This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bailey-Smith, K.
Right arrow Articles by Moir, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bailey-Smith, K.
Right arrow Articles by Moir, A.

 Previous Article  |  Next Article 

Journal of Bacteriology, June 2005, p. 3800-3806, Vol. 187, No. 11
0021-9193/05/$08.00+0     doi:10.1128/JB.187.11.3800-3806.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The ExsA Protein of Bacillus cereus Is Required for Assembly of Coat and Exosporium onto the Spore Surface

Karen Bailey-Smith,1,{dagger} Sarah J. Todd,1 Thomas W. Southworth,1 John Proctor,2 and Anne Moir1*

Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN, United Kingdom,1 Department of Biomedical Science, University of Sheffield, Sheffield S10 2TN, United Kingdom2

Received 26 October 2004/ Accepted 24 February 2005


arrow
ABSTRACT
 
The outermost layer of spores of the Bacillus cereus family is a loose structure known as the exosporium. Spores of a library of Tn917-LTV1 transposon insertion mutants of B. cereus ATCC 10876 were partitioned into hexadecane; a less hydrophobic mutant that was isolated contained an insertion in the exsA promoter region. ExsA is the equivalent of SafA (YrbA) of Bacillus subtilis, which is also implicated in spore coat assembly; the gene organizations around both are identical, and both proteins contain a very conserved N-terminal cortex-binding domain of ca. 50 residues, although the rest of the sequence is much less conserved. In particular, unlike SafA, the ExsA protein contains multiple tandem oligopeptide repeats and is therefore likely to have an extended structure. The exsA gene is expressed in the mother cell during sporulation. Spores of an exsA mutant are extremely permeable to lysozyme and are blocked in late stages of germination, which require coat-associated functions. Two mutants expressing differently truncated versions of ExsA were constructed, and they showed the same gross defects in the attachment of exosporium and spore coat layers. The protein profile of the residual exosporium harvested from spores of the three mutants—two expressing truncated proteins and the mutant with the original transposon insertion in the promoter region—showed some differences from the wild type and from each other, but the major exosporium glycoproteins were retained. The exsA gene is extremely important for the normal assembly and anchoring of both the spore coat and exosporium layers in spores of B. cereus.


arrow
INTRODUCTION
 
Bacillus cereus, Bacillus anthracis, and Bacillus thuringiensis are very closely related (16, 22), and the possession of an exosporium is a major characteristic of this group. This outermost layer of the spore is the least understood of all the spore integuments. The paradigm of sporeformers, B. subtilis, lacks a distinct, separate exosporium, although there has been a report that a very outermost tightly fitting layer of the spore coat can be visualized after extracting some of the coat material from spores with urea-mercaptoethanol and might be considered an exosporium (26). The exosporium of Bacillus cereus is first observed as a small lamellar structure in the mother cell cytoplasm in proximity to, but not in contact with, the outer forespore membrane; it is synthesized concurrently with the spore coat, although the two structures are clearly separate within the mature spore (16). The exosporium contains a hexagonal crystal-like basal layer and a hairy-nap outer layer (9). It has been estimated as containing 53% protein, 20% amino and neutral polysaccharide, 18% lipids, and approximately 4% ash. The whole structure makes up approximately 2% of the dry weight of the spore (14). A number of the proteins from the exosporia of B. cereus (7, 37) and B. anthracis (25, 28, 30) have been identified, most notably the B. anthracis surface-exposed glycoprotein antigen BclA (30, 31).

The hydrophobic properties of Bacillus megaterium QMB1551 spores probably reflect the presence of an exosporium, as spores with a defective or absent exosporium show greatly reduced affinity for hexadecane (11). Spores of several species that do not possess a distinct exosporium, including B. subtilis, Bacillus licheniformis, and Bacillus macerans, also exhibit a lesser degree of hydrophobicity. A reduction in partition into hexadecane was used to enrich for exosporium mutants of B. cereus; one of the mutants recovered has a defect in exsA.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and media. The bacterial strains and plasmids used in this study are listed in Table 1. B. cereus strains were routinely cultured in or on Oxoid nutrient broth (NB) or nutrient agar (NA) containing the appropriate antibiotics (tetracycline at 50 µg ml–1, erythromycin at 1 µg ml–1, and lincomycin at 25 µg ml–1). Luria broth was used to culture wild-type B. cereus for transformation and for B. cereus "plating" cells for phage transduction. NBY broth, phage assay broth (36), NBY agar, and PA agar (36) were used for B. cereus phage transduction. Escherichia coli strains were grown at 37°C in Luria broth or L agar, containing ampicillin at 100 µg ml–1 if appropriate.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Strains and plasmids used

