Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delgado, M. A. Articles by Salomón, R. A. Search for Related Content PubMed PubMed Citation Articles by Delgado, M. A. Articles by Salomón, R. A.

 Previous Article  |  Next Article 

Journal of Bacteriology, May 2005, p. 3465-3470, Vol. 187, No. 10
0021-9193/05/$08.00+0     doi:10.1128/JB.187.10.3465-3470.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

YojI of Escherichia coli Functions as a Microcin J25 Efflux Pump

Mónica A. Delgado, Paula A. Vincent, Ricardo N. Farías, and Raúl A. Salomón^*

Departamento de Bioquímica de la Nutrición, Instituto Superior de Investigaciones Biológicas (Consejo Nacional de Investigaciones Científicas y Técnicas-Universidad Nacional de Tucumán), and Instituto de Química Biológica "Dr. Bernabé Bloj," Chacabuco 461, 4000 San Miguel de Tucumán, Tucumán, Argentina

Received 28 October 2004/ Accepted 2 February 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present study, we showed that yojI, an Escherichia coli open reading frame with an unknown function, mediates resistance to the peptide antibiotic microcin J25 when it is expressed from a multicopy vector. Disruption of the single chromosomal copy of yojI increased sensitivity of cells to microcin J25. The YojI protein was previously assumed to be an ATP-binding-cassette-type exporter on the basis of sequence similarities. We demonstrate that YojI is capable of pumping out microcin molecules. Thus, one obvious explanation for the protective effect against microcin J25 is that YojI action keeps the intracellular concentration of the peptide below a toxic level. The outer membrane protein TolC in addition to YojI is required for export of microcin J25 out of the cell. Microcin J25 is thus the first known substrate for YojI.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Microcin J25 (MccJ25) is a plasmid-encoded, 21-amino-acid antibacterial peptide produced by Escherichia coli (4, 21). It is active against E. coli, Salmonella, and Shigella. Four genes (mcjA, mcjB, mcjC, and mcjD) are required for MccJ25 synthesis, export, and immunity (26, 27). mcjA encodes the primary structure of MccJ25 as a 58-amino-acid precursor, from which a 37-amino-acid N-terminal leader is removed. The 21-residue mature peptide has a compact, extraordinary structure, which consists of an eight-residue lariat ring and a C-terminal tail which folds on itself and passes through the ring, where it is sterically trapped (2, 19, 30). The mcjB and mcjC gene products are involved in this assembly process (27). The mcjD product has a dual role. It works as a dedicated ATP-binding cassette (ABC) exporter of MccJ25 and, at the same time, by ensuring rapid secretion from the cytoplasm, protects cells from endogenous MccJ25 synthesized in producer cells, as well as from the exogenous microcin that gains entry (27).

MccJ25 intake is mediated by the outer membrane receptor FhuA and the inner membrane proteins TonB, ExbB, ExbD, and SbmA (22, 23). E. coli RNA polymerase is the target of antibiotic action (7, 31). The binding site for MccJ25 is located in the secondary channel of the enzyme (1, 16), which provides a route by which the nucleotide substrates reach the catalytic site. Thus, MccJ25 inhibits transcription by clogging the channel and blocking the access of substrates to the active center (1, 16).

In the course of experiments aimed at cloning an MccJ25-resistant mutation, we found a recombinant plasmid able to confer resistance to the antibiotic, but, unexpectedly, this plasmid did not contain the mutation. Analysis of this plasmid led to the identification of a previously described chromosomal locus, yojI, which, when present in multiple copies, protected cells from MccJ25. Gene disruption experiments showed that a protective effect against MccJ25 was exerted by the single-copy chromosomal gene yojI. On the basis of sequence similarities, yojI had been assumed to encode an ABC-type exporter (18). Here we provide evidence which strongly suggests that the resistance to MccJ25 mediated by YojI involves extrusion of the peptide and that YojI is assisted by the multifunctional outer membrane protein TolC.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains and growth conditions. The E. coli K-12 strains and plasmids used in this work are described in Table 1. P1 vir transduction was used to introduce the tolC::Tn10 allele into MC4100 and MG1655. The rich and minimal media used in this work were Luria broth (LB) and M9 minimal salts with 0.2% glucose (15), respectively. Solid media contained 1.5% agar. Antibiotics were added, when required, at the following final concentrations: ampicillin, 50 µg/ml; chloramphenicol, 30 µg/ml; and tetracycline, 10 µg/ml. Incubations were done at 37°C except for strains bearing the mini-Mu plasmid pEG109 and its derivative pCLO4, which were grown at 30°C.

