Previous Article | Next Article ![]()
Journal of Bacteriology, January 2005, p. 320-328, Vol. 187, No. 1
0021-9193/05/$08.00+0 doi:10.1128/JB.187.1.320-328.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Jennifer L. Wendt,
Calista J. Mitchell,
and
David S. Weiss*
Department of Microbiology, University of Iowa, Iowa City, Iowa
Received 7 August 2004/ Accepted 17 September 2004
|
|
|---|
|
|
|---|
FtsI, also known as penicillin-binding protein 3 (PBP3), is a transpeptidase needed for cross-linking septal peptidoglycan (1, 3, 38). Previous studies from a number of laboratories have shown that FtsI is one of over a dozen proteins that localize to the division site, where they form a structure called the septal ring (for recent reviews, see references 12 and 43). As division proceeds, the ring constricts so as to remain at the leading edge of the developing septum. The septal ring is thought to be a multiprotein complex that mediates cell division. Studies of septal ring assembly in various mutant backgrounds have revealed that, at least in E. coli, the division proteins are recruited to the ring in a sequential fashion. In this hierarchy, FtsI is one of the last proteins to join the ring; localization of FtsI appears to depend upon the prior localization of FtsZ, FtsA, ZipA, FtsEX (though this is a leaky requirement), FtsK, FtsQ, FtsBL, and FtsW. This scheme suggests that FtsI is recruited to the septal ring by a cascade of protein-protein interactions involved in the assembly of a multiprotein complex. Moreover, FtsI might localize by binding to FtsW, since FtsW appears to be directly responsible for recruiting FtsI to the septal ring (28). A recent study employing a bacterial two-hybrid system reported that FtsI interacts with itself, FtsW, FtsQ, and FtsA (10), but it is not clear whether any of these interactions are direct.
In terms of structure, FtsI is a bitopic membrane protein with a short N-terminal cytoplasmic domain, a single TMH, and a large periplasmic region that contains two domainsone of unknown function, the other a transpeptidase catalytic domain (Fig. 1) (4, 33). The question of what part(s) of FtsI serves to direct the protein to the division site has been addressed by random mutagenesis of the entire gene followed by a screen for localization-defective mutant proteins (45). Mutant proteins specifically defective in septal localization all had lesions in one of three amino acidsR23, L39, or Q46that are in or near the TMH. These lesions did not prevent insertion of the mutant proteins into the membrane, although subtle effects on how the mutant proteins sit in the lipid bilayer could not be ruled out. Nevertheless, the simplest interpretation was that the most important localization signals in FtsI reside in the TMH, not in the domain of unknown function, as had been suggested previously (27, 33).
![]() View larger version (14K): [in a new window] |
FIG. 1. Domain structure of FtsI. On top is a ribbon diagram showing that mature FtsI is 577 residues in length. It contains a short cytoplasmic domain, a single TMH, and a large periplasmic region that includes both a domain of unknown function and a transpeptidase catalytic domain. The sequence below the ribbon diagram shows the 51 N-terminal amino acids. The minimal fragment found here to direct GFP to the septal ring is indicated in large type and extends from W22 to V47. The borders of the TMH as determined by five different computer programs are indicated by underlining; underlined residues were predicted by at least one program to be in the TMH, while residues between the underlined regions were predicted by all five programs to be in the TMH. Arginines at positions 23 and 41 that were presumed in earlier studies to be the borders of the TMH are boxed. The bottom sequence summarizes results of our mutagenesis studies. Arrowheads indicate the positions of cytoplasmic domain deletions. An asterisk marks each residue found to be important for septal localization by alanine scanning. Arrows show the positions of the leucine insertion that abolishes septal localization and of the L33P substitution that corrects this defect. Letters beneath the sequence indicate lesions found in a previous study (45) to cause localization defects (R23C, R23H, L39P, and Q46H).
|
|
|
|---|
(
att-lom)::bla araC PBAD-ftsI], MC4100 [F
araD139
lacU169
relA1 rpsL150 thi mot flb-5301 deoC7 ptsF25 rbsR], LMG64 [ftsI23(Ts) leu::Tn10 recA::cat], and DHB4 [F' lacIq pro/
lacX74 galE galK thi rpsL phoR
phoA(PvuII)
malF3]. These strains have been described previously (5, 16, 45). Media. Strains were grown in Luria broth (LB) (10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl per liter with 15 g of agar per liter for plates) containing the following antibiotics as appropriate: chloramphenicol at 10 µg/ml, kanamycin at 40 µg/ml, and ampicillin at either 25 µg/ml for chromosomal alleles or 200 µg/ml for plasmids. Isopropyl-ß-D-thiogalactopyranoside (IPTG) was used to induce expression from Plac, while L-arabinose and D-glucose were used for induction and repression, respectively, of PBAD (15).
