This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Uehara, T.
Right arrow Articles by Park, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Uehara, T.
Right arrow Articles by Park, J. T.

 Previous Article  |  Next Article 

Journal of Bacteriology, June 2005, p. 3643-3649, Vol. 187, No. 11
0021-9193/05/$08.00+0     doi:10.1128/JB.187.11.3643-3649.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Recycling of the Anhydro-N-Acetylmuramic Acid Derived from Cell Wall Murein Involves a Two-Step Conversion to N-Acetylglucosamine-Phosphate

Tsuyoshi Uehara,1 Kyoko Suefuji,1 Noelia Valbuena,1,{dagger} Brian Meehan,1 Michael Donegan,2 and James T. Park1*

Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111,1 Discovery Proteomics/Small Molecule Research Center, Applied Biosystems, Framingham, Massachusetts 017012

Received 11 January 2005/ Accepted 17 February 2005


arrow
ABSTRACT
 
Escherichia coli breaks down over 60% of the murein of its side wall and reuses the component amino acids to synthesize about 25% of the cell wall for the next generation. The amino sugars of the murein are also efficiently recycled. Here we show that the 1,6-anhydro-N-acetylmuramic acid (anhMurNAc) is returned to the biosynthetic pathway by conversion to N-acetylglucosamine-phosphate (GlcNAc-P). The sugar is first phosphorylated by anhydro-N-acetylmuramic acid kinase (AnmK), yielding MurNAc-P, and this is followed by action of an etherase which cleaves the bond between D-lactic acid and the N-acetylglucosamine moiety of MurNAc-P, yielding GlcNAc-P. The kinase gene has been identified by a reverse genetics method. The enzyme was overexpressed, purified, and characterized. The cell extract of an anmK deletion mutant totally lacked activity on anhMurNAc. Surprisingly, in the anmK mutant, anhMurNAc did not accumulate in the cytoplasm but instead was found in the medium, indicating that there was rapid efflux of free anhMurNAc.


arrow
INTRODUCTION
 
In the past decade nine enzymes, including the two reported here, have been shown to be involved in recycling components of the cell wall peptidoglycan. This is quite remarkable considering that the recycled murein constitutes less than 1% of the cell's dry weight. Goodell originally observed that Escherichia coli recycled almost 50% of the cell wall diaminopimelic acid (Dap) in the form of the murein tripeptide L-Ala-{gamma}-D-Glu-meso-Dap and predicted that a ligase adds the tripeptide directly to UDP-N-acetylmuramic acid (6). Incorporation of the tripeptide was reported to require OppA, a periplasmic binding protein involved in uptake of oligopeptides (7). However, this later proved not to be the case, and instead MppA, a specific periplasmic binding protein, was required, which transferred the tripeptide to the membrane components of oligopeptide permease (18). Surprisingly, it was subsequently found that, even in the absence of oligopeptide permease, murein tripeptide was recycled efficiently (20). This led to the discovery that murein tripeptide was imported almost entirely in the form of anhydro-disaccharide-peptides and that recycling of murein tripeptide required AmpG and AmpD (10).

Figure 1 shows the scheme for the murein recycling pathway. During growth, the principal muropeptide produced from murein by lytic transglycosidases and endopeptidases is GlcNAc- anhydro-N-acetylmuramic acid (anhMurNAc)-L-Ala-{gamma}-D-Glu-meso-Dap-D-Ala (8). This and related anhydro-disaccharide-containing muropeptides are transported into the cytoplasm by the AmpG permease (2) designated Amp (for ampicillin), because it was found to be required for ß-lactamase induction (13). AmpD was once considered to serve as a negative regulator of ß-lactamase induction since, in its absence, induction was constitutive (14). This protein was found to be an anhMurNAc-L-Ala amidase (9, 11) which cleaves the bond between anhMurNAc and the peptide. In the ampD mutant, high concentrations of anhMurNAc-tripeptide serve as an inducer of ß-lactamase (10, 12).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 1. Scheme for recycling of anhydro-muropeptides. PBPs, penicillin binding proteins.

Following release of tripeptide from the muropeptide by AmpD, a ligase, Mpl (16), links the peptide to UDP-MurNAc, thereby returning it to the biosynthetic pathway for cell wall synthesis (Fig. 1). In the absence of Mpl, tripeptide would be expected to accumulate in the cytoplasm. However, this is not the case, because MpaA, a {gamma}-D-Glu-Dap amidase, cleaves Dap from over 90% of the tripeptide that could have been utilized by Mpl (25). The resulting dipeptide, L-Ala-D-Glu, is converted to L-Ala-L-Glu by YcjG, an L-Ala-DL-Glu epimerase (22). The L-Ala-L-Glu dipeptide can then be cleaved by the PepD peptidase, yielding L-Ala and L-Glu (22).

LdcA is an LD-carboxypeptidase which cleaves the bond between Dap and D-Ala (23) (Fig. 1). In the normal pathway for murein synthesis, the precursor, UDP-MurNAc-pentapeptide, is formed by the addition of D-Ala-D-Ala to UDP-MurNAc-tripeptide. Without LdcA, strains apparently link tetrapeptide, rather than tripeptide, to UDP-MurNAc (23). This results in a significant amount of tetrapeptide being incorporated into the murein instead of the pentapeptide needed for cross-linking and leads to eventual loss of integrity of the murein sacculus and cell lysis. Thus, LdcA is required in the recycling process to trim the tetrapeptide to a tripeptide. The lytic phenotype of the ldcA mutant dramatizes the contribution that recycling of wall amino acids makes to cell wall formation and integrity.