View this table: [in this window] [in a new window]

TABLE 1. E. coli strains and plasmids used in this work

Sensitivity test and bioassay of microcin activity. Sensitivity to MccJ25 was tested by a spot-on-lawn assay, as follows. Doubling dilutions of a purified MccJ25 preparation were spotted (10 µl) onto LB plates and dried. Aliquots (50 µl) of cultures to be tested for sensitivity, in the stationary phase, were mixed with 3 ml of top agar (LB containing 0.7% agar) and overlaid onto the plates. After overnight incubation, the plates were examined for different degrees of inhibition.

To test a strain's ability to produce extracellular MccJ25, it was grown on solid LB medium, and a fresh colony was stabbed with a toothpick into the assay plate, which contained M9 medium. After 6 h or 24 h of growth at 37°C, cells were killed with chloroform. The plates were then overlaid with approximately 10⁸ sensitive indicator cells in 3 ml of soft agar. The presence of excreted microcin was indicated by a zone of growth inhibition in the lawn of indicator cells surrounding the stabbed colony.

In vivo DNA cloning. In vivo cloning was done by introducing the mini-MudII4042-containing plasmid pEG109 (12) into strain SBG231 Mucts. Transformed chloramphenicol-resistant cells were grown and heated at 42°C to induce transposition during phage replication, and strain pop3001.6 was infected with the resulting lysate. Transductants were selected on LB containing chloramphenicol and MccJ25, purified on the same medium, and then rechecked for MccJ25 resistance.

Recombinant DNA methods. Plasmid DNA was isolated with the Wizard miniprep DNA purification system (Promega). Digestion with restriction endonucleases, ligation with T4 DNA ligase, transformation of competent cells by the CaCl₂ procedure, and agarose gel electrophoresis were done as described previously (24). Automated DNA sequencing was carried out by dideoxy termination (25). Database searches and sequence alignments were performed with the online BLAST Network Service at the National Center for Biotechnology Information, National Institutes of Health, Bethesda, Md. Restriction enzymes and DNA ligase were purchased from New England Biolabs.