Molecular biological procedures and oligonucleotides. Standard procedures for cloning and analysis of DNA, PCR, electroporation, and transformation were used (2). Enzymes used to manipulate DNA were from New England BioLabs (Beverly, Mass.). Oligonucleotides were from Integrated DNA Technologies (Coralville, Iowa). DNA sequencing was performed by the DNA Core Facility of the University of Iowa by using dye terminator cycle-sequencing chemistry. All constructs made by PCR were sequenced to verify their integrity.
Plasmids.
Plasmids used in this study were based on pDSW521 (Knr Plac::gfp-ftsI2-577, where ftsI2-577 indicates the ftsI gene in which the bases that code for residues 2 to 577 have been retained). pDSW521 is a derivative of pTH18-kr, which has a copy number of
5 (19, 45).
(i) Deletions of the cytoplasmic domain.
To delete the first 14 codons, ftsI was amplified from pLMG173 (16) with primers MW1 (CGGAATTCAACAACAACCGTAAGGAACATGCCAACTTTATCAGT) and pBAD-rev (ACCGCTTCTGCGTTCTGATT). The first primer encodes an EcoRI site (underlined) that is in frame with an EcoRI site at the junction between gfp and ftsI in pDSW521. It also encodes a linker sequence (NNNRK) followed by codons 15 to 21 of ftsI. The second primer anneals to vector sequences downstream of ftsI in pLMG173. The PCR product was digested with EcoRI and SacII (site in ftsI), and the
200-bp product was ligated into the same sites of a gfp-ftsI fusion vector named pDSW254 (44) to make pDSW372. A
1.8-kb EcoRI-HindIII fragment that carries ftsI was subsequently excised from pDSW372 and used to replace the corresponding fragment in pDSW521 to create pDSW723 (Knr Plac::gfp-ftsI15-577). Plasmids pDSW724 (Knr Plac::gfp-ftsI19-577) and pDSW725 (Knr Plac::gfp-ftsI22-577) were constructed similarly, except that the upstream primers were MW2 (CGGAATTCAACAACAACCGTAAGTTTATCAGTTGGCGTTTTGCG) and MW3 (CGGAATTCAACAACAACCGTAAG TGGCGTTTTGCGTTGTTATGC), respectively. The pDSW254 derivatives constructed as intermediates were pDSW373 and pDSW374.
(ii) Deletions of the periplasmic domain.
The transpeptidase domain was deleted by digesting pDSW521 with PstI, treating the remaining sequence with T4 DNA polymerase to remove 3' overhangs, and religating the ends. This procedure introduces a frameshift mutation, so Arg 239 of FtsI is followed by 7 nonnative residues (RRWFIAQ ) and a stop codon. The resulting plasmid is pDSW669 (Knr Plac::gfp-ftsI2-239). A deletion that removed all ftsI codons downstream of Arg 80 was constructed by PCR. The upstream primer was gfp-461 (5' ATACATCATGGCAGACAAACA ), which binds in the middle of gfp. The downstream primer was Arg80 (CTAAGCTTTTAcccggg CGACCAGAACGGTCAGTAAT ), which carries 7 codons of ftsI (the last being codon 80) followed by a SmaI site (lowercase letters), a stop codon, and a HindIII site (underlined). The SmaI site was included to permit making fusions to the C terminus of this construct in the future. The
500-bp PCR product was digested with HpaI and HindIII and ligated into pDSW521 that had been cut with the same enzymes to produce pDSW714. Other deletion derivatives were made similarly using the following downstream primers: Ser70 (CTAAGCTTTTAcccgggGGAGGTGGAAACTTGCTGAAC), Arg60 (CTAAGCTTTTAcccgggACGCATGTCGCCCTCTTTCAC), Lys55 (CTAAGCTTTTAcccgggTTTCACCAGCATATCCGGGGA), Asp51 (CTAAGCTTTTAcccgggATCCGGGGAGATAACTTGTAA), Pro50 (CTAAGCTTTTAcccgggCGGGGAGATGACTTGTAACCA), Val47 (CTAAGCTTTTAcccgggAACTTGTAACCACGCTACGCG), Leu45 (CTAAGCTTTTAcccgggTAACCACGCTACGCGTCCGAG), and Ala43 (CTAAGCTTTTAcccgggCGCTACGCGTCCGAGCAGAAA). Finally, a control construct that expressed only gfp was made with the following downstream primer: CTAAGCTTTTAcccgggGTTGTTGTTGAATTCTTTGTA. The corresponding plasmids and the proteins that they produce are pDSW715 (GFP-FtsI2-70), pDSW716 (GFP-FtsI2-60), pDSW717 (GFP-FtsI2-55), pDSW718 (GFP-FtsI2-51), pDSW719 (GFP-FtsI2-60), pDSW720 (GFP-FtsI2-47), pDSW721 (GFP-FtsI2-45), pDSW722 (GFP-FtsI2-43), and pDSW729 (GFP).