Spore preparation. Spores of B. cereus strains were prepared in CCY medium as previously described (8), with incubation at 30°C with shaking until the culture contained >95% free spores. The spores were harvested by centrifugation at 15,000 x g for 10 min at 4°C, and the pellet was resuspended in chilled, sterile distilled water. Spore pellets were washed in chilled distilled water 8 to 10 times by repeated centrifugation. The final pellet was resuspended in spore resuspension buffer (50 mM Tris-HCl, 0.5 mM EDTA, pH 7.5) and stored at –20°C until further use. This buffer does not affect spore resistance or germination properties.

Enrichment for exosporium mutants. Spore preparations from Tn917-LTV1 transposon insertion libraries (6, 8) were subjected to an enrichment procedure for spores with altered surface hydrophobicity (11). Hexadecane (0.4 ml) was added to 10 ml of spore suspension (at an optical density at 600 nm [OD600] of 0.6 to 0.7) in glass bottles, vortexed for 1 min, and then left to stand for 15 min. The lower aqueous layer was then extracted again with hexadecane. After a total of five extractions, aliquots of the final aqueous layer were plated on NA containing erythromycin and lincomycin, and spores were recovered as colonies after overnight incubation at 37°C. The transfer of spores to the hexadecane layer at the first extraction was estimated from the reduction in OD580 of the aqueous layer after extraction. Inocula from individual spore-containing colonies were suspended in crystal violet solution (1% [wt/vol] in 10% [vol/vol] methanol) and left to be stained for 10 min before being viewed by phase-contrast microscopy to assess the status of the exosporium.

Phage transduction. A generalized transduction procedure was used to confirm 100% linkage of the transposon macrolide-lincosamide-streptogramin B (MLS) resistance to the exosporium-negative phenotype. CP51ts was propagated on each of the donor Tn917-LTV1 exosporium mutants, and generalized transduction was carried out (8). Transductants were allowed to sporulate by incubating the plates for 4 days at 30°C. Spores were visualized by phase-contrast microscopy as described above.

Measurement of lysozyme resistance. Spores were incubated with lysozyme (250 µg ml–1 in 0.9% NaCl) for 10 min at 37°C and the survivors enumerated by plating dilutions on NA. Both untreated and treated spores were also viewed by phase-contrast microscopy.

Electron microscopy. Spore sections were prepared as described previously (13). Sections were placed on Formvar-coated copper grids and examined under a Phillips CM10 transmission electron microscope at an accelerating voltage of 80 kV, and electron micrographs were recorded on AGFA Scientifica 23D56 EM film.

Loss of OD during germination. Washed spores were germinated as previously described (2), except that the spore suspensions were in wells of a microtiter tray, and the OD490 was measured on a Wallac Victor2 1420 multilabel counter.

Exosporium extraction and protein separation. Exosporium was removed by treatment in a French pressure cell; extraction, purification, and washes were all as previously described (37). Protein concentrations were measured by an adaptation of the Lowry method (7, 21) using bovine serum albumin as the protein standard. Protein samples were analyzed on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with 12% polyacrylamide gels (12). Gels were stained with either silver stain (Bio-Rad) or SYPRO Ruby protein gel stain (Molecular Probes). To separate small proteins, samples were boiled in a different sample buffer (3 M Tris-HCl, pH 8.45, 12% glycerol, 4% SDS, 0.1% Coomassie blue G), and separated on precast 16% Tris-Tricine gels (Novex).

Deglycosylation of exosporium. Trifluoromethansulfonic acid-anisole (9:1, vol/vol; 50 µl) was added to 100 to 200 µg of lyophilized exosporium extract and vortexed. The mix was chilled on ice for 2 h, and the reaction was then stopped by the dropwise addition of 1 ml of prechilled diethyl ether-pyridine (1:1). The sample was centrifuged at 16,000 x g for 8 min at 4°C; the pellet was resuspended in 1 ml 0.1 M NH4HCO3 and dialyzed overnight against 0.1 M NH4HCO3, with four buffer changes, using dialysis tubing with a molecular mass cutoff of 3.5 kDa. The dialysate was centrifuged at 16,000 x g for 10 min and the pellet resuspended in 100 µl spore resuspension buffer.