Construction of a yojI chromosomal deletion. Deletion of the yojI gene was performed by use of the one-step chromosomal gene inactivation method described by Datsenko and Wanner (6). This technique uses the highly efficient phage Red recombination system encoded on the helper plasmid pKD46 and direct transformation of PCR products consisting of the cat marker gene with extensions identical to the sequences flanking the region targeted for deletion. E. coli strain DH5yojI::cat was constructed by transforming strain DH5 carrying the Red helper plasmid pKD46 (6) with a PCR product generated by using plasmid pKD3 (6) as the template with primers P1YojI (CTGCGGGCTGTAATTCATTGTCCGGGTTTTCTGCTGTAGGCTGGAGCTGCTTC) and P2YojI(GACGGCAGCAGTCCGCCAGGTCAGCGTCGTAATACATATGAATATCCTCCTTAG). These primers included 18 and 20 nucleotides (nt) of priming sites 1 and 2, respectively, of pKD3 and 35-nt homologous extensions flanking the 5' and 3' ends of the yojI gene. Transformants were selected at 37°C on LB agar containing chloramphenicol. Homologous recombination between the genomic DNA and the PCR product resulted in precise deletion of the entire coding region of yojI and replacement of this region with the cat gene. Represen-tative gene disruption mutants gave a new fragment of the expected size (300 bp) in a PCR test using the locus-specific primer P3YojI (CCATCGACTGCCGCTACAACC), located 129 nt upstream the start codon of yojI, and the cat-specific primer c1 (TTATACGCAAGGCGACAAGG) (6). The same primer combination gave negative results with parental strain DH5.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cloning of an E. coli K-12 chromosomal gene that confers resistance to MccJ25 when multiple copies of it are present. Most spontaneous MccJ25-resistant mutants affect outer and inner membrane components involved in MccJ25 intake (22, 23). In an attempt to identify the MccJ25 intracellular target, we isolated a novel spontaneous MccJ25-resistant mutant of E. coli K-12, designated SBG231. Genetic analysis located the mutation at 90 min on the E. coli genetic map. To clone the mutated gene, a mini-MudII4042 library was made by thermoinduction of strain SBG231 Mucts(pEG109), as described by Groisman et al. (12), and used to transduce strain pop3001.6. The rationale was that overexpression of the mutant gene would lead to microcin resistance. Transductants were selected on minimal medium supplemented with chloramphenicol and MccJ25. It was expected that only cells transformed with recombinant plasmids containing the mutation would grow. Plasmid DNA was extracted from one of four MccJ25-resistant clones and retransformed into pop3001.6 cells. Cells that received the plasmid, designated pCLO4, became resistant to a high MccJ25 concentration (1 mg/ml), while transformants with the control pEG109 plasmid were fully sensitive. A restriction map of pCLO4 showed that it included approximately 14 kb from the E. coli chromosome (Fig. 1). Unexpectedly, when we compared the physical map of the fragment cloned in pCLO4 with that of E. coli K-12 (20), no similarity was detected in the 90-min region. Instead, we found an overlap in the 49-min area. In fact, the fragment carried by pCLO4 was located at approximately 2,304 to 2,318 kb of the E. coli genome (3). This was interpreted to mean that a wild-type locus, and not the mutation we were seeking, was cloned from strain SBG231, which, when present in multiple copies, provided microcin resistance. (Cloning of the mutation at 90 min was achieved by a different approach and established that the RNA polymerase ß' subunit is the MccJ25 target [7].)

View larger version (12K): [in this window] [in a new window]

FIG. 1. (A) Overview of the E. coli genomic region containing yojI. (B) Restriction map and genetic organization of the E. coli chromosomal fragment cloned in pCLO4 (thick line). The relevant portion of the mini-Mu plasmid used for in vivo cloning is represented by the open box. Below the map, the horizontal lines indicate the pCLO4 segments carried by pUC18 derivatives used in this study. Relevant restriction sites are indicated (B, BamHI; H, HindIII; P, PstI; S, SalI; M, SmaI).

Subcloning of the MccJ25 resistance determinant. Cells containing pCLO4 formed extremely mucoid colonies. This was possibly due to overexpression of rcsB, a gene encoding a positive regulator of colanic acid synthesis (10, 13), which should be encompassed by the segment cloned in pCLO4 (Fig. 1). It was possible that the colanic acid capsule was responsible for the resistance to MccJ25 because it opposed a permeability barrier to antibiotic entry. This possibility was excluded, however, since a subclone of pCLO4 harboring rcsB (pCLO5 in Fig. 1) led to the mucoid phenotype but not to MccJ25 resistance. To identify the locus in pCLO4 responsible for MccJ25 resistance, additional subclones of this plasmid in the vector pUC18 were constructed. Two of them, pCLO6 and pCLO7 (Fig. 1), were able to confer MccJ25 resistance when they were transformed into DH5 cells. In particular, the 4.2-kb PstI-SmaI insert in pCLO7 should have encompassed only a single complete chromosomal open reading frame (ORF), yojI, flanked by a truncated alkB gene and 1.7 kb from the left end of the mini-Mu vector (Fig. 1). Sequencing of the ends of the insert and restriction analysis confirmed this organization. These results established that yojI is responsible for MccJ25 resistance.