(iii) Combining cytoplasmic and periplasmic domain deletions. Plasmid pDSW726 (GFP-FtsI2-60) was made exactly like pDSW716, except that the template for PCR was pDSW374 rather than pDSW521. Plasmid pDSW727 (GFP-FtsI22-47) was made exactly the same as pDSW726 by using the downstream primer that truncates ftsI at codon 47.
Alanine scanning of ftsI. Alanine substitutions in the TMH of ftsI were made by using either the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, Calif.) or the Gene Tailor kit (Invitrogen, Carlsbad, Calif.). The template was pDSW521 (Knr Plac::gfp-ftsI). Primer sequences are available upon request. Constructs were confirmed by sequencing.
Isolation of suppressor alleles.
Random mutagenesis was done by PCR with Taq DNA polymerase as described previously (45). The template was pLD75, which carries an ftsI allele with an extra leucine codon in the TMH (16). The insertion becomes codon 41, so the allele will be referred to here as ftsI+L41; in a previous publication (16), it was referred to as I/IStu/I to indicate that the insertion creates a StuI restriction site near the border of the TMH with the periplasmic domain. The primers used were pBAD-SacI (GAAGAGCTCGAGGAGGAAGAACCGATGCCG) and I3'-Xba (GTCTCTAGATTAATTACTACCAAACATATCC), which anneal upstream and downstream of ftsI+L41 in pLD75. The resulting
1.8-kb product was digested with SacI and XbaI (sites underlined) and cloned into the same sites of pDSW204, which confers Ampr and has a modified Trc promoter (44). The resulting plasmid pools were introduced into the ftsI23(Ts) mutant LMG64 by electroporation. Cells were plated on LB-ampicillin at either 30°C to assess transformation efficiency or 42°C to select for suppressor mutations. Suppressor mutations were mapped to the ftsI gene on the plasmid by recovering the ftsI allele on an
1.8-kb SacI-XbaI fragment, ligating the fragment back into pDSW204, and retesting the phenotype. Three independent isolates were ultimately sequenced and found to have the same suppressor mutation, T98 to C, which changes Leu 33 to Pro. One plasmid was saved and designated pDSW744. To fuse gfp to ftsI+L41 and ftsIL33P,+L41, the genes were amplified by PCR from pLD75 and pDSW744, respectively, by using primers P496 CCAGAATTCAACAACAACAAAGCAGCGGCGAAAACGCAG and P497 CCTAAGCTTACGATCTGCCACCTGTCCC. The resulting
1.8-kb product was digested with EcoRI and HindIII (sites underlined) and ligated into the same sites of pDSW521 to create pDSW658 (Knr Plac::gfp-ftsI+L41) and pDSW659 (Knr Plac::gfp-ftsIL33P,+L41).
Complementation assays. pDSW521 or derivatives were transformed into EC812 with selection for kanamycin resistance on LB containing kanamycin, chloramphenicol, ampicillin, and arabinose. The arabinose was present to induce chromosomal PBAD-ftsI in EC812. Isolates were tested for complementation by streaking onto LB plates containing the same antibiotics except glucose (to repress PBAD-ftsI) and IPTG (to induce the ftsI allele on the plasmid). Growth was scored after 18 h at 37°C on a scale from poor (), meaning that no isolated colonies formed, to good (+++), meaning that colonies were as large as those obtained with wild-type gfp-ftsI2-577 expressed from pDSW521. To test for dominance (which was not observed), similar plates that contained arabinose rather than glucose were used. Complementation was also tested in the ftsI23(Ts) strains LMG64 and EC295. Transformants were recovered at 30°C by selecting for kanamycin resistance, and then isolates were tested for complementation by streaking onto LB-kanamycin with IPTG. Growth was scored after 18 h at 42°C. Identical control plates were incubated at 30°C to test for dominance (which was not observed).