The amino sugars from the murein are also recycled (19). Under normal growth conditions, the AmpD amidase and NagZ, a ß-N-acetylglucosaminidase (1, 28), cleave the incoming muropeptides to release GlcNAc and anhMurNAc (Fig. 1). A nagZ mutant accumulates huge amounts of the GlcNAc-anhMurNAc disaccharide (19). This reflects the amount of disaccharide-peptides imported via AmpG and cleaved by AmpD (1). Recently, we have shown that the GlcNAc is phosphorylated by a specific kinase, NagK, thereby returning it to the pathway for utilization (26) (Fig. 1). Thus, until now, every component of anhydro-muropeptides has been shown to be salvaged, with the exception of anhMurNAc; here we demonstrate that this compound is readily converted to a form that can be recycled. It was shown previously that strains lacking the NagA deacetylase required for utilization of GlcNAc-6-phosphate accumulated GlcNAc and GlcNAc-P but failed to accumulate anhMurNAc, suggesting that E. coli is able to metabolize anhMurNAc (19). It was speculated that anhMurNAc may be converted to GlcNAc by an "etherase" before reintroduction into the biosynthetic pathway for murein synthesis (19). Now, as illustrated in Fig. 2, we have shown that anhMurNAc is first phosphorylated by a specific anhMurNAc kinase to generate MurNAc-P, which is then converted to GlcNAc-P by an etherase and thus is able to enter the known pathway for amino sugar metabolism.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 2. Conversion of 1,6-anhydro-N-acetylmuramic acid to N-acetylglucosamine-6-phosphate.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and growth conditions. E. coli MG1655 (F ilvG rfb-50 rph-1) (24) was used for purification and identification of the kinase protein. E. coli TP77B, a nagZ mutant derivative of TP71B [F nagB lysA opp araD139 rpsL150 deoC1 ptsF25 ftbB5301 rbsR relA1 {Delta}(argF-lac)] (19), was used to isolate radioactive anhMurNAc. E. coli BL21(DE3)/pTanmK was used for production of quantities of purified AnmK. E. coli BL21(DE3)/pExoII (3) was used for production of ExoII ß-N-acetylglucosaminidase. Cultures were grown in L broth at 37°C with aeration unless otherwise noted.

Purification and identification of anhMurNAc kinase. The kinase was purified from 8.5 g of E. coli MG1655 cell paste obtained from a culture grown to the late log phase. The cells were suspended in 20 ml of PED5 (5 mM potassium phosphate buffer [pH 7.6], 1 mM EDTA, 1 mM dithiothreitol) and ruptured by sonication in the presence of 0.1 mg of phenylmethylsulfonyl fluoride/ml. After centrifugation at 27,000 x g for 20 min at 4°C, 14 mg of streptomycin sulfate/ml was dissolved in the supernatant, which was then centrifuged at 100,000 x g for 90 min at 4°C. The supernatant was loaded onto a 45-ml DEAE-Sephacel column. The column was washed with PED5, followed by a 300-ml gradient to 200 mM NaCl in PED5. Fractions with high kinase activity were pooled, concentrated to 4 ml, and equilibrated with PED5 using an Amicon Ultrafree 4, 10K centrifugal filter device (Millipore, Bedford, MA). The sample was loaded onto a 20-ml hydroxylapatite column (BIO-GEL HT; Bio-Rad, Hercules, CA) previously equilibrated with PED5; the column was washed with PED5, followed by a 300-ml gradient to 100 mM phosphate buffer (pH 7.6) in PED5. Fractions containing anhMurNAc kinase were pooled and concentrated, and the buffer was replaced with PED2 (same as PED5 except that it contained 2 mM potassium phosphate). The sample was loaded onto a 1-ml MonoQ HR 5/5 column (Amersham Pharmacia, Uppsala, Sweden) and washed with 10 ml of PED2, followed by a gradient to 100 mM NaCl in PED2 over 30 min at a flow rate of 1 ml/min. The active fractions were concentrated and then diluted 20-fold with GGED5 (5 mM glycylglycine-NaOH [pH 8.4], 1 mM EDTA, 1 mM dithiothreitol). The sample was loaded onto the MonoQ column previously equilibrated with GGED5 and washed with GGED5, followed by a gradient to 100 mM NaCl in GGED5 over 30 min at a flow rate of 1 ml/min. The most active kinase fraction, which eluted in 90 mM NaCl, was concentrated, electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, and stained with Coomassie brilliant blue to obtain the protein used for identification by proteomic mass spectrometry at the Tufts University Core Facility. The molecular biology techniques used were those described by Sambrook et al. (21).

ExoII ß-N-acetylglucosaminidase. Purification was performed by using the procedure of Chitlaru and Roseman (3), with minor modifications. E. coli BL21(DE3)/pExoII was grown in 1 liter of L broth containing 100 µg of ampicillin/ml and supplemented with 0.1% glucose and 0.25x E salts (27). In the late log phase, the cells were harvested by centrifugation, washed with buffer D (50 mM phosphate buffer [pH 7.0], 1 mM EDTA, 0.2 mM dithiothreitol), and resuspended in 8 ml of buffer D. The cells were ruptured by sonication, and then 14 mg of streptomycin/ml was added and the suspension was centrifuged at 175,000 x g for 90 min at 4°C. The supernatant was concentrated to 1.3 ml and loaded onto a 45-ml DEAE-Sephacel column, and the column was washed with 35 ml of buffer D, followed by a 100-ml gradient to 1 M NaCl in buffer D. The active fractions (assayed with p-nitrophenyl-ß-N-acetylglucosaminide as described by Chitlaru and Roseman [3]) were pooled, concentrated to 0.6 ml, loaded onto a molecular sieve (1.8 by 85 cm; Ultragel AcA34; Sigma, St. Louis, MO), and eluted with a solution containing 50 mM phosphate buffer (pH 7.0), 100 mM NaCl, and 1 mM EDTA. The active fractions were pooled, concentrated to 1.5 ml, and stored in small aliquots at –60°C in the presence of 8% glycerol.

