Previous Article | Next Article 
Journal of Bacteriology, April 2004, p. 2511-2514, Vol. 186, No. 8
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.8.2511-2514.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Control of Expression of the Arginine Deiminase Operon of Streptococcus gordonii by CcpA and Flp
Yiqian Dong, Yi-Ywan M. Chen, and R. A. Burne*
Department of Oral Biology, University of Florida, Gainesville, Florida 32610
Received 22 October 2003/
Accepted 2 January 2004

ABSTRACT
In
Streptococcus gordonii DL1, inactivation of the
ccpA gene
and a gene encoding an Fnr-like protein (Flp) demonstrated that
CcpA was essential for carbohydrate catabolite repression and
that Flp was required for optimal expression and anaerobic induction
of the arginine deiminase system.

TEXT
The arginine deiminase system (ADS) (encoded by the
arc operon)
is a multienzyme pathway that catalyzes the conversion of arginine
to ornithine, ammonia, and CO
2, with the concomitant production
of ATP. The ADS is widely distributed among prokaryotes, and
the primary structures of the enzymes involved in the AD pathway
have been reasonably conserved throughout evolution. However,
the genetic regulation characteristics of ADS differ among organisms.
For instance, both
Pseudomonas aeruginosa (
17) and
Bacillus licheniformis (
26) utilize the ADS exclusively under anaerobic
conditions through a transcriptional regulator belonging to
the Anr (for "anaerobic regulation of arginine catabolism and
nitrate reduction")/Fnr (for "fumarate nitrate reductase") family.
Induction by Anr/Fnr can be further enhanced in the presence
of arginine by ArgR, the transcriptional regulator. In some
lactic acid bacteria, such as
Streptococcus sanguis (
8) and
Lactobacillus sakei (
31), the expression of the operon is under
the control of carbon catabolite repression (CCR) and is inducible
by arginine; however, the mechanisms for CCR and arginine induction
are not fully understood. Furthermore, in some oral bacteria
(such as
S. sanguis NCTC10904 and
Streptococcus rattus FA-1)
the ADS can be repressed by aeration through an as-yet-undefined
pathway (
2). In the oral cavity, the ADS is one of two primary
pathways for ammonia generation. Ammonia produced by the ADS
can neutralize acids generated by bacterial glycolysis, thereby
increasing dental biofilm pH. The elevated pH induced by arginine
catabolism is thought to be important in inhibiting the development
of tooth decay and in modulating the composition of plaque (
1,
3). Among the comparatively few ADS-positive species that colonize
the mouth,
Streptococcus gordonii is one of the more abundant
organisms in tooth biofilms and makes up a significant portion
of healthy human supragingival dental plaque (
3,
19). Thus,
the ADS of
S. gordonii may play a critical role in the prevention
of dental caries.