Microscopy.
GFP-FtsI proteins were visualized in fixed cells as described previously (45). All cultures were grown at 30°C. (i) Localization of GFP-FtsI proteins in merodiploids was tested in transformants of DHB4 and MC4100. An overnight culture grown in LB-kanamycin was diluted 1:1,000 into the same medium plus IPTG, grown to an optical density at 600 nm of
0.3, and then fixed for microscopy. (ii) Localization of GFP-FtsI proteins in filamentous cells depleted of FtsI was done with transformants of EC812 as described previously (45).
Western blotting. At the time of harvesting cells for fluorescence, a sample of culture was taken and examined by Western blotting. FtsI and GFP-FtsI were detected with anti-FtsI antibody as described previously (45).
Prediction of the TMH by using computer programs.
Residues K11 to G57 of FtsI were analyzed with five programs that predict the location of TMHs:TMpred (http://www.ch.embnet.org/software/TMPRED_form.html) (no documentation published), PHDhtm (http://cubic.bioc.columbia.edu/predictprotein/submit_def.html) (36), HMMTOP (http://www.enzim.hu/hmmtop/) (39), TopPred II (http://www.sbc.su.se/
erikw/toppred2/) (41), and TMHMM (http://www.cbs.dtu.dk/services/TMHMM/) (21). Default settings were used in all cases. The predictions returned were as follows: with TMpred, A25 to W44; with HMMTOP, F24 to I48; with PHDhtm, L26 to W44; with TMHMM, S21 to A43; and with TopPred II, W22 to V42. We also analyzed the full-length FtsI sequences with all five programs and got the following predictions: with TMpred, F24 to L45; with HMMTOP, F19 to L38; with PHDhtm, L26 to A43; with TMHMM, S21 to A43; and with TopPred II, W22 to V42. Note that only HMMTOP gave a significantly different prediction, shifting the TMH by 6 residues depending on how much of FtsI was submitted for analysis. The HMMTOP prediction for the full-length protein is unlikely to be correct, because it is clearly an outlier among the 10 predictions made and, unlike the other programs, is sensitive to how much of the N terminus is included in the analysis. Moreover, if the TMH were to start at F19, then the GFP-FtsI22-577 protein would have two additional charged residues in the TMH (derived from the linker between GFP and FtsI). Unless these residues can "snorkel" to the surface, such a drastic change in the TMH might be expected to compromise the function of the protein; nevertheless, it supports cell division. For these reasons, predictions obtained with the K11-G57 peptide were used to obtain the results shown in Fig. 1.
Molecular modeling of the TMH. Residues W22 to W44 of FtsI were assigned an alpha-helical structure by using Sybyl 6.8 (1999-2001; Tripos, Inc.). Hydrogens were added to the structure, the molecular dictionary was set to "protein," and then a steric minimization was computed by using the following settings: the method was Powell, the initial optimization was simplex, the termination was a gradient of 0.05 kcal/mol · Å, there were 8,000 maximum iterations, and the energy force field was "not in use." Hydrogens were then removed, as were lone-pair electrons from the two cysteines. Files were saved as Brookhaven database files and processed in Protein Explorer (Eric Martz, 2002).