Preparation of radioactive anhMurNAc and MurNAc. E. coli TP77B was grown in 40 ml of M9 minimal medium containing 0.6% glycerol, 0.1% Casamino Acids, 1 mM MgCl2, 4 µg of thiamine, and 1 µCi of [6-3H]glucosamine (GlcN) (21.6 Ci/mol; NEN Life Science Products, Boston, MA)/ml. This strain accumulates large quantities of the disaccharide GlcNAc-anhMurNAc (19). Late-log-phase cells were harvested and extracted with hot water, and the soluble material was lyophilized, dissolved in 0.2 ml of water, acidified with trifluoroacetic acid (TFA), and fractionated by high-pressure liquid chromatography (HPLC) on a C18 Hypersil-octyldecyl silane reverse-phase column (250 by 4.6 mm; particle size, 3 µm; Bischoff, Leonberg, Germany) using a program consisting of 0.05% TFA for 30 min, followed by a gradient to 10% of 0.035% TFA in acetonitrile over 40 min. The flow rate was 0.5 ml/min, and 0.25-ml fractions were collected. Under these conditions, GlcNAc-anhMurNAc was recovered in fractions 115 to 125. After lyophilization of the fractions containing GlcNAc-anhMurNAc, the disaccharide was dissolved in 0.2 ml of 20 mM HEPES (pH 7.0) and digested with 2 µg of ExoII ß-N-acetylglucosaminidase for 3 h at 37°C. The digest was acidified with TFA and chromatographed by HPLC as described above. anhMurNAc was recovered from fractions 90 to 110. To obtain radioactive MurNAc, [6-3H]anhMurNAc was incubated with 0.02 µg of purified AnmK for 30 min at 37°C in 30 mM Tris-HCl (pH 7.6) containing 7.5 mM ATP and 7.5 mM MgCl2, and then the kinase was inactivated at >95°C for 3 min, followed by treatment with calf intestinal phosphatase (CIP) (New England Biolabs, Beverly, MA) to generate radioactive MurNAc.

Large-scale preparation of anhMurNAc. Cell paste (114 g) of the E. coli nagZ mutant TP77 [F nagZ lysA opp araD139 rpsL150 deoC1 ptsF25 ftbB5301 rbsR relA1 {Delta}(argF-lac)] (1) was suspended in 120 ml of cold water, followed by addition of 9.5 ml of cold 100% trichloroacetic acid. After 10 min, the suspension was centrifuged at 8,000 x g for 10 min. The supernatant was collected, and the residue was extracted with 100 ml of cold water and centrifuged. The combined supernatants were extracted four times with 75 ml of cold ether. The water phase was aerated to remove the ether. The extract was adjusted to pH 7 with 0.4 ml of 10 N NaOH, concentrated by evaporation under reduced pressure, and finally lyophilized. The lyophilized material was dissolved in 10 ml (final volume) of water, 16 ml of cold ethanol was added, and then after 10 min a voluminous precipitate was removed by centrifugation for 10 min at 6,000 x g. The supernatant was evaporated under reduced pressure to remove the ethanol and then lyophilized. The material was dissolved in 4.8 ml (final volume) of water to which 300,000 cpm of [6-3H]GlcNAc-anhMurNAc was added. Three 1.6-ml aliquots were fractionated on a molecular sieve (90 by 1.6 cm) of Toyopearl HW-40S (TosoHaas, Montgomeryville, PA). Fractions (about 0.6 ml) were collected every 3 min, and the radioactive fractions were collected and lyophilized. The lyophilized material was dissolved in 0.6 ml of water. Three 0.2-ml aliquots were purified by HPLC as described above. The purified disaccharide was digested with ExoII ß-N-acetylglucosaminidase, and the anhMurNAc was recovered by HPLC. About 40 µmol was obtained, as determined by titration.

Separation of amino sugars by TLC. Thin-layer chromatography (TLC) was performed with two different solvent systems, a basic solvent system and an acidic solvent system. For basic solvent TLC, a sample was streaked on a plastic-backed cellulose thin-layer plate (EMD Chemicals, Gibbstown, NJ) and chromatographed in 80% ethanol containing 0.4 M NH4OH. The material at the origin, representing compounds containing phosphate, was scraped into a scintillation vial and mixed with 0.2 ml of water, 3 ml of scintillation fluid was added, and the sample was counted. The Rf of nonphosphorylated anhMurNAc or GlcNAc was about 0.6. For acidic solvent TLC, compounds were separated in n-butanol:acetic acid:water (4:1:1). GlcNAc had an Rf of about 0.3, MurNAc had an Rf of 0.62, and anhMurNAc had an Rf of 0.78 in this system. One-centimeter strips of cellulose were scraped into scintillation vials and counted.

Assay and kinetics for anhMurNAc kinase. Aliquots of enzyme were incubated at 37°C for 30 min with 6 µl of a mixture containing 10 mM MgCl2, 10 mM ATP, and 800 cpm of anhMurNAc in 10 mM Tris-HCl (pH 7.6) (the substrate concentration was estimated to be 4 µM). The reaction mixture was fractioned by basic solvent TLC. The counts at the origin represented the amount of substrate phosphorylated. To determine the Km values for anhMurNAc and ATP, two methods were used. In the first method, the assay mixture (10 µl) contained 100 mM Tris-HCl (pH 7.5), 10 mM ATP, 20 mM MgCl2, 2 ng of purified AnmK, 4,000 cpm of [6-3H]anhMurNAc, and various amounts of nonradioactive anhMurNAc. After incubation for 30 min at 37°C, samples were inactivated by incubation at >90°C for 3 min and fractionated by basic solvent TLC. The radioactive count at the origin of the TLC corresponded to the amount of MurNAc-P formed by AnmK. When the Km for ATP was measured, 2 mM anhMurNAc was used with various amounts of ATP. After ADP was found to be a strong inhibitor, a second method was used, in which ATP was regenerated from ADP by addition of 5 mM phosphoenolpyruvate and 0.1 U of pyruvate kinase from rabbit muscle (Sigma, St. Louis, MO).