Dong et al. previously reported that the arc operon in S. gordonii is arranged as arcABCDT. In addition to the genes encoding enzymes involved in the AD pathway, arcR, a gene encoding an activator for the arc operon, is located 3' to arcT and transcribed in the opposite orientation. We also showed that the expression of the S. gordonii arc operon is inducible by arginine and subject to CCR. Arginine induction is mediated in large part by the activity of ArcR, but the molecular basis for CCR of the arc operon has not been defined (7). In most gram-positive bacteria, binding of CcpA (for "catabolite control protein A") (13) to a palindromic sequence, the carbon catabolite response element, results in repression of CCR-sensitive operons (28). However, other pathways such as CcpB (4), CcpC (15), and phosphotransferase system-dependent CCR (exerted through phosphorylation of specific transcriptional regulators) are known to be involved in CCR of some gram-positive bacteria (10, 20, 27). To determine whether CcpA is the primary protein exerting CCR of arc operon expression in S. gordonii, an apparent CcpA homolog, which was identified from the partial S. gordonii genome database (The Institute for Genomic Research website [http://www.tigr.org]), was amplified by PCR using primers ccpA-S and ccpA-AS (Table 1), with S. gordonii DL1 chromosomal DNA as the template. An erythromycin resistance cassette was then cloned into the unique EcoRV site within the ccpA gene, and the resulting plasmid was used to transform S. gordonii to generate a CcpA-deficient derivative via double-crossover recombination. The arcA promoter (parcA) (obtained as a 337-bp fragment upstream of the arcA start codon by PCR with primers parcA5' and parcA3') (Table 1) was directly fused to a chloramphenicol acetyltransferase (CAT) gene (cat) in plasmid pMC286, which was constructed by insertion of the promoterless cat gene from pC194 (14) into pGEM-Zf3(+) at BamHI and SphI sites. The fusion was constructed such that translation was driven from the arcA ribosome binding site. The transcriptional fusion was then released and cloned into pMJB8 (5), an S. gordonii integration vector that allows insertion of foreign DNA at the gtfG (glucosyltransferase gene) locus with the selection of a kanamycin-resistant phenotype. The construct was then used to transform wild-type and CcpA-deficient strains of S. gordonii. CAT activity (optical density at 600 nm
0.6 to 0.7) was measured in mid-exponential-phase cells grown in TY medium (29) with 10 mM glucose (a repressing sugar) or 10 mM galactose (a nonrepressing sugar) by the method of Shaw (24). In the wild-type background, the level of CAT activity in cells grown in TY medium with galactose was 17-fold higher than that seen with cells grown in TY medium with glucose (Table 2). In the CcpA-deficient strain, CCR was relieved and there was no significant difference in CAT activity between cells grown in galactose or glucose. These results indicated that (excluding other possible pathways such as those of CcpB, CcpC, and phosphotransferase system-dependent CCR) CcpA is the primary regulator for CCR of the arc operon in S. gordonii.
View this table:
[in this window]
[in a new window]
|
TABLE 2. CAT-specific activities in wild-type and CcpA-deficient strains of S. gordonii/parcA-cat and wild-type and Flp-deficient strains of S. gordonii/parcA-cat under aerobic and anaerobic growth conditions
|
After the incomplete
S. gordonii genome was searched, one 684-bp
open reading frame (ORF) (located 263 bp 5' to
arcA) was predicted
to code for a homologue of known proteins of the Crp/Fnr family,
which has been proven to be responsible for anaerobic versus
aerobic gene regulation in many gram-negative bacteria (
16,
17,
30) and in some gram-positive bacteria, including
Bacillus subtilis and
B. licheniformis (
6,
18). The proteins with the
most similarity to this ORF (
Streptococcus pyogenes SPY1548
[43% identical residues],
B. licheniformis ArcR [37% identical
residues],
P. aeruginosa Anr [23% identical residues],
L. sakei ArcR [34% identical residues], and
Enterococcus faecalis ArcE
[35% identical residues]) were putative members of the Crp/Fnr
family that were either linked to, or already shown to be involved
in,
arc regulation. Thus, we designated this ORF
flp (for "Fnr-like
protein") in
S. gordonii. A multiple-sequence alignment of Flp
and selected representatives of the Crp/Fnr family showed that
there are conserved residues throughout the proteins (Fig.
1).
Although the overall level of similarity between Flp and each
of the aligned proteins is not high, the predicted helix-turn-helix
motif located in the C-terminal part of the proteins is more
conserved. Of note, conserved residues (such as arginine and
glutamic acid) (
32) shown to be involved in recognition of the
DNA binding site by Crp were found in
S. gordonii Flp at positions
212 and 213 (Fig.
1). However, Flp in
S. gordonii has only two
cysteine residues instead of the four conserved cysteine residues
that are usually found in other Fnr homologues (
12,
21,
25).
To date, only two other known Fnr-like proteins containing two
cysteine residues that regulate the redox responses in
Lactococcus lactis and
Lactobacillus casei have been identified (
11,
23).