|
|
|---|
40 amino acids and a large periplasmic domain of
500 amino acids. Hydropathy plots revealed a span of 17 consecutive nonpolar amino acids from F24 to G40 that could serve as a TMH (Fig. 1). This hydrophobic span is flanked by Arg 23 and Arg 41, which were considered to define the borders of the TMH in two reports that analyzed the functions of the cytoplasmic domain and TMH by constructing hybrid proteins (8, 16). It is important to note, however, that the borders of the TMH are not known so precisely, and one caution in the interpretation of results obtained with hybrid FtsI proteins is that the domains might not have been replaced as cleanly as intended. To better define the TMH and to get an estimate of the uncertainty involved in that definition, we used five different computer programs that identify transmembrane segments in proteins. Residues K11 to G57 of FtsI were submitted for analysis because one of the programs used gave an unlikely prediction when the full-length protein was analyzed (see Materials and Methods). No two programs predicted exactly the same TMH, but all included the hydrophobic region from L26 to V42 (Fig. 1). Interestingly, all of the programs placed Arg 41 inside the TMH, and two of them included Arg 23 as well. While this phenomenon may seem counterintuitive, studies of membrane proteins and model peptides have revealed that arginines can be accommodated near the end of a TMH because the long side chain allows the positively charged guanidinium group to interact with the phospholipid headgroups, an arrangement called snorkeling (reviewed in reference 20). Several of the algorithms included Trp 22 and/or Trp 44 in the TMH. Aromatic amino acids, especially Trp and Tyr, are often found near the ends of TMHs, where they serve as anchors because the aromatic rings have a preference for the interface between the hydrophobic and hydrophilic phases (reviewed in references 20 and 35).
We conclude from this analysis that the TMH is probably longer than the hydrophobic core defined operationally as the TMH in previous studies (8, 16). The TMH is not likely to be longer than from S21 to I48. Given the evidence that Trp residues are often found at the borders of TMHs, it is tempting to speculate that the TMH extends from Trp 22 to Trp 44, but biochemical approaches will be needed to determine the boundaries of the TMH precisely.
FtsI proteins with truncations of the cytoplasmic domain.
We made a series of deletion constructs that removed progressively increasing amounts of the cytoplasmic domain of FtsI (Fig. 1). The largest deletion, M1 to S21, removed essentially the entire domain, replacing it with GFP and a linker sequence (NNNRK ) followed by the presumed first residue of the transmembrane segment (W22) of FtsI. These constructs were tested for their ability to complement two ftsI(Ts) strains and one FtsI depletion strain. The two temperature-sensitive (TS) strains carry the same ftsI23(Ts) allele (the lesion is Y380
D [M. C. Wissel and D. S. Weiss, unpublished data]). Curiously, one of the TS strains, LMG64, is tighter than the other, EC295. We do not know the reason for this, but EC295 is an MG1655 derivative, and we have observed that several other widely used fts alleles are not as tight when they are moved to an MG1655 background (D. S. Weiss, unpublished data). The LMG64 TS strain is also tighter than the FtsI depletion strain used in these studies, EC812.
All but one of these constructs complemented both ftsI(Ts) strains and the depletion strain when they were expressed at roughly wild-type levels from a lac promoter on a low-copy-number plasmid (Table 1). The exception was the largest deletion, M1 to S21, which, according to one of the computer prediction programs, lacks the first residue of the TMH. This deletion derivative complemented the depletion strain and the EC295 TS mutant but not the more stringent LMG64 TS mutant. Thus, even the largest deletion retained substantial function in cell division.
|
View this table: [in a new window] |
TABLE 1. Characterization of truncated FtsI proteins (fused to GFP)
|
All of the GFP-FtsI derivatives with cytoplasmic domain deletions were tested for septal localization in two genetic configurations. One, referred to here as merodiploid, involves expressing gfp-ftsI fusions at approximately wild-type levels from a low-copy-number plasmid in a strain that also produces FtsI from the native chromosomal gene. This is a stringent test for localization, in that the GFP-FtsI protein has to compete with wild-type FtsI for assembly into the septal ring. The other configuration, called the depletion strain, involves expressing GFP-FtsI derivatives from the same low-copy-number plasmid but in a strain that has been engineered to express a chromosomal ftsI gene under the control of the arabinose-dependent PBAD promoter. Growth on glucose depletes the cells of FtsI and enables us to observe localization of GFP-FtsI derivatives that retain some ability to localize but compete poorly with the wild type. (In principle, the use of these two strains might allow us to detect mutant GFP-FtsI proteins that cannot localize by themselves but can be recruited into the septal ring by the wild-type protein via, for example, formation of an FtsI-GFP-FtsI heterodimer. In practice, however, we have yet to observe better localization in a merodiploid than in a depletion strain.)
Consistent with the complementation results, GFP-FtsI derivatives with deletions of the cytoplasmic domain localized to the septal ring in both tests (Fig. 2; Table 1). Most remarkably, even the GFP-FtsI22-577 protein, which probably lacks the entire cytoplasmic domain, localized in the merodiploid configuration, indicating that it retains enough targeting information to compete effectively with wild-type FtsI for assembly into the septal ring.