Assay for etherase. MurNAc-P, prepared from anhMurNAc with purified AnmK kinase as described above for the anhMurNAc kinase assay, was used directly following heat inactivation of the kinase. Enzyme was added, and the mixture was incubated for 30 min at 37°C. Following heat inactivation of the enzyme, 4 U of CIP was added, and incubation was continued for another 30 min at 37°C. Compounds in the digests were chromatographed by acidic solvent TLC to separate GlcNAc and MurNAc from each other.

Cloning of the anmK gene. The anmK DNA fragment from the E. coli chromosome was amplified by PCR using 5'-TCCCGAAGACTTTCCTGGTC and 5'-GGTGCGCAAACGTCAGATTG as the primers. The amplified DNA was ligated into the pGEM-T vector (Promega, Madison, WI), generating plasmid pTanmK carrying the anmK gene under the control of the T7 promoter.

Overexpression and purification of recombinant AnmK. E. coli strain BL21(DE3), freshly transformed with pTanmK, was grown at 37°C with vigorous shaking in 1 liter of L broth containing 100 µg of ampicillin/ml and 0.2% glucose. After the culture grew to the mid-log phase, isopropyl-ß-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM, and incubation was continued for 3 h. Overexpressed AnmK protein that was >99% pure was obtained from the cells by streptomycin sulfate treatment and DEAE-Sephacel, hydroxylapatite, and MonoQ chromatography as described above for purification and identification of AnmK (Fig. 3). We found that the purified AnmK lost most of its activity upon freezing. However, the purified protein was active for at least 3 months when it was stored in 40% glycerol at –20°C.



View larger version (84K):
[in this window]
[in a new window]
 
FIG. 3. Purification of recombinant AnmK overexpressed in E. coli strain BL21(DE3)/pTanmK. Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue. Lane 1, streptomycin sulfate treatment; lane 2, DEAE-Sephacel; lane 3, hydroxylapatite; lane 4, MonoQ. Lanes 1 to 3 each contained 10 µg of protein, and lane 4 contained 5 µg.

Construction of anhMurNAc kinase-negative (anmK) strains. anmK was deleted as described previously (5, 25), using primers 5'-GGTCTGGAGGGCAATACGCCCTCCCTAACGTTCCAAGTGTAGGCTGGAGCTGCTTCG and 5'-AGGATGAACTATGAAATCGGGCCGCTTTATTGGCGTTATGAATATCCTCCTTAGTTC (the boldface sequences are homologous to the anmK-flanking sequence, and the underlined sequences are homologous to the pKD3 vector sequence flanking the Cmr gene) and pKD3 as the template to synthesize the PCR product used for one-step inactivation. The anmK::Cm mutation was confirmed by PCR with the primers used for cloning anmK described above. anmK::Cm was transduced into TP71B with T4gt7 phage (17).

Labeling cells with [6-3H]GlcN and analysis of the hot-water extract and the spent medium by HPLC. Cells were labeled in 8 ml of the glycerol-Casamino Acids minimal medium containing 1 µCi of [6-3H]GlcN/ml as described previously (19). Spent medium, separated by centrifugation (10,000 x g, 5 min 4°C), and the hot-water extract were lyophilized and fractionated by HPLC as described above for preparation of radioactive anhMurNAc and MurNAc. anhMurNAc was recovered from fractions 90 to 110, and UDP-MurNAc-pentapeptide was in fractions 125 to 135.

MS. Samples were diluted 1:10 in a solution of 50:50 acetonitrile-5 mM ammonium acetate. The mass spectrometry (MS) data were acquired by direct infusion of the diluted samples into an API 4000 liquid chromatography-MS-MS system (Applied Biosystems/MDS Sciex, Concord, Ontario, Canada). The instrument was operated in the negative ion mode using a ramped collision energy for all MS-MS scans. Selective detection of the proposed phosphorylated compounds was possible because of the use of a precursor ion scan of mass 79 Da (PO3). The resultant scan produced a mass spectrum that contained only the molecular ions of the phosphorylated compounds present in the sample. The substrate, which was not phosphorylated, was analyzed by a Q1 negative ion scan.


arrow
RESULTS
 
Pathway for anhMurNAc utilization. It was previously demonstrated that after incubation of [3H]anhMurNAc with a soluble cell extract from E. coli cells for 2 h at 37°C, only a small amount of anhMurNAc was converted to material that was separated from anhMurNAc by HPLC (19). In contrast, when 10 mM ATP and MgCl2 were added to a comparable extract, anhMurNAc was completely converted to a compound (s) that no longer bound to a C18 reverse-phase column which bound anhMurNAc and that remained at the origin in basic solvent TLC. Using the basic solvent TLC assay as a guide, the enzyme activity for anhMurNAc was partially purified from cell extracts of wild-type strain E. coli MG1655 by three sequential chromatographic steps: DEAE-Sephacel, hydroxylapatite, and MonoQ in pH 7.6 buffer as described in Materials and Methods. When digests of anhMurNAc (molecular weight, 275) were analyzed by mass spectrometry in the negative ion mode, an ion with a mass of 372 Da corresponding to MurNAc-P and an ion with a mass of 300 Da corresponding to GlcNAc-P were shown to be present (data not shown), suggesting that anhMurNAc was phosphorylated and that some of the product, MurNAc-P, was converted to GlcNAc-P. When the digest was treated with CIP, followed by acidic solvent TLC, three bands of radioactivity were detected. The Rf values of the three bands corresponded to those of anhMurNAc, MurNAc, and GlcNAc. Since the activity on anhMurNAc was stable at pH 9 for at least several hours, the enzyme preparation was fractionated on the MonoQ column in pH 8.4 buffer as described in Materials and Methods. This separated two activities; an activity on anhMurNAc to generate MurNAc-P eluted at 90 mM NaCl, and an activity converting MurNAc-P to GlcNAc-P eluted at 22 mM NaCl. Thus, the pathway from anhMurNAc to GlcNAc-P involves two enzymes, anhMurNAc kinase (AnmK) and MurNAc-P etherase.