Recently, Nishino and Yamaguchi (17) constructed a library of 37 E. coli ORFs assumed to be drug transporter genes on the basis of sequence similarities (18), including seven putative ABC-type ORFs. Among the latter were yojI and the adjacent ORF yojH. Although yojH was first assumed to be a drug resistance gene on the basis of its membrane topology, its product is actually a membrane-associated malate dehydrogenase and the gene has been renamed mqo (28) (Fig. 1A). Plasmids pUCyojIH, pTrcHyojI, and pTrcHyojH from Nishino and Yamaguchi's library were transformed into DH5, and the transformants were tested for their resistance to MccJ25. We added 0.1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) to agar plates when we examined the susceptibility to MccJ25 of cells harboring the pTrc6His derivatives pTrcHyojI and pTrcHyojH. Cells carrying either pTrcHyojI or pUCyojIH, both of which express YojI, showed complete resistance to MccJ25 (no inhibition halos were detected in a spot-on-lawn test). As expected, synthesis of YojH alone from pTrcHyojH (used as a control) did not lead to resistance. These results confirmed that overexpression of yojI confers MccJ25 resistance.

YojI mediates export of MccJ25. One obvious explanation for the protective effect of YojI against MccJ25 is that it is capable of pumping out MccJ25 molecules, which would keep the intracellular concentration of the peptide below a toxic level. To prove this hypothesis, we tested whether YojI could substitute for McjD, the natural MccJ25 exporter, in secreting MccJ25. We subcloned a 4-kb HindIII-HincII fragment from plasmid pTUC203 (26) into pACYC184. This fragment carries the MccJ25 synthesis genes, mcjABC, but lacks the mcjD sequences encoding the C-terminal 117 amino acids of McjD, including the essential Walker B motif of the ABC exporter. The resulting plasmid, named pTUC348, was expected to be lethal to cells, since in the absence of a functional McjD the MccJ25 peptide would accumulate in host cells and kill them. Therefore, it was transformed into E. coli DH5 carrying pJS300 (26), a pUC18 derivative expressing McjD. When a mixture of plasmids pTUC348 (chloramphenicol resistant) and pJS300 (ampicillin resistant) was transformed into DH5 cells, selecting only for chloramphenicol resistance, all transformants which appeared were also ampicillin resistant, consistent with absolute coselection for the immunity plasmid pJS300. This expected result indicated that pTUC348 could not be propagated in the absence of an immunity gene. When the plasmid preparation with both pTUC348 and pJS300 was transformed into strain SBG231, containing an MccJ25-resistant RNA polymerase (7), clones harboring only pTUC348 were obtained. These transformants grew normally, indicating that the mutation overcame the inhibitory effect of accumulated internal MccJ25, but they were unable to give growth inhibition halos on an MccJ25-sensitive indicator strain (Fig. 2A). Introduction of a second plasmid containing either mcjD (pJS300) or yojI (pCLO7) rescued the MccJ25 secretion phenotype, as shown by the inhibition zones (Fig. 2B and C). This result indicated that YojI was able to export MccJ25 out of the cells.

View larger version (108K): [in this window] [in a new window]

FIG. 2. Biossay for MccJ25 export by YojI. Microcin-resistant strain SBG231 transformed with pTUC348 (A), pTUC348 and pJS300 (mcjD+) (B), and pTUC348 and pCLO7 (yojI+) (C) was assayed for production of extracellular MccJ25. Plasmid pTUC348 directs MccJ25 synthesis but lacks the functional MccJ25 export-immunity gene mcjD. Two independent transformants were stabbed (black dots) in each row and pregrown for 6 h before they were overlaid with a lawn of sensitive cells and incubated overnight at 37°C.