Glycoprotein staining. Proteins were transferred onto nitrocellulose membrane (Amersham) using 10 mM CAPS [3-(cyclohexylamino)-1-propanesulfonic acid] transfer buffer. Glycoprotein staining was performed using a glycoprotein ECL detection kit (Amersham).

ß-Galactosidase assay during sporulation. B. cereus strains were induced to sporulate synchronously at 30°C by the resuspension method (29), with the addition of alanine, valine, leucine, isoleucine, serine, and threonine (10 µg ml–1 each), as well as tryptophan (20 µg ml–1), in the resuspension medium. ß-Galactosidase assays were carried out on frozen cell pellets from 0.5-ml aliquots harvested at regular intervals after resuspension. The cell/spore pellets were incubated on ice for 30 min in 0.5 ml ABT (100 mM NaCl, 60 mM K2HPO4, 40 mM KH2PO4, 0.1% Triton X-100) containing lysozyme (2 mg ml–1); substrate (4-methylumbelliferyl-ß-D-galactoside; 5 µl of a 4-mg ml–1 solution) was added, and the reaction mix was incubated at 25°C for 60 min. The reaction was stopped with 0.5 ml 0.4 M sodium carbonate, the sample was centrifuged to remove any cell debris, and the fluorescent product was measured using a Wallac Victor2 1420 multilabel counter (excitation, 355 nm; emission, 460 nm). Specific activity units are picomoles of methylumbelliferone formed per minute per OD600 unit.

Inverse PCR. Chromosomal DNA was digested with AluI, diluted, and ligated to circularize the fragments. The divergent primers KB1 (GAGTGTTATCTCTCTACAGTGGCAG) and KB2 (TTGGCACAAACAGGTAACGGTTA), both designed against Tn917-LTV1, were used to prime synthesis.

DNA sequencing. All DNA sequences were determined by cycle sequencing on both strands, using a primer walking strategy. The Staden suite of programs (27) was used for sequence assembly and analysis.

Insertional inactivation of the B. cereus exsA gene. The forward primer KB66 (AATAGAATTCCACAACTTAGTAATCCAG; bases not in the B. cereus genome are italicized, and restriction sites are underlined) was used with reverse primer KB68 (ATAAGGATCCGGCGGTATGACTTGTGG) and KB99 (AATAGGATCCGGTTTGGCATAGACGTATG) to generate PCR fragments of 0.9 kb and 1.6 kb, respectively, both internal to the exsA open reading frame. PCR products were digested with EcoRI and BamHI and cloned into similarly digested pMUTIN4 (38), generating plasmids pMEX2 and pMEX3, respectively, which were maintained in E. coli. Potential integrational knockout mutants were obtained by introducing plasmid pMEX DNA into B. cereus ATCC 10876 by electroporation (5), selecting transformants for resistance to erythromycin and lincomycin. PCR was used to confirm the junctions resulting from integration of the pMEX plasmids into the B. cereus chromosome.

Nucleotide sequence accession number. The exsA-yrbB region was deposited in GenBank with accession number AY682718.


arrow
RESULTS
 
Isolation of exosporium-defective spores of B. cereus. A library of B. cereus 569 UM 20.1 spores, each carrying a chromosomal copy of Tn917-LTV1 (8), were subjected to a hexadecane/aqueous-phase partitioning system to enrich for spores that had altered hydrophobic properties and would therefore more readily partition to the aqueous phase. In a single cycle, ca. 65 to 75% of wild-type B. cereus spores partitioned into the hexadecane, whereas for the less hydrophobic B. subtilis spores the proportion was ca. 10%. Five cycles of hexadecane partition were carried out. Spores remaining in the aqueous layers after the fifth extraction (measured as 0.05% of the original concentration) were plated on NA and incubated at 30°C for 4 days to allow spore formation. Spores from individual colonies were then screened by light microscopy, using a crystal violet stain to help visualize the exosporium (9). Isolates that did not show normal exosporium staining (most commonly around 3% of the colonies checked, but varying from <1% to >20%) were then subcultured, and spores were harvested for checking by electron microscopy.

AM1605 was one of the isolated mutants. The altered hydrophobicity aimed for in the enrichment procedure was confirmed for this mutant (30% partition into hexadecane in one cycle, compared to 63% for the wild-type parent), but it cannot be specifically attributed to the exosporium, as the coat layers of this mutant were also no longer properly assembled onto the spore surface.