![]() View larger version (49K): [in a new window] |
FIG. 2. Localization of GFP-FtsI deletion derivatives. (Large images) Localization of GFP-FtsI in cells depleted of wild-type FtsI; (inset) localization of GFP-FtsI in cells that also contain wild-type FtsI (i.e., an ftsI/gfp-ftsI merodiploid). Numbers refer to the fragment of FtsI fused to GFP. Arrows indicate examples of septal localization. For this experiment, EC812 (FtsI depletion strain) or MC4100 (merodiploid) were transformed with a low-copy-number plasmid that expresses a gfp-ftsI derivative, as indicated. EC812 transformants were grown in LB with 0.2% glucose (to deplete FtsI) and 100 µM IPTG (to induce gfp-ftsI from the plasmid) for 5 h, at which time the cells were fixed and examined by fluorescence microscopy. MC4100 transformants were grown in LB with IPTG (even though MC4100 is lacI negative) and processed similarly. Localization of these mutant proteins was also assayed in DHB4 transformants, with similar results. Like MC4100, DHB4 is wild type for ftsI but carries lacIq.
|
10 s) were needed to photograph both full-length and truncated gfp-ftsI proteins, we suspect that weak localization of, for example, the GFP-FtsI2-47 protein is not simply due to low abundance or inefficient membrane insertion.
Why derivates that lacked most of the periplasmic domain localized poorly compared to full-length FtsI is a matter of conjecture. Periplasmic sequences might affect the conformation of the TMH, or they might engage other division proteins and contribute to septal localization. The domain of unknown function has been suggested to be a site of interaction with other division proteins (27, 33). These interactions may help recruit FtsI to the septal ring, enable FtsI to recruit downstream proteins such as FtsN, and/or regulate the catalytic (transpeptidase) activity of FtsI. Previously, we described several single-amino-acid substitutions in the domain of unknown function that cause subtle localization defects in a merodiploid (
2-fold) (45). Together with the larger defect seen when the entire domain is deleted, it seems likely that the domain of unknown function contributes to septal localization, but we doubt that it is the primary targeting signal in FtsI. In this context, it is worth noting that our lab has described amino acid substitutions in the domain of unknown function that impair localization of the next protein in the recruitment hierarchy, FtsN (45).
While this work was in progress, Piette et al. also reported the localization of GFP-FtsI proteins with progressive deletions of the periplasmic domain (34). Their findings and ours are in general agreement. One notable difference is that they observed localization when residues up to Val 42 were deleted from FtsI (i.e., GFP-FtsI2-42), whereas the protein with the largest deletion that localized in our studies was truncated at Val 47 (i.e., GFP-FtsI2-47). Another difference was that Piette et al. were able to verify expression of their truncated proteins by Western blotting with anti-GFP the antibody. We think both differences can be attributed to higher levels of expression of gfp-ftsI alleles in the study of Piette et al., as they employed a higher-copy-number plasmid with a stronger promoter and a stronger ribosome binding site.
Localization of the TMH. We combined cytosolic and periplasmic domain deletions and found that a 26-amino-acid fragment extending from W22 to V47 localized in cells depleted of wild-type FtsI (Fig. 2). This fragment localized poorlythe fluorescent bands tended to be faint, and only some of the septal rings in the depletion filaments were decorated as indicated by the low number of rings per unit of cell length (Table 1). Because the filaments were smooth (i.e., the fluorescent GFP-FtsI22-47 bands were not associated with indentations), we do not think that residual native FtsI recruited the GFP-FtsI22-47 protein to these sites. On the contrary, our data imply that GFP-FtsI22-47 competes with native FtsI for septal localization and that the short fragment localizes by the same mechanism as that used by authentic FtsI. The fact that there is competition helps rule out the possibility that localization of the fragment is some sort of artifact.
The W22 to V47 fragment corresponds very well with the TMH (Fig. 1). The fact that the isolated TMH can localize at all underscores its importance as a targeting signal. Our lab has previously identified amino acid substitutions that cause large (
8-fold) defects in septal localization of full-length FtsI (45). Strikingly, all of these lesions fall within the fragment that we have now shown is sufficient to target GFP to the septal ring (Fig. 1).