Identification of AnmK. The AnmK-active fraction obtained by chromatography on MonoQ in pH 8.4 buffer appeared to contain two proteins with molecular masses of about 40,000 Da as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with Coomassie brilliant blue staining. Analysis of the tryptic digest of these protein bands by mass spectrometry actually identified four proteins. The only unknown open reading frame, ydhH, coding for a 369-amino-acid protein (molecular weight, 39,496), was tested as the likely anhMurNAc kinase. A ydhH knockout strain was constructed as described in Materials and Methods. This mutant totally lacked activity against anhMurNAc, indicating that YdhH is AnmK. The anmK mutant grew normally and had normal morphology. AnmK was cloned under the inducible promoter, overproduced, and purified as described in Materials and Methods (Fig. 3).

Characterization of AnmK. When [6-3H]anhMurNAc was incubated with purified AnmK in the presence or absence of ATP and/or Mg2+, MurNAc-P was formed only when both ATP and Mg2+ were present (data not shown). Mass spectrometry confirmed that AnmK converted anhMurNAc to MurNAc-P (Fig. 4A and B). The kinase exhibited an unusual pH profile. From no activity at pH 4.5 and 5% of the maximum activity at pH 6.0, the activity continued to increase to pH 10.0 (Fig. 5). AnmK did not phosphorylate MurNAc, indicating that AnmK acts only on anhMurNAc, and 20 mM MurNAc did not inhibit the AnmK activity on anhMurNAc (data not shown). To examine the possible inhibition of AnmK by ADP or MurNAc-P, the phosphorylation of anhMurNAc was measured every 15 min in the presence or absence of pyruvate kinase and phosphoenolpyruvate to regenerate ATP from ADP. In the absence of the regeneration system, the rate of phosphorylation of anhMurNAc slowed markedly after 15 min of incubation, during which 0.4 mM ADP and MurNAc-P were produced, while in the presence of the ATP regeneration system the amount of MurNAc-P increased with time until nearly all of the anhMurNAc was converted (Fig. 6). These results suggest that ADP, but not MurNAc-P, is a strong inhibitor of AnmK. The kinetic values of AnmK were determined in the presence of pyruvate kinase and phosphoenolpyruvate by using the basic solvent TLC system to measure the rate of product formation. The Km values of anhMurNAc and ATP were approximately 1 mM. The Vmax was 180 µmol/mg/min, which is equivalent to a turnover number of 7,000 per min. The Ki of ADP was determined to be 0.4 mM using an amount of the enzyme that converted less than 10% of the anhMurNAc to prevent inhibition by the ADP produced during the assay.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 4. Identification of the products of kinase and etherase activity by mass spectrometry. (A) Q1 negative ion scan of the substrate. The sample was identical to the sample in panel B, but without treatment with AnmK. Inactivated AnmK was added. (B) Precursor ion scan of m/z 79 (PO3) of a sample in which 0.03 µmol of anhMurNAc was incubated with 0.08 µmol of MgCl2-ATP, 10 µl of PED5, and 0.2 µg of purified AnmK in a 17-µl (final volume) mixture for 2 h at 37°C. A basic solvent TLC indicated that there was almost complete conversion to MurNAc-P. (C) Precursor ion scan of m/z 79 (PO3) of a sample identical to the sample in panel B, which was then incubated with partially purified etherase for 1 h at 37°C. Acidic solvent TLC following treatment with CIP indicated that there was more than 85% conversion to GlcNAc-P. Rel. Int., relative intensity; amu, atomic mass units.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 5. pH profile of AnmK activity. A total of 4,000 cpm of [3H]anhMurNAc was incubated in various buffers with 2.5 ng of purified AnmK in the presence of 10 mM ATP and 10 mM MgCl2 at 37°C for 30 min. Activities were measured by the basic solvent TLC method. The buffers used were 100 mM sodium acetate for pH 4.5, morpholineethanesulfonic acid (MES)-NaOH for pH 6.0 and 6.5, HEPES-NaOH for pH 7.0, Tris-HCl for pH 7.5, 8.0, and 8.5, and glycine-NaOH for pH 9.0, 9.5, 10.0, and 10.5.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6. Time course of the production of MurNAc-P by purified AmnK in the presence ({diamondsuit}) or absence ({diamond}) of 0.2 U of pyruvate kinase and 5 mM phosphoenolpyruvate. The reaction mixtures contained 2 mM anhMurNAc, 4,000 cpm of [3H]anhMurNAc, 10 mM ATP, 10 mM MgCl2, and 100 mM Tris-HCl (pH 7.5) and were incubated at 37°C. Aliquots were taken every 15 min and inactivated at >90°C for 3 min. The amounts of MurNAc-P were measured by the basic solvent TLC method.

Fate of anhMurNAc in a strain lacking AnmK. In an anmK null mutant, anhMurNAc was expected to accumulate since in the nagZ mutants huge amounts of the GlcNAc-anhMurNAc disaccharide accumulated in the cytoplasm (1). However, when the hot-water extract of cells of the anmK mutant labeled with [6-3H]GlcN was analyzed by HPLC, only a small amount of radioactive anhMurNAc was present in the anmK mutant compared to the amount of disaccharide that accumulated in the nagZ mutant. Since the cell extract of the anmK mutant lacked any activity against anhMurNAc and yet no anhMurNAc accumulated in the cytoplasm, anhMurNAc was either metabolized by an alternative pathway in the intact cell or was released into the medium. When the spent media of wild-type and anmK mutant cultures grown with [6-3H]GlcN were analyzed by HPLC, a high level of radioactivity was detected in the spent medium of the anmK mutant in the same fractions in which anhMurNAc eluted, while the spent medium from the wild type contained only 3% as much radioactivity in these fractions (Table 1). It was found that all of the radioactive material could be phosphorylated by purified AnmK, indicating that the compound accumulating in the spent medium of the anmK mutant was anhMurNAc. The actual amount of anhMurNAc present in the medium was about 100 times the amount detected in the cytoplasm (Table 1). Thus, anhMurNAc is rapidly lost from the cell when it cannot be phosphorylated.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Release of anhMurNAc into the medium by the anmK mutant