As noted above, under these assay conditions (6 h of pregrowth before overlaying with indicator cells) strain SBG231(pTUC348) did not produce a detectable zone of inhibition. However, after the cells were pregrown overnight, a 0.5-cm halo was visible (results not shown). This relatively low-level secretion of MccJ25 may be explained by the presence in SBG231 of the single chromosomal copy of yojI.

TolC is required for microcin J25 secretion by YojI. ABC-type exporters usually function together with a membrane fusion protein (MFP), anchored to the inner membrane by either a single hydrophobic -helix or a covalent lipid moiety, and an outer membrane channel, so that the pumped-out molecules do not accumulate in the periplasm (9). The yojI gene does not appear to be associated with any gene coding for an MFP, but it is possible that YojI may interact with a member of the MFP family and an outer membrane channel encoded elsewhere on the chromosome. It is noteworthy that McjD, the dedicated exporter of MccJ25, is believed to form a microcin export complex with TolC, but so far, no MFP constituent has been identified for this system (8). We presumed that TolC might also serve as the channel for the YojI efflux system. If so, the increased MccJ25 resistance seen in strains harboring pCLO7 (yojI⁺) would be negated by a tolC mutation. To test this hypothesis, a tolC::Tn10 insertion mutation was transduced into MC4100(pCLO7), and transductants were examined for resistance to MccJ25. The tolC mutation completely eliminated the MccJ25 resistance phenotype. In addition, when the tolC null allele was transduced into SBG231(pTUC348, pCLO7), microcin excretion was abolished. Again, it was necessary to use the microcin-resistant SBG231 background for this assay, since the accumulated microcin kills a TolC^– MccJ25-producing cell. These results strongly suggest that TolC and YojI are components of an efflux complex that uses MccJ25 as a substrate.

Disruption of either tolC or yojI genes leads to increased sensitivity to MccJ25. We have long noticed that in twofold serial dilution assays on LB plates with several E. coli K-12 strains as indicators (including the widely used strains MC4100, MG1655, and DH5), MccJ25 gives rise to turbid zones of growth inhibition, except for the first two or three dilutions, which produce clear halos with cloudy edges. As described previously (21), exposure of sensitive cells to MccJ25 results in filamentous growth. Microscopic observation during formation of a turbid zone of growth inhibition revealed that the cells gradually elongated over the first few hours of incubation. However, most of the filaments recovered and finally developed into colonies, which explains the final turbid appearance. These observations suggested that E. coli strains have intrinsic partial resistance to MccJ25. In light of the results described above, it was tempting to speculate that this phenotype results from removal of MccJ25 from the cells by the YojI-TolC complex. If so, one would predict that disruption of either tolC or yojI would make E. coli cells more sensitive to MccJ25. To test this hypothesis, a tolC::Tn10 mutation was transduced into MC4100 and MG1655, and the strains were examined for sensitivity to MccJ25 in a spot-on-lawn test. The tolC derivatives were at least fourfold more sensitive to exogenous MccJ25 than their wild-type parental strains and gave completely clear spots. Microscopic examination of the halos revealed only isolated cells or short filaments dispersed all over the transparent zones. Apparently, the effect of MccJ25 on the tolC mutant cells was so disruptive that growth and division ceased without any gross changes in morphology. Introduction of plasmid pAX629, which carries a cloned copy of the wild-type tolC gene (14), into the tolC mutants restored the phenotype of the parent strains, showing that the effect of the tolC mutation on MccJ25 sensitivity is due to inactivation of the tolC gene itself rather than to the possible polarity of the insertion mutation on the expression of a downstream gene.

Next, we compared the resistance to MccJ25 of wild-type and yojI cells. To this end, the chromosomal yojI gene of strain DH5 was deleted by the method of Datsenko and Wanner (6), as described in Materials and Methods. A yojI strain displayed increased susceptibility to MccJ25. In a spot-on-lawn test it was approximately eightfold more sensitive than the control strain DH5 and showed completely clear zones of growth inhibition (Fig. 3).