The exosporium defect and the transposon insertion in AM1605 were 100% linked in generalized transduction with the phage CP51ts, demonstrating that the transposon insertion was responsible for the exosporium defect. Electron micrographs of whole spores of AM1605 demonstrate the presence of partially detached exosporium material (Fig. 1). In thin sections (Fig. 2), spores lacking any coat or exosporium are seen, along with some spores associated with partly assembled but incomplete coat layers, surrounded by an exosporium.



View larger version (79K):
[in this window]
[in a new window]
 
FIG. 1. The exosporium of exsA mutants is not tightly attached. Whole spores of AM1605 (exsA) (image on left) are compared to those of the wild-type parent (image on right). Bars represent 0.2 µm.



View larger version (123K):
[in this window]
[in a new window]
 
FIG. 2. Coat and exosporium assembly are disrupted in an exsA mutant. Sections through AM1605 (exsA) (image on left) and wild-type (image on right) spores are shown. Bars represent 0.2 µm.

Identification of the site of transposon insertion in AM1605. Inverse PCR (15) was carried out using primers KB1 and KB2, and a product of approximately 600 bp was obtained. The DNA sequence of this product contained the 5' end of Tn917-LTV1 followed by genomic sequence, which was screened against the then-unfinished B. anthracis genome sequence of The Institute for Genomic Research (TIGR) (at www.tigr.org). The DNA region identified contained part of an open reading frame designated exsA, with a product having limited homology to the outer spore coat protein in B. subtilis named YrbA or SafA (18, 19, 34). The sequences flanking each end of the transposon insertion in AM1605 were recovered by standard PCR and sequenced. The point of insertion was 85 bp upstream of the predicted ExsA start codon, in the presumed promoter region. Another three independent mutants with insertions in the exsA open reading frame (SJT001, SJT002, and SJT006, interrupting after 339, 21, and 18 amino acid residues, respectively) were obtained from later experiments. All have similar defects as observed by electron microscopy (data not shown).

Characterization of the exsA region of B. cereus. The DNA sequence of a 3,893-bp region of the B. cereus ATCC 10876 genome was determined by sequencing of chromosomal PCR products. The gene organization was identical to those now reported for B. anthracis (24), B. cereus 14579 (10), and B. cereus 10987 (23); the 3' end of a nadA homologue is followed by a potential Rho-independent terminator. The exsA gene of B. cereus ATCC 10876 would encode a polypeptide of 643 amino acids and is followed by a potential Rho-independent terminator. The next gene downstream encodes a homologue of the B. subtilis outer spore coat protein, YrbB, and this gene is also followed by a possible Rho-independent transcriptional terminator. The same gene organization, nadBCA-safA-yrbB, is found in the B. subtilis genome.

The sequence of ExsA is rather unusual (Fig. 3). It contains an N-terminal region which shows 86% identity to B. subtilis SafA over the first 49 amino acids. This N terminus contains a LysM motif defining it as a cell wall or cortex binding domain (34), but the near identity to SafA in this region suggests that the domain may have functions in addition to that of generalized peptidoglycan binding. As in SafA, a short charged region (residues 50 to 57) is followed by a short sequence rich in alanine, proline, and glycine (residues 58 to 67). The rest of the two proteins are somewhat similar in composition rather than in sequence. Both contain segments relatively rich in proline, methionine, and tyrosine. ExsA contains several different tandem multiple sequence repeats, which are not present in SafA of B. subtilis. These are interspersed with more unique sequence (emphasized by the spacing in Fig. 3). The most extensive repeat sequence, IMDNNQPPNIMP (residues 354 to 521), is present 14 times and is five repeats longer than that reported in the corresponding gene product from the B. anthracis Ames genome sequence. After the repeat regions, there is again some similarity between ExsA and the B. subtilis SafA protein, from residue 581 to 643. In particular, the C terminus of ExsA (EEEDEEEV) is very negatively charged, as is that of SafA (EEENE). An EDCGC motif (residues 580 to 584) is found in an approximately equivalent position in the SafA sequence. Other Bacillus SafA homologues also show conservation in this C-terminal domain. The ExsA proteins encoded in B. anthracis, B. cereus ATCC 14579, and B. cereus ATCC 10987 are 96%, 98%, and 94% identical to ExsA of ATCC 10876, respectively, not including a general minor variation in the precise number of sequence repeats in each, as illustrated above.



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 3. Predicted sequence of ExsA from B. cereus ATCC 10876. This is laid out to emphasize the repeated regions. The residues immediately preceding interruption of the sequence in mutants AM1606 and AM1607 are underlined.