Demonstration of etherase activity. Etherase is defined as an activity that cleaves an ether bond, in this case the ether bond between the GlcNAc and D-lactic acid moieties of MurNAc-P. When MurNAc-P was incubated with partially purified etherase from E. coli, MurNAc-P was converted to GlcNAc-P. Precursor ion scanning of mass 79 (PO3) with the mass spectrometer confirmed that this etherase conversion product was indeed phosphorylated and had the correct mass corresponding to GlcNAc-P (Fig. 4C). Residual AMP, ADP, and ATP were also observed and were labeled accordingly in this mass spectrum. The sugar released from the sugar phosphate by treatment with CIP had the same Rf as GlcNAc on an acidic solvent TLC. Definitive proof was obtained by demonstration that the dephosphorylated product could be phosphorylated by NagK, a GlcNAc-specific kinase from E. coli (26). Thus, following treatment with CIP of an aliquot of the product formed by the action of etherase on MurNAc-P, only 1% of the product remained at the origin on a basic solvent TLC. When an identical CIP-treated aliquot was heated at 90°C for 5 min to inactivate CIP and was then incubated with 5.5 µg of NagK for 60 min at 37°C, 73% of the counts were found at the origin of a basic solvent TLC. Since NagK is specific for GlcNAc at the substrate concentration employed (26), we concluded that etherase converts MurNAc-P to GlcNAc-P.


arrow
DISCUSSION
 
We demonstrated a pathway for utilization of the anhMurNAc derived from murein recycling. In the first of two steps, anhMurNAc is phosphorylated and the 1,6-anhydro bond is cleaved by AnmK, yielding MurNAc-P. In the second step, the bond between the GlcNAc and D-lactic acid moieties of MurNAc-P is cleaved by an etherase, producing GlcNAc-P. This pathway was confirmed experimentally. As shown in Fig. 4A and B, we identified the substrate, anhMurNAc (m/z 274), which was converted by AnmK to MurNAc-P (m/z 372). As shown in Fig. 4C, MurNAc-P is converted by etherase to GlcNAc-P (m/z 300).

AnmK and etherase copurified during three chromatographic steps before separation was achieved by chromatography on MonoQ in pH 8.4 buffer. We identified ydhH as the anmK gene by proteomic mass spectrometry of the gene product. anmK appears to be a monocistronic gene present at 37.0 min on the E. coli chromosome and is likely to be transcribed from a putative {sigma}70-dependent promoter. Deletion of the gene produced a strain that totally lacked AnmK activity or any activity modifying anhMurNAc. anmK was cloned under an inducible promoter, and the protein was overexpressed, purified, and studied biochemically. AnmK requires ATP and Mg2+ for activity. The activity of AnmK was highest at pH 10 and was very low below pH 6.0 (Fig. 5). The enzyme is specific for anhMurNAc and does not phosphorylate MurNAc. The enzyme has an apparent Km of 1 mM for both anhMurNAc and ATP. ADP is a strong inhibitor, with a Ki of approximately 0.4 mM.

The conversion of anhMurNAc to MurNAc-P involves hydrolysis of the 1,6-anhydro bond and the simultaneous phosphorylation of the sugar. A similar reaction has recently been studied, in which a kinase from Aspergillus niger phosphorylates levoglucosan (1,6-anhydro-ß-D-glucose) to form glucose-6-P (29).

Contrary to our experience with other genes involved in murein recycling, the anmK knockout strain did not accumulate the substrate for AnmK. Instead, anhMurNAc appeared in the medium. Presumably, an active efflux pump rids the mutant cells of anhMurNAc.

Evidence for an etherase that converts MurNAc-P to GlcNAc-P. When MurNAc-P was incubated with partially purified etherase, a product was formed which had the following two properties: (i) it had the mass expected for GlcNAc-P (Fig. 4C) and (ii) when dephosphorylated by CIP, it could be rephosphorylated by NagK, a kinase specific for GlcNAc at low substrate concentrations. This proved that the product was GlcNAc-P.

We attempted to identify the etherase protein in a highly purified etherase-active fraction which still contained several proteins, but all the major bands in the active fraction proved to be known proteins, so thus far we have not been able to identify the etherase gene. However, we recently learned that the gene for an etherase in E. coli has been identified (T. Jaeger, M. Arsic, and C. Mayer, submitted for publication). The gene, yfeU, is part of an operon that includes a gene coding for a new phosphotransferase, MurP, which Mayer and coworkers showed was required for growth of E. coli on MurNAc as the sole source of carbon (4). The pathway for utilization of anhMurNAc in the cytoplasm and the pathway for metabolism of MurNAc from the medium merge at the stage of formation of MurNAc-P. Although we have not determined the position of the phosphate in the sugar phosphates involved in this pathway, the fact that NagA, a GlcNAc-6-P deacetylase, and NagB, a GlcN-6-P deaminase, are required for the growth on MurNAc (4) indicates that the phosphate is located at position 6. Thus, MurNAc from the environment and anhMurNAc from E. coli's cell wall are both converted to MurNAc-6-P and hence to GlcNAc-6-P before they are utilized by the organism.

Surprisingly, in Vibrio cholerae and Vibrio parahaemolyticus, there are two paralogs of the etherase gene, one in an operon encoding the MurP phosphotransferase system required for uptake of MurNAc and the other in a putative operon with anmK. In contrast, although some gram-negative bacteria possess an ortholog of AnmK along with an ortholog of the etherase, which may or may not be encoded together in an operon, many other gram-negative bacteria contain only an ortholog of the kinase. This suggests that many bacteria may be able to utilize MurNAc-P without conversion to GlcNAc-P.