View larger version (70K): [in this window] [in a new window]

FIG. 3. Susceptibility of the yojI mutant as quantitated by the critical dilution method. Twofold serial dilutions of MccJ25 were spotted on LB plates. After the spots dried, the plates were overlaid with a suspension of control DH5 cells (top) and DH5yojI cells (bottom). The numbers indicate the reciprocal of each dilution. The MccJ25 titer (i.e., the last dilution giving a halo) was 1:64 for the control (turbid spots) and 1:512 for the YojI-defective mutant (clear halos).

Taken together, the results described above support the concept that yojI is functional when a single copy is present and that, acting in concert with tolC, it is an important determinant of the baseline resistance of E. coli cells to MccJ25.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The main findings of the present study are as follows. (i) Overexpression of yojI confers increased resistance to MccJ25 and is correlated with an increased efflux of the antibiotic. Note that the plasmid-encoded immunity to MccJ25 is based on such a mechanism. (ii) Efflux of and resistance to microcin J25 mediated by YojI are dependent upon the outer membrane channel TolC. Therefore, it is likely that these proteins form a complex for MccJ25 excretion. (iii) We experimentally validated for the first time the previous inference (based on sequence homologies) that YojI is an exporter. (iv) Disruption of either the tolC or yojI gene renders E. coli K-12 cells more susceptible to MccJ25. This may be explained by assuming that either mutation results in loss of the efflux process, leading to an increase in the intracellular concentration of microcin. And (v) The yojI mutant was viable, indicating that yojI is not an essential gene.

MccJ25 is the first substrate known for the YojI pump. Although the normal biological role of YojI is not yet understood, obviously it cannot be transport of MccJ25. The specificity of YojI is not known, but it was shown that overproduction of YojI did not alter the resistance to any of 26 representative antimicrobial agents and chemical compounds translocated by AcrAB or other major drug transporters (17). This suggests that it could be quite specific in its choice of substrate. Given the peptide nature of MccJ25, it is possible that YojI recognizes peptide compounds as substrates for transport.

 
We thank Mary Berlin (at the E. coli Genetic Stock Center), Felipe Moreno, and Akihito Yamaguchi for generosity in providing bacterial strains and plasmids.

This work was supported by grants from Agencia Nacional de Promoción Científica y Tecnológica (grant PICT 2003 01-17819) and Consejo de Investigaciones de la Universidad Nacional de Tucumán (grant 26/D235). M.A.D. was supported by a CONICET fellowship. R.A.S., P.A.V., and R.N.F. are career investigators of CONICET.