Mutations truncating the exsA gene in B. cereus. In strain AM1605, the transposon insertion is in the promoter region of exsA, so additional mutants in which the coding sequence is disrupted were constructed. The insertional vector pMUTIN4 has already been used to inactivate the gerN gene in B. cereus ATCC 10876 (35). A similar integrational inactivation approach, by single crossover between the chromosome and an internal region of the gene cloned in pMUTIN4, was employed using plasmids pMEX2 and pMEX3. Two separate mutants were generated: in AM1606 ExsA is interrupted after amino acid 318, and in AM1607 it is interrupted after amino acid 562 (Fig. 3).

Resistance and germination properties of exsA mutants. As would be expected for spores with gross spore coat defects, all three mutants were extremely sensitive to lysozyme (>90% of spores lysed within 10 min). In fact, the spores of exsA mutants were not stable, tending to lyse spontaneously on freezing and thawing. On addition of L-alanine or inosine to initiate germination of spores of mutant AM1605, OD was lost more slowly than in wild type, and spores became phase grey, but dipicolinic acid release and loss of heat resistance were equally fast in the wild type and the mutant (data not shown). This is characteristic of spores that have incomplete spore coats, as demonstrated for B. cereus (3). The precise reason for the block is not demonstrated, but such spores could lack the full complement of cortex lytic enzymes, such as the CwlJ protein in B. subtilis, which is extracted during coat removal (1, 4, 20).

Analysis of salt- and detergent-washed exosporium fractions. For wild-type spores, the exosporium can be detached from the rest of the spore by passing through a French press and then can be separated from spores on a Urografin density step gradient (37). Salt and detergent washing removes adsorbed proteins from the exosporium, and the final pellet should consist primarily of the integral components of the exosporium.

Exosporium fractions from wild-type B. cereus and the three exsA mutants AM1605, AM1605, and AM1607 were obtained and washed with salt and detergent. These exosporium fractions were obtained by French press treatment of spores, prepared as usual by multiple water washes; the yield of exosporium from the mutants was only 10% of that of from wild type (a large proportion of the exosporium material is presumably lost in the original spore washing process). Proteins in the fractions were separated on a 12% SDS-polyacrylamide gel and stained with Sypro Ruby (Fig. 4). The wild-type profile is slightly different from those of the three mutants. There are also minor differences between these mutants; the profiles of the two truncated mutants AM1606 and AM1607 are similar but differ from that of AM1605, the mutant with a transposon insertion in the promoter region. The nature of the differences has not been defined, as the amount of material available was insufficient for N-terminal sequencing. The band at >205 kDa, which was characterized in wild-type extracts as containing at least the glycoprotein ExsJ (37), is still present in all four strains. BclA, the major glycoprotein antigen reported for B. anthracis (30), was detected by Western blotting in very-high-molecular-weight material and, after deglycosylation, as a band at ca. 40 kDa, in both wild-type and mutant fractions (Fig. 5).



View larger version (108K):
[in this window]
[in a new window]
 
FIG. 4. Exosporium proteins of the wild type and exsA mutants. Proteins were separated by SDS-PAGE and visualized with Sypro Ruby. Lane 1, wild type (B. cereus ATCC 10876); lane 2, AM1605; lane 3, AM1606; lane 4, AM1607; lanes 5 and 6, low- and high-range molecular mass markers (Sigma), respectively.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5. Western blots of SDS-PAGE-separated exosporium before and after deglycosylation. Blots were probed with an anti-BclA antibody provided by J. F. Kearney (28). Lane 1, wild type; lane 2, AM1605; lane 3, wild type, deglycosylated; lane 4, AM1605, deglycosylated. Lanes 1 and 2 contained 30 and 18 µg protein, respectively.

Total glycoprotein staining of the exosporium fractions (Fig. 6) confirmed that the absence of ExsA does not prevent insertion of glycoprotein into the exosporium.



View larger version (73K):
[in this window]
[in a new window]
 
FIG. 6. Glycoprotein-stained exosporium proteins. After separation by SDS-PAGE, glycoproteins were visualized on polyvinylidene difluoride blots by using the ECL glycoprotein detection kit (Amersham). Lane 1, AM1605; lane 2, wild type; lane 3, AM1605, deglycosylated; lane 4, wild type, deglycosylated.