It was found that the
flp gene was preceded by a putative Shine-Dalgarno
sequence and began with an ATG codon. In addition, a putative
rho-independent terminator (5'-
TTTCTTTTTTTAGCAAAAACAAAGA
TTTTATAAAAAAATAAA-3'
[the bases forming the stem-loop are underlined]) was found
between
flp and
arcA (Fig.
2), in consistency with our finding
that
arc gene expression is driven from its own promoter (
7).
We also examined the two ORFs immediately 5' to the
flp gene
in
S. gordonii; these ORFs were revealed in BLAST searches to
be conserved hypothetical proteins.
To determine the function of Flp in regulation of
arc operon
expression,
flp was amplified by recombinant PCRs with primers
(Table
1) that were designed on the basis of the
flp sequence
identified from the partial sequence in the
S. gordonii genome
database. The introduction of a unique SmaI site 141 bp 3' to
the start codon of
flp allowed the subsequent cloning of a spectinomycin
resistance cassette into the
flp gene, and the resulting plasmid
was used to transform
S. gordonii to generate a Flp-deficient
derivative via double-crossover recombination. The p
arcA-cat fusion was then used to transform the Flp-deficient mutant and
wild-type
S. gordonii. Early-log-phase cells (optical density
at 600 nm

0.25 to 0.35) grown in TY medium containing 10 mM
galactose and 50 mM arginine under anaerobic conditions in a
GasPak jar (BBL), or with aeration by shaking at 300 rpm with
50 ml of culture in a 250-ml flask (
2), were harvested and used
to measure CAT activity. Inactivation of
flp resulted in 11-
and 4.3-fold decreases in CAT activity compared to the results
seen with the wild-type strain grown under anaerobic and aerobic
growth conditions (Table
2), respectively, which suggested that
Flp was an activator of
arc operon expression in
S. gordonii.
In the Flp-deficient strain, furthermore, CAT activity in cells
grown under anaerobic conditions was less than twofold higher
than that seen in aerobically grown cells compared to a fivefold
difference in the results seen with the wild-type strain, which
indicated Flp might be involved in anaerobic induction of the
ADS in
S. gordonii. So far, there is no evidence to indicate
that Flp is a global regulatory protein, as it is in
Escherichia coli and
P. aeruginosa (
9,
22,
30), but the possibility cannot
be excluded that Flp regulates genes other than the
arc operon.

ACKNOWLEDGMENTS
This work was supported by Public Health Service grant DE10362
from the National Institute of Dental and Craniofacial Research.

FOOTNOTES
* Corresponding author. Mailing address: University of Florida, Department of Oral Biology, P.O. Box 100424, Gainesville, FL 32610-0424. Phone: (352) 392-4370. Fax: (352) 392-7357. E-mail:
rburne{at}dental.ufl.edu.


REFERENCES
1 - Bowden, G. H., and I. R. Hamilton. 1987. Environmental pH as a factor in the competition between strains of the oral streptococci Streptococcus mutans, S. sanguis, and "S. mitior" growing in continuous culture. Can. J. Microbiol. 33:824-827.[Medline]
2 - Burne, R. A., D. T. Parsons, and R. E. Marquis. 1991. Environmental variables affecting arginine deiminase expression in oral streptococci, p. 276-280. In P. P. Dunny, G. M. Cleary, and L. L. McKay (ed.), Genetics and molecular biology of streptococci, lactococci, and enterococci. American Society for Microbiology, Washington, D.C.