It should be interesting to determine the mechanism of cleavage of the bond between the GlcNAc and D-lactic acid moieties of MurNAc-P. Conceivably, this bond could be cleaved by a reductive process to form propionic acid or hydrolytically to form lactic acid. To our knowledge, there has been only one report of a bacterial enzyme called an etherase. In this case, a ß-aryl ether of lignin was cleaved by a glutathione S-transferase, and a second enzyme, a glutathione lyase, was required to remove glutathione from one of the cleavage products (15).

With the identification of a pathway for recycling anhMurNAc, all components of the cell wall murein have been shown to be efficiently recycled (1, 2, 10, 16, 19, 23, 25, 26). At least nine enzymes are dedicated to the process of salvaging the components of the cell wall murein. The result is that over 60% of the side wall of the cell is broken down and recycled each generation, and this is sufficient to provide the amino acids for an estimated 25% of the new wall synthesized each generation. Although murein recycling is not essential for E. coli growth under laboratory conditions, for gram-negative bacteria to have conserved the recycling pathway, it must play a useful role in nature.


arrow
ACKNOWLEDGMENTS
 
This work was supported in part by Public Health Service grant GM51610 from the National Institute of General Medical Sciences.

We thank the Digestive Disease Center (NIDDK, P30 DK34928) for production of E. coli cells.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111. Phone: (617) 636-6753. Fax: (617) 636-0337. E-mail: james.park{at}tufts.edu. Back

{dagger} Present address: Departamento de Ecología, Genética, Microbiología, Área de Microbiología, Facultad de Biología, Universidad de León, 24071 León, Spain. Back


arrow
REFERENCES
 
    1
  1. Cheng, Q., H. Li, K. Merdek, and J. T. Park. 2000. Molecular characterization of the ß-N-acetylglucosaminidase of Escherichia coli and its role in cell wall recycling. J. Bacteriol. 182:4836-4840.[Abstract/Free Full Text]
  2. 2
  3. Cheng, Q., and J. T. Park. 2002. Substrate specificity of the AmpG permease required for recycling of cell wall anhydro-muropeptides. J. Bacteriol. 184:6434-6436.[Abstract/Free Full Text]
  4. 3
  5. Chitlaru, E., and S. Roseman. 1996. Molecular cloning and characterization of a novel ß-N-acetyl-D-glucosaminidase from Vibrio furnissii. J. Biol. Chem. 271:33433-33439.[Abstract/Free Full Text]
  6. 4
  7. Dahl, U., T. Jaeger, B. T. Nguyen, J. M. Sattler, and C. Mayer. 2004. Identification of a phosphotransferase system of Escherichia coli required for growth on N-acetylmuramic acid. J. Bacteriol. 186:2385-2392.[Abstract/Free Full Text]
  8. 5
  9. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
  10. 6
  11. Goodell, E. W. 1985. Recycling of murein by Escherichia coli. J. Bacteriol. 163:305-310.[Abstract/Free Full Text]
  12. 7
  13. Goodell, E. W., and C. F. Higgins. 1987. Uptake of cell wall peptides by Salmonella typhimurium and Escherichia coli. J. Bacteriol. 169:3861-3865.[Abstract/Free Full Text]
  14. 8
  15. Holtje, J. V. 1998. Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli. Microbiol. Mol. Biol. Rev. 62:181-203.[Abstract/Free Full Text]
  16. 9
  17. Holtje, J. V., U. Kopp, A. Ursinus, and B. Wiedemann. 1994. The negative regulator of ß-lactamase induction AmpD is a N-acetyl-anhydromuramyl-L-alanine amidase. FEMS Microbiol. Lett. 122:159-164.[CrossRef][Medline]
  18. 10
  19. Jacobs, C., L. J. Huang, E. Bartowsky, S. Normark, and J. T. Park. 1994. Bacterial cell wall recycling provides cytosolic muropeptides as effectors for ß-lactamase induction. EMBO J. 13:4684-4694.[Medline]
  20. 11
  21. Jacobs, C., B. Joris, M. Jamin, K. Klarsov, J. Van Beeumen, D. Mengin-Lecreulx, J. van Heijenoort, J. T. Park, S. Normark, and J. M. Frere. 1995. AmpD, essential for both ß-lactamase regulation and cell wall recycling, is a novel cytosolic N-acetylmuramyl-L-alanine amidase. Mol. Microbiol. 15:553-559.[Medline]
  22. 12
  23. Jacobs, C., J. M. Frere, and S. Normark. 1997. Cytosolic intermediates for cell wall biosynthesis and degradation control inducible ß-lactam resistance in gram-negative bacteria. Cell 88:823-832.[CrossRef][Medline]
  24. 13
  25. Korfmann, G., and C. C. Sanders. 1989. AmpG is essential for high-level expression of AmpC ß-lactamase in Enterobacter cloacae. Antimicrob. Agents Chemother. 33:1946-1951.[Abstract/Free Full Text]
  26. 14
  27. Lindberg, F., S. Lindquist, and S. Normark. 1987. Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii ß-lactamase. J. Bacteriol. 169:1923-1928.[Abstract/Free Full Text]
  28. 15
  29. Masai, E., A. Ichimura, Y. Sato, K. Miyauchi, Y. Katayama, and M. Fukuda. 2003. Roles of the enantioselective glutathione S-transferases in cleavage of ß-aryl ether. J. Bacteriol. 185:1768-1775.[Abstract/Free Full Text]
  30. 16
  31. Mengin-Lecreulx, D., J. van Heijenoort, and J. T. Park. 1996. Identification of the mpl gene encoding UDP-N-acetylmuramate:L-alanyl-{gamma}-D-glutamyl-meso-diaminopimelate ligase in Escherichia coli and its role in recycling of cell wall peptidoglycan. J. Bacteriol. 178:5347-5352.[Abstract/Free Full Text]
  32. 17
  33. Miller, J. H. 1992. A short course in bacterial genetics, a laboratory manual, p. 268-274. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  34. 18
  35. Park, J. T., D. Raychaudhuri, H. Li, S. Normark, and D. Mengin-Lecreulx. 1998. MppA, a periplasmic binding protein essential for import of the bacterial cell wall peptide L-alanyl-{gamma}-D-glutamyl-meso-diaminopimelate. J. Bacteriol. 180:1215-1223.[Abstract/Free Full Text]
  36. 19
  37. Park, J. T. 2001. Identification of a dedicated recycling pathway for anhydro-N-acetylmuramic acid and N-acetylglucosamine derived from Escherichia coli cell wall murein. J. Bacteriol. 183:3842-3847.[Abstract/Free Full Text]
  38. 20
  39. Park, J. T. 1993. Turnover and recycling of the murein sacculus in oligopeptide permease-negative strains of Escherichia coli: indirect evidence for an alternative permease system and for a monolayered sacculus. J. Bacteriol. 175:7-11.[Abstract/Free Full Text]
  40. 21
  41. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  42. 22
  43. Schmidt, D. M. Z., B. K. Hubbard, and J. A. Gerlt. 2001. Evolution of enzymatic activities in the enolase superfamily: functional assignment of unknown proteins in Bacillus subtilis and Escherichia coli as L-Ala-D/L-Glu epimerases. Biochemistry 40:15707-15715.[CrossRef][Medline]
  44. 23
  45. Templin, M. F., A. Ursinus, and J. V. Holtje. 1999. A defect in cell wall recycling triggers autolysis during the stationary growth phase of Escherichia coli. EMBO J. 18:4108-4117.[CrossRef][Medline]
  46. 24
  47. Tian, G., and W. K. Maas. 1994. Mutational analysis of the arginine repressor of Escherichia coli. Mol. Microbiol. 13:599-608.[Medline]
  48. 25
  49. Uehara, T., and J. T. Park. 2003. Identification of MpaA, an amidase in Escherichia coli that hydrolyzes the {gamma}-D-glutamyl-meso-diaminopimelate bond in murein peptides. J. Bacteriol. 185:679-682.[Abstract/Free Full Text]
  50. 26
  51. Uehara, T., and J. T. Park. 2004. The N-acetyl-D-glucosamine kinase of Escherichia coli and its role in murein recycling. J. Bacteriol. 186:7273-7279.[Abstract/Free Full Text]
  52. 27
  53. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithinase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 218:97-106.[Free Full Text]
  54. 28
  55. Votsch, W., and M. F. Templin. 2000. Characterization of a ß-N-acetylglucosaminidase of Escherichia coli and elucidation of its role in muropeptide recycling and ß-lactamase induction. J. Biol. Chem. 275:39032-39038.[Abstract/Free Full Text]
  56. 29
  57. Zhuang, X., and H. Zhang. 2002. Identification, characterization of levoglucosan kinase, and cloning and expression of levoglucosan kinase cDNA from Aspergillus niger CBX-209 in Escherichia coli. Protein Expr. Purif. 26:71-81.[CrossRef][Medline]


