Novel Target for Antibiotics. J. Biol. Chem. 279: 52075-52081 [Abstract] [Full Text]  
• Zaleski, P., Piekarowicz, A. (2004). Characterization of a dam mutant of Haemophilus influenzae Rd. Microbiology 150: 3773-3781 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) A retraction has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kossykh, V. G. Articles by Lloyd, R. S. Search for Related Content PubMed PubMed Citation Articles by Kossykh, V. G. Articles by Lloyd, R. S.