Alanine-scanning mutagenesis. To identify TMH residues important in septal localization, we performed alanine-scanning mutagenesis on the region from W22 to V47 (in the context of a GFP fusion to full-length FtsI). When expressed at wild-type levels from a low-copy-number plasmid, all but two of the alanine substitution alleles complemented two ftsI(Ts) strains and an FtsI depletion strain (Table 2). The exceptions were R23A and L45A, which failed to complement in any background. Western blotting with anti-FtsI antibody revealed that the L45A protein was truncated (Fig. 3), presumably by leader peptidase. The L45A substitution creates an Ala-Trp-Ala sequence near the periplasmic end of the TMH, which matches the Ala-X-Ala cleavage site recognized by leader peptidase (42). Why the R23A protein failed to support division is not obvious. While this substitution caused a localization defect, the R23A protein localized better than the I31A mutant protein that nevertheless rescued division. R23 was previously identified as a residue important for FtsI function and septal localization (Fig. 1) (45).
|
View this table: [in a new window] |
TABLE 2. Alanine-scanning mutagenesis of GFP-FtsI
|
![]() View larger version (50K): [in a new window] |
FIG. 3. Expression of alanine-scanning derivatives of GFP-FtsI. DHB4 transformants were grown in LB with 100 µM IPTG to an optical density at 600 nm of 0.3 and then harvested for analysis by Western blotting with anti-FtsI antibody. The first lane on each blot is the vector, pDSW729, which expresses gfp alone. The second lane is pDSW521, which expresses the gfp-ftsI wild type. The remaining lanes show alanine-scanning derivatives of pDSW521, as indicated by the residue changed to alanine. Two prominent breakdown products of GFP-FtsI are indicated on the right with an asterisk.
|
Some of the critical residues are near the borders of the TMH (R23, R41, W43, and Q46). These residues are likely to be important for positioning the helix properly in the membrane, so lesions here might impair localization indirectly. The remaining critical residues probably lie in the hydrophobic core (F24, L27, I31, L35, and L39). Models of the TMH indicate that these residues are on the same face of the alpha-helix (Fig. 4). We propose that this surface of the TMH interacts with a helix from another membrane protein. A likely candidate is FtsW, which has 10 TMHs (13, 23) and is, according to the recruitment hierarchy, the protein that recruits FtsI to the septal ring (28).
![]() View larger version (19K): [in a new window] |
FIG. 4. Proposed structure of the localization helix. (A) Model of TMH residues W22 to W44 as an alpha-helix. Residues identified by alanine scanning as important for septal localization are indicated with arrows. Amino acids are color coded as follows: red indicates Arg; blue indicates Phe; light gray indicates Gly; dark gray indicates Ala; yellow indicates Cys; green indicates Leu, Val, and Ile; and purple indicates Trp. Because the modeling software assumes an aqueous environment, the side chain of Arg 41 points down. This alignment places the positively charged guanidinium moiety inside the lipid bilayer. More likely, the side chain points up so that the guanidinium can interact with the lipid phosphate groups. (B) Helical wheel diagram of W22 to L39. Boxes highlight hydrophobic residues from F24 to L39 that were identified by alanine scanning as important for septal localization. Note that these residues fall on one face of the helix.
|
Intragenic suppression of an insertion in the TMH of FtsI. Insertion of a single Leu residue between G40 and R41 lengthens the hydrophobic core of the TMH by 1 residue and results in a loss of function in cell division (16). The mutant protein, referred to herein as FtsI+L41, is stable as determined by Western blotting. Using a fusion to GFP, we found that the Leu insertion prevents septal localization either in a merodiploid (not shown) or in filamentous cells depleted of wild-type FtsI (Fig. 5).
![]() View larger version (39K): [in a new window] |
FIG. 5. Localization of GFP-FtsI+L41 and GFP-FtsIL33P,+L41. EC812 transformants carrying pDSW658 or pDSW659 were grown for 5 h in LB with 0.2% glucose (to deplete FtsI) and 100 µM IPTG (to induce the gfp-ftsI derivative) and then fixed and examined by fluorescence microscopy. Arrows indicate fluorescent bands indicative of septal localization.