3 - Burne, R. A., and R. E. Marquis. 2000. Alkali production by oral bacteria and protection against dental caries. FEMS Microbiol. Lett. 193:1-6.[CrossRef][Medline]
4 - Chauvaux, S., I. T. Paulsen, and M. H. Saier, Jr. 1998. CcpB, a novel transcription factor implicated in catabolite repression in Bacillus subtilis. J. Bacteriol. 180:491-497.[Abstract/Free Full Text]
5 - Chen, Y. Y., M. J. Betzenhauser, and R. A. Burne. 2002. cis-acting elements that regulate the low-pH-inducible urease operon of Streptococcus salivarius. Microbiology 148:3599-3608.[Abstract/Free Full Text]
6 - Cruz Ramos, H., L. Boursier, I. Moszer, F. Kunst, A. Danchin, and P. Glaser. 1995. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms. EMBO J. 14:5984-5994.[Medline]
7 - Dong, Y., Y.-Y. M. Chen, J. A. Snyder, and R. A. Burne. 2002. Isolation and molecular analysis of the gene cluster for the arginine deiminase system from Streptococcus gordonii DL1. Appl. Environ. Microbiol. 68:5549-5553.[Abstract/Free Full Text]
8 - Ferro, K. J., G. R. Bender, and R. E. Marquis. 1983. Coordinately repressible arginine deiminase system in Streptococcus sanguis. Curr. Microbiol. 9:145-150.
9 - Galimand, M., M. Gamper, A. Zimmermann, and D. Haas. 1991. Positive FNR-like control of anaerobic arginine degradation and nitrate respiration in Pseudomonas aeruginosa. J. Bacteriol. 173:1598-1606.[Abstract/Free Full Text]
10 - Gosalbes, M. J., V. Monedero, and G. Perez-Martinez. 1999. Elements involved in catabolite repression and substrate induction of the lactose operon in Lactobacillus casei. J. Bacteriol. 181:3928-3934.[Abstract/Free Full Text]
11 - Gostick, D. O., J. Green, A. S. Irvine, M. J. Gasson, and J. R. Guest. 1998. A novel regulatory switch mediated by the FNR-like protein of Lactobacillus casei. Microbiology 144:705-717.[Abstract/Free Full Text]
12 - Green, J., A. D. Sharrocks, B. Green, M. Geisow, and J. R. Guest. 1993. Properties of FNR proteins substituted at each of the five cysteine residues. Mol. Microbiol. 8:61-68.[CrossRef][Medline]
13 - Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacl and galR repressors. Mol. Microbiol. 5:575-584.[CrossRef][Medline]
14 - Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150:815-825.[Abstract/Free Full Text]
15 - Jourlin-Castelli, C., N. Mani, M. M. Nakano, and A. L. Sonenshein. 2000. CcpC, a novel regulator of the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J. Mol. Biol. 295:865-878.[CrossRef][Medline]
16 - Lazazzera, B. A., H. Beinert, N. Khoroshilova, M. C. Kennedy, and P. J. Kiley. 1996. DNA binding and dimerization of the Fe-S-containing FNR protein from Escherichia coli are regulated by oxygen. J. Biol. Chem. 271:2762-2768.[Abstract/Free Full Text]
17 - Lu, C. D., H. Winteler, A. Abdelal, and D. Haas. 1999. The ArgR regulatory protein, a helper to the anaerobic regulator ANR during transcriptional activation of the arcD promoter in Pseudomonas aeruginosa. J. Bacteriol. 181:2459-2464.[Abstract/Free Full Text]
18 - Maghnouj, A., A. A. Abu-Bakr, S. Baumberg, V. Stalon, and C. Vander Wauven. 2000. Regulation of anaerobic arginine catabolism in Bacillus licheniformis by a protein of the Crp/Fnr family. FEMS Microbiol. Lett. 191:227-234.[CrossRef][Medline]
19 - Marquis, R. E., G. R. Bender, D. R. Murray, and A. Wong. 1987. Arginine deiminase system and bacterial adaptation to acid environments. Appl. Environ. Microbiol. 53:198-200.[Abstract/Free Full Text]
20 - Martin-Verstraete, I., J. Stulke, A. Klier, and G. Rapoport. 1995. Two different mechanisms mediate catabolite repression of the Bacillus subtilis levanase operon. J. Bacteriol. 177:6919-6927.[Abstract/Free Full Text]
21 - Melville, S. B., and R. P. Gunsalus. 1990. Mutations in fnr that alter anaerobic regulation of electron transport-associated genes in Escherichia coli. J. Biol. Chem. 265:18733-18736.[Abstract/Free Full Text]
22 - Salmon, K., S. P. Hung, K. Mekjian, P. Baldi, G. W. Hatfield, and R. P. Gunsalus. 2003. Global gene expression profiling in Escherichia coli K12. The effects of oxygen availability and FNR. J. Biol. Chem. 278:29837-29855.[Abstract/Free Full Text]
23 - Scott, C., J. R. Guest, and J. Green. 2000. Characterization of the Lactococcus lactis transcription factor FlpA and demonstration of an in vitro switch. Mol. Microbiol. 35:1383-1393.[CrossRef][Medline]
24 - Shaw, W. V. 1979. Chloramphenicol acetyltransferase activity from chloramphenicol-resistant bacteria. Methods Enzymol. 43:737-755.