 
* Corresponding author. Mailing address: Departamento de Bioquímica de la Nutrición, INSIBIO, Chacabuco 461, 4000 San Miguel de Tucumán, Argentina. Phone and fax: (54) (381) 4248921. E-mail: salomon{at}fbqf.unt.edu.ar.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Adelman, K., J. Yuzenkova, A. LaPorta, N. Zenkin, J. Lee, J. T. Lis, S. Borukhov, M. D. Wang, and K. Severinov. 2004. Molecular mechanism of transcription inhibition by peptide antibiotic microcin J25. Mol. Cell 14:753-762.[CrossRef][Medline]
2
2. Bayro, M. J., J. Mukhopadhyay, G. V. T. Swapna, J. Y. Huang, L.-C. Ma, E. Sineva, P. E. Dawson, G. T. Montelione, and R. H. Ebright. 2003. Structure of antibacterial peptide microcin J25: a 21-residue lariat protoknot. J. Am. Chem. Soc. 125:12382-12383.[CrossRef][Medline]
3
3. Blattner, F. R., G. Plunkett, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. F. McGregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453-1474.[Abstract/Free Full Text]
4
4. Blond, A., J. Péduzzi, C. Goulard, M. J. Chiuchiolo, M. Barthélémy, Y. Prigent, R. A. Salomón, R. N. Farías, F. Moreno, and S. Rebuffat. 1999. The cyclic structure of microcin J25, a 21-residue peptide antibiotic from Escherichia coli. Eur. J. Biochem. 259:747-755.[Medline]
5
5. Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:1141-1156.[Abstract/Free Full Text]
6
6. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
7
7. Delgado, M. A., M. R. Rintoul, R. N. Farías, and R. A. Salomón. 2001. Escherichia coli RNA polymerase is the target of the cyclopeptide antibiotic microcin J25. J. Bacteriol. 183:4543-4550.[Abstract/Free Full Text]
8
8. Delgado, M. A., J. O. Solbiati, M. J. Chiuchiolo, R. N. Farías, and R. A. Salomón. 1999. Escherichia coli outer membrane protein TolC is involved in the production of the peptide antibiotic microcin J25. J. Bacteriol. 181:1968-1970.[Abstract/Free Full Text]
9
9. Dinh, T., I. T. Paulsen, and M. H. Saier, Jr. 1994. A family of extracytoplasmic proteins that allow transport of large molecules across the outer membranes of gram-negative bacteria J. Bacteriol. 176:3825-3831.[Abstract/Free Full Text]
10
10. Gottesman, S., P. Trisler, and A. Torres-Cabassa. 1985. Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes. J. Bacteriol. 162:1111-1119.[Abstract/Free Full Text]
11
11. Grant, S. G. N., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc. Natl. Acad. Sci. USA 87:4645-4649.[Abstract/Free Full Text]
12
12. Groisman, E. A., B. A. Castilho, and M. J. Casadaban. 1984. In vivo DNA cloning and adjacent gene fusing with a mini-Mu-lac bacteriophage containing a plasmid replicon. Proc. Natl. Acad. Sci. USA 81:1480-1483.[Abstract/Free Full Text]
13
13. Gupte, G., C. Woodward, and V. Stout. 1997. Isolation and characterization of rcsB mutations that affect colanic acid capsule synthesis in Escherichia coli K-12. J. Bacteriol. 179:4328-4335.[Abstract/Free Full Text]
14
14. Hiraga, S., H. Niki, T. Ogura, C. Ichinose, H. Mori, B. Ezaki, and A. Jaffé. 1989. Chromosome partitioning in Escherichia coli: novel mutants producing anucleate cells. J. Bacteriol. 173:1496-1505.
15
15. Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
16
16. Mukhopadhyay, J., E. Sineva, J. Knight, R. M. Levy, and R. H. Ebright. 2004. Antibacterial peptide microcin J25 inhibits transcription by binding within and obstructing the RNA polymerase secondary channel. Mol. Cell 14:739-751.[CrossRef][Medline]
17
17. Nishino, K., and A. Yamaguchi. 2001. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J. Bacteriol. 183:5803-5812.[Abstract/Free Full Text]
18
18. Paulsen, I. T., M. K. Sliwinski, and M. H. Saier, Jr. 1998. Microbial genome analyses: global comparisons of transport capabilities based on phylogenies, bioenergetics and substrate specificities. J. Mol. Biol. 277:573-592.[CrossRef][Medline]
19
19. Rosengren, K. J., R. J. Clark, N. L. Daly, U. Goransson, A. Jones, and D. J. Craik. 2003. Microcin J25 has a threaded side chain-to-backbone ring structure and not a head-to-tail cyclized backbone. J. Am. Chem. Soc. 125:12464-12474.[CrossRef][Medline]
20
20. Rudd, K. E. 1998. Linkage map of Escherichia coli K-12, edition 10: the physical map. Microbiol. Mol. Biol. Rev. 62:985-1019.[Abstract/Free Full Text]
21
21. Salomón, R. A., and R. N. Farías. 1992. Microcin 25, a novel antimicrobial peptide produced by Escherichia coli. J. Bacteriol. 174:7428-7435.[Abstract/Free Full Text]
22
22. Salomón, R. A., and R. N. Farías. 1993. The FhuA protein is involved in microcin 25 uptake J. Bacteriol. 175:7741-7742.[Abstract/Free Full Text]
23
23. Salomón, R. A., and R. N. Farías. 1995. The peptide antibiotic microcin 25 is imported through the TonB pathway and the SbmA protein. J. Bacteriol. 177:3323-3325.[Abstract/Free Full Text]
24
24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
25
25. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.[Abstract/Free Full Text]
26
26. Solbiati, J. O., M. Ciaccio, R. N. Farías, and R. A. Salomón. 1996. Genetic analysis of plasmid determinants for microcin 25 production and immunity. J. Bacteriol. 178:3661-3663.[Abstract/Free Full Text]
27
27. Solbiati, J. O., M. Ciaccio, R. N. Farías, J. E. González-Pastor, F. Moreno, and R. A. Salomón. 1999. Sequence analysis of the four plasmid genes required to produce the circular peptide antibiotic microcin J25. J. Bacteriol. 181:2659-2662.[Abstract/Free Full Text]
28
28. van der Rest, M. E., C. Frank, and D. Molenaar. 2000. Functions of the membrane-associated and cytoplasmic malate dehydrogenases in the citric acid cycle of Escherichia coli. J. Bacteriol. 182:6892-6899.[Abstract/Free Full Text]
29
29. Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268.[CrossRef][Medline]
30
30. Wilson, K. A., M. Kalkum, J. Ottesen, J. Yuzenkova, B. T. Chait, R. Landick, T. Muir, K. Severinov, and S. A. Darst. 2003. Structure of microcin J25, a peptide inhibitor of bacterial RNA polymerase, is a lassoed tail. J. Am. Chem. Soc. 125:12475-12483.[CrossRef][Medline]
31
31. Yuzenkova, J., M. Delgado, S. Nechaev, D. Savalia, V. Epshtein, I. Artsimovitch, R. A. Mooney, R. Landick, R. N. Farias, R. Salomon, and K. Severinov. 2002. Mutations of bacterial RNA polymerase leading to resistance to microcin J25. J. Biol. Chem. 277:50867-50875.[Abstract/Free Full Text]