Journal of Bacteriology, June 2005, p. 3643-3649, Vol. 187, No. 11
0021-9193/05/$08.00+0     doi:10.1128/JB.187.11.3643-3649.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Plumbridge, J. (2009). An Alternative Route for Recycling of N-Acetylglucosamine from Peptidoglycan Involves the N-Acetylglucosamine Phosphotransferase System in Escherichia coli. J. Bacteriol. 191: 5641-5647 [Abstract] [Full Text]  
  • Jaeger, T., Mayer, C. (2008). The Transcriptional Factors MurR and Catabolite Activator Protein Regulate N-Acetylmuramic Acid Catabolism in Escherichia coli. J. Bacteriol. 190: 6598-6608 [Abstract] [Full Text]  
  • Park, J. T., Uehara, T. (2008). How Bacteria Consume Their Own Exoskeletons (Turnover and Recycling of Cell Wall Peptidoglycan). Microbiol. Mol. Biol. Rev. 72: 211-227 [Abstract] [Full Text]  
  • Garcia, D. L., Dillard, J. P. (2008). Mutations in ampG or ampD Affect Peptidoglycan Fragment Release from Neisseria gonorrhoeae. J. Bacteriol. 190: 3799-3807 [Abstract] [Full Text]  
  • de la Mora, J., Ballado, T., Gonzalez-Pedrajo, B., Camarena, L., Dreyfus, G. (2007). The Flagellar Muramidase from the Photosynthetic Bacterium Rhodobacter sphaeroides. J. Bacteriol. 189: 7998-8004 [Abstract] [Full Text]  
  • Uehara, T., Park, J. T. (2007). An Anhydro-N-Acetylmuramyl-L-Alanine Amidase with Broad Specificity Tethered to the Outer Membrane of Escherichia coli. J. Bacteriol. 189: 5634-5641 [Abstract] [Full Text]  
  • Herve, M., Boniface, A., Gobec, S., Blanot, D., Mengin-Lecreulx, D. (2007). Biochemical Characterization and Physiological Properties of Escherichia coli UDP-N-Acetylmuramate:L-Alanyl-{gamma}-D-Glutamyl-meso- Diaminopimelate Ligase. J. Bacteriol. 189: 3987-3995 [Abstract] [Full Text]  
  • Uehara, T., Suefuji, K., Jaeger, T., Mayer, C., Park, J. T. (2006). MurQ Etherase Is Required by Escherichia coli in Order To Metabolize Anhydro-N-Acetylmuramic Acid Obtained either from the Environment or from Its Own Cell Wall. J. Bacteriol. 188: 1660-1662 [Abstract] [Full Text]  
  • Jaeger, T., Arsic, M., Mayer, C. (2005). Scission of the Lactyl Ether Bond of N-Acetylmuramic Acid by Escherichia coli "Etherase". J. Biol. Chem. 280: 30100-30106 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Uehara, T.
Right arrow Articles by Park, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Uehara, T.
Right arrow Articles by Park, J. T.