25 - Spiro, S., and J. R. Guest. 1988. Inactivation of the FNR protein of Escherichia coli by targeted mutagenesis in the N-terminal region. Mol. Microbiol. 2:701-707.[CrossRef][Medline]
26 - Stockley, P. G., A. J. Baron, C. M. Wild, I. D. Parsons, C. M. Miller, C. A. Holtham, and S. Baumberg. 1998. Dissecting the molecular details of prokaryotic transcriptional control by surface plasmon resonance: the methionine and arginine repressor proteins. Biosens. Bioelectron. 13:637-650.[CrossRef][Medline]
27 - Tobisch, S., J. Stulke, and M. Hecker. 1999. Regulation of the lic operon of Bacillus subtilis and characterization of potential phosphorylation sites of the LicR regulator protein by site-directed mutagenesis. J. Bacteriol. 181:4995-5003.[Abstract/Free Full Text]
28 - Weickert, M. J., and G. H. Chambliss. 1990. Site-directed mutagenesis of a catabolite repression operator sequence in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 87:6238-6242.[Abstract/Free Full Text]
29 - Wexler, D. L., M. C. Hudson, and R. A. Burne. 1993. Streptococcus mutans fructosyltransferase (ftf) and glucosyltransferase (gtfBC) operon fusion strains in continuous culture. Infect. Immun. 61:1259-1267.[Abstract/Free Full Text]
30 - Ye, R. W., D. Haas, J. O. Ka, V. Krishnapillai, A. Zimmermann, C. Baird, and J. M. Tiedje. 1995. Anaerobic activation of the entire denitrification pathway in Pseudomonas aeruginosa requires Anr, an analog of Fnr. J. Bacteriol. 177:3606-3609.[Abstract/Free Full Text]
31 - Zúñiga, M., M. Champomier-Verges, M. Zagorec, and G. Pérez-Martínez. 1998. Structural and functional analysis of the gene cluster encoding the enzymes of the arginine deiminase pathway of Lactobacillus sake. J. Bacteriol. 180:4154-4159.[Abstract/Free Full Text]
32 - Zúñiga, M., M. del Carmen Miralles, and G. Pérez-Martínez. 2002. The product of arcR, the sixth gene of the arc operon of Lactobacillus sakei, is essential for expression of the arginine deiminase pathway. Appl. Environ. Microbiol. 68:6051-6058.[Abstract/Free Full Text]
Journal of Bacteriology, April 2004, p. 2511-2514, Vol. 186, No. 8
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.8.2511-2514.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Liu, Y., Burne, R. A.
(2009). Multiple Two-Component Systems Modulate Alkali Generation in Streptococcus gordonii in Response to Environmental Stresses. J. Bacteriol.
191: 7353-7362
[Abstract]
[Full Text]
-
Wood, D. N., Weinstein, K. E., Podbielski, A., Kreikemeyer, B., Gaughan, J. P., Valentine, S., Buttaro, B. A.
(2009). Generation of Metabolically Diverse Strains of Streptococcus pyogenes during Survival in Stationary Phase. J. Bacteriol.