|
We mutagenized a plasmid-borne ftsI+L41 allele by PCR. Plasmids were transformed into an ftsI(Ts) strain, which was plated at either 30°C to determine transformation efficiency or 42°C to select for suppressors. Out of an estimated
70,000 transformants plated at 42°C, 26 colonies were obtained. All appeared phenotypically similar upon restreaking. Three isolates that arose from independent PCRs were characterized further. All had the same mutation, T98
C, which changes Leu 33 to Pro. As expected, all three isolates retained the extra Leu codon in the parental allele. Changing Leu 33 to Pro is expected to bend the alpha-helix (35), which might restore the helix more closely to its proper length despite the presence of the extra leucine. A GFP fusion was then constructed and used to test for septal localization. GFP-FtsIL33P,+L41 did not localize in a merodiploid (data not shown) but did localize when cells were depleted of wild-type FtsI (Fig. 5). Note that the depletion strain did not become filamentous in this experiment because the mutant GFP-FtsI protein supports division.
The location of the suppressor mutation suggests that the primary effect of the original leucine insertion was manifested locally (i.e., in the TMH itself) rather than at a remote site (i.e., the domain of unknown function). Given that there are several leucines in the TMH that could be changed to proline by a single nucleotide substitution, one wonders why only the L33P lesion was recovered. Perhaps bends introduced at other sites do not restore function; even if these bends also shorten the helix, they might not permit the TMH to make a precise fit with the presumed target TMH to which it binds.
Requirements for TMHs in localization of other proteins. The results of this and other studies (34, 45) establish that the TMH of FtsI is directly involved in targeting FtsI to the septal ring. Alignments of FtsI proteins from several bacterial species indicate that the length of the TMH is well conserved, as indicated by the spacing of the two arginines that flank the hydrophobic core, but the sequence of the hydrophobic core is not conserved (data not shown). Thus, we see no evidence of a targeting motif that might be shared among different Fts proteins. Moreover, studies of the bitopic membrane proteins that localize to the septal ring in E. coli have shown that targeting information can reside in a variety of domainscytoplasmic, TMH, or periplasmic (Fig. 6). The lack of a conserved targeting motif is consistent with the notion that division proteins localize by a cascade of protein-protein interactions rather than by binding to a common target in the septal ring. Nevertheless, it is interesting that FtsA and ZipA do not appear to share a targeting motif even though each protein binds the C-terminal tail of FtsZ (11, 17, 18, 24, 26, 29, 30).
![]() View larger version (15K): [in a new window] |
FIG. 6. Targeting domains in bitopic membrane proteins needed for cell division in E. coli. For clarity, proteins are not drawn to scale. Regions sufficient for septal localization are shown in black, while regions known to be dispensable are in white. FtsB has not been studied with respect to this function and is shown in gray. Even where targeting information has been studied, only a few constructs have been evaluated in some cases, so further work may narrow the localization determinant to a smaller protein fragment than indicated here. Previous reports and the present study were the sources of information for localization determinants ZipA (17), FtsQ (7), FtsL (14), FtsI (this study), and FtsN (8).
|
We think that it is unusual for a TMH to target a protein to a site more specific than the membrane. Besides FtsI, the only example of which we are aware involves several bitopic membrane proteins that localize to the Golgi apparatus of eukaryotes (reviewed in reference 31). These proteins have short transmembrane helices (
15 hydrophobic residues) compared to those of proteins found in the plasma membrane (
20 hydrophobic residues), and it is the length rather than the sequence of these short TMHs that appears to be important for proper localization. Golgi apparatus membranes contain little cholesterol and are therefore thinner than the plasma membrane, which is
50% cholesterol (40). It has been proposed that short TMHs target certain proteins to the Golgi apparatus by matching the thickness of the bilayer to the length of the TMH (reference 6, but see also reference 25). In contrast to the situation with Golgi body proteins, at least one of which can localize properly if it is given a polyleucine TMH of the appropriate length (32), our studies of FtsI indicate that the sequence of the TMH is important for septal localization. This finding suggests that the TMH targets FtsI to the septal ring by binding to another protein rather than partitioning passively into a region where the lipid bilayer has unique properties.
This work was supported by a grant from the National Institutes of Health (GM59893) to D.S.W., start-up funds from the University of Iowa, and a donation from the Bruning Foundation. The DNA facility is supported by the Diabetes and Endocrinology Research Center with National Institutes of Health grant DK25295 and by the School of Medicine.
Present address: Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, Kansas City, KS 66160. ![]()
Present address: ConjuGon, Inc., Madison, WI 53719. ![]()
Present address: 416 Mozart Court, Wheaton, IL 60187. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»