---

Journal of Bacteriology, May 2005, p. 3465-3470, Vol. 187, No. 10
0021-9193/05/$08.00+0     doi:10.1128/JB.187.10.3465-3470.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Rosner, J. L., Martin, R. G. (2009). An Excretory Function for the Escherichia coli Outer Membrane Pore TolC: Upregulation of marA and soxS Transcription and Rob Activity Due to Metabolites Accumulated in tolC Mutants. J. Bacteriol. 191: 5283-5292 [Abstract] [Full Text]  
• Socias, S. B., Vincent, P. A., Salomon, R. A. (2009). The Leucine-Responsive Regulatory Protein, Lrp, Modulates Microcin J25 Intrinsic Resistance in Escherichia coli by Regulating Expression of the YojI Microcin Exporter. J. Bacteriol. 191: 1343-1348 [Abstract] [Full Text]  
• Yamanaka, H., Kobayashi, H., Takahashi, E., Okamoto, K. (2008). MacAB Is Involved in the Secretion of Escherichia coli Heat-Stable Enterotoxin II. J. Bacteriol. 190: 7693-7698 [Abstract] [Full Text]  
• Pomares, M. F., Vincent, P. A., Farias, R. N., Salomon, R. A. (2008). Protective Action of ppGpp in Microcin J25-Sensitive Strains. J. Bacteriol. 190: 4328-4334 [Abstract] [Full Text]  
• Bellomio, A., Vincent, P. A., de Arcuri, B. F., Farias, R. N., Morero, R. D. (2007). Microcin J25 Has Dual and Independent Mechanisms of Action in Escherichia coli: RNA Polymerase Inhibition and Increased Superoxide Production. J. Bacteriol. 189: 4180-4186 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delgado, M. A. Articles by Salomón, R. A. Search for Related Content PubMed PubMed Citation Articles by Delgado, M. A. Articles by Salomón, R. A.