191: 6242-6252
[Abstract]
[Full Text]
-
Johnson, B. P., Jensen, B. J., Ransom, E. M., Heinemann, K. A., Vannatta, K. M., Egland, K. A., Egland, P. G.
(2009). Interspecies Signaling between Veillonella atypica and Streptococcus gordonii Requires the Transcription Factor CcpA. J. Bacteriol.
191: 5563-5565
[Abstract]
[Full Text]
-
Liu, Y., Dong, Y., Chen, Y.-Y. M., Burne, R. A.
(2008). Environmental and Growth Phase Regulation of the Streptococcus gordonii Arginine Deiminase Genes. Appl. Environ. Microbiol.
74: 5023-5030
[Abstract]
[Full Text]
-
Lin, X., Lamont, R. J., Wu, J., Xie, H.
(2008). Role of Differential Expression of Streptococcal Arginine Deiminase in Inhibition of fimA Expression in Porphyromonas gingivalis. J. Bacteriol.
190: 4367-4371
[Abstract]
[Full Text]
-
Jakubovics, N. S., Gill, S. R., Iobst, S. E., Vickerman, M. M., Kolenbrander, P. E.
(2008). Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii. J. Bacteriol.
190: 3646-3657
[Abstract]
[Full Text]
-
Almengor, A. C., Kinkel, T. L., Day, S. J., McIver, K. S.
(2007). The Catabolite Control Protein CcpA Binds to Pmga and Influences Expression of the Virulence Regulator Mga in the Group A Streptococcus. J. Bacteriol.
189: 8405-8416
[Abstract]
[Full Text]
-
Makhlin, J., Kofman, T., Borovok, I., Kohler, C., Engelmann, S., Cohen, G., Aharonowitz, Y.
(2007). Staphylococcus aureus ArcR Controls Expression of the Arginine Deiminase Operon. J. Bacteriol.
189: 5976-5986
[Abstract]
[Full Text]
-
Kaufman, G. E., Yother, J.
(2007). CcpA-Dependent and -Independent Control of Beta-Galactosidase Expression in Streptococcus pneumoniae Occurs via Regulation of an Upstream Phosphotransferase System-Encoding Operon. J. Bacteriol.
189: 5183-5192
[Abstract]
[Full Text]
-
Bizzini, A., Entenza, J. M., Moreillon, P.
(2007). Loss of penicillin tolerance by inactivating the carbon catabolite repression determinant CcpA in Streptococcus gordonii. J Antimicrob Chemother
59: 607-615
[Abstract]
[Full Text]
-
Deutscher, J., Francke, C., Postma, P. W.
(2006). How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria. Microbiol. Mol. Biol. Rev.
70: 939-1031
[Abstract]
[Full Text]
-
Michel, A., Agerer, F., Hauck, C. R., Herrmann, M., Ullrich, J., Hacker, J., Ohlsen, K.
(2006). Global Regulatory Impact of ClpP Protease of Staphylococcus aureus on Regulons Involved in Virulence, Oxidative Stress Response, Autolysis, and DNA Repair.. J. Bacteriol.
188: 5783-5796
[Abstract]
[Full Text]
-
Zeng, L., Dong, Y., Burne, R. A.
(2006). Characterization of cis-Acting Sites Controlling Arginine Deiminase Gene Expression in Streptococcus gordonii. J. Bacteriol.
188: 941-949
[Abstract]
[Full Text]
-
Gruening, P., Fulde, M., Valentin-Weigand, P., Goethe, R.
(2006). Structure, Regulation, and Putative Function of the Arginine Deiminase System of Streptococcus suis. J. Bacteriol.
188: 361-369
[Abstract]
[Full Text]
-
Iyer, R., Baliga, N. S., Camilli, A.
(2005). Catabolite Control Protein A (CcpA) Contributes to Virulence and Regulation of Sugar Metabolism in Streptococcus pneumoniae. J. Bacteriol.
187: 8340-8349
[Abstract]
[Full Text]