Expression of ExsA is sporulation specific. The insertion of pMUTIN4 also created a lacZ transcriptional reporter fusion downstream of the exsA promoter. In a culture of AM1606 cells sporulating synchronously at 30°C, exsA was expressed from 2 h after the initiation of sporulation, before the appearance of phase-bright forespores (Fig. 7). The ß-galactosidase was not trapped in mature spores—activity in spores, assayed after germinating them in the presence of chloramphenicol to inhibit any de novo protein synthesis, was <0.2% of the t10 value—suggesting that expression was occurring only in the mother cell, not in the forespore. The early time of expression and the mother cell location would be consistent with sigma E-dependent expression, as reported for safA in B. subtilis (18, 34). Identification of the transcriptional start point was not undertaken, but the necessary regulatory region must extend at least 85 bp upstream of the translational start point, because a transposon insertion at this position interfered with gene function. This upstream region is well conserved in the sequenced B. cereus and B. anthracis strains, except that in B. anthracis Ames, at 135 bp upstream, there is an insertion of a ca. 240-bp element. This element is found in multiple copies in the genome, and as the Ames strain makes a functional coat and exosporium, this presumably lies upstream of the essential promoter region.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 7. Expression of exsA during synchronous sporulation. This was estimated using the ß-galactosidase reporter activity of AM1606, which carries an exsA-lacZ transcriptional fusion. Time zero corresponds to the synchronous transfer of the cells to sporulation medium. Circles represent LacZ specific activity (picomoles of methylumbelliferone produced/minute/OD unit); open circles are for reporter strain AM1606, and closed circles are for the wild-type UM20.1 parent. Aliquots of the sporulating cells were visualized by light microscopy to estimate the percentage containing phase-grey or phase-bright forespores (represented as closed squares).


arrow
DISCUSSION
 
By using a screen for altered spore hydrophobicity, a mutant with a gross defect in assembly of exosporium onto the surface of the spore has been isolated, demonstrating the importance of ExsA for spore coat and exosporium assembly in B. cereus. Interruption of the open reading frame to generate C-terminal truncations results in mutants with the same morphological defect seen in the original promoter mutant, but the pattern of proteins found in the exosporium fraction is slightly different. This suggests that there may be differences with respect to the assembly of a small number of exosporium proteins, but these have not been identified in this study. The mutants are difficult to work with, as the spores are particularly unstable, and large quantities of exosporium are difficult to obtain.

The exosporium was certainly not normal—it looked slightly thinner and was not usually shaped around the spore but extended as looser material. In sections, many spores either lacked coat layers or the coat layers were detached but still spore associated.

The ExsA protein is related to the SafA (SpoVID-associated factor) protein of B. subtilis, which interacts with SpoVID during the early stages of coat assembly (19). Both SpoIVA and SpoVID are required for SafA localization, and homologues of both are encoded in the B. cereus genome, so by analogy one would predict that they are similarly required for assembly of ExsA. SpoIVA is closely conserved (88% amino acid identity for B. cereus versus B. subtilis), whereas SpoVID is less conserved. The N- and C-terminal domains of SpoVID are similar, but the glutamate-rich central domain is variable in both sequence and size across the bacilli.

ExsA seems to be more critical in B. cereus than SafA is in B. subtilis, in that a less extreme coat assembly defect has been reported for B. subtilis safA mutants. Like the exsA mutants, safA mutant spores were sensitive to lysozyme, but their spore structure appeared rather less disturbed. In thin sections of safA spores, the outer layer of the spore coat was less electron dense and less thick, and a separate loose layer surrounded the coat (34). The spore coats in a B. cereus exsA mutant, in contrast (Fig. 2), appear very incomplete and only partially assembled.

A number of spore coat proteins, including CotG, are absent from the coat layers of a safA mutant (34); a direct comparison with the consequences of exsA mutation is not possible, as only exosporium profiles, not total coat profiles, have been compared for exsA mutants. However, to speculate, the ExsB protein of B. cereus, which is encoded in the genomic location in B. cereus that is equivalent to CotG in B. subtilis and has some similarity to CotG (37), could be absent in the mutants with a truncated ExsA, according to the data in Fig. 4; its expected position would be at ca. 29 kDa (37).

SafA in B. subtilis is found in two forms. The shorter form derives from both an internal translational start within the safA gene (17) and, apparently, proteolytic processing by the YabG protease (32, 33), a conserved homologue of which is encoded in the B. cereus genome. Western blotting would be required to identify the size of the ExsA protein in B. cereus, to demonstrate whether it is present in both full-size and shorter forms.

The remaining, loosely attached exosporium material still contained many of the proteins found in the profile of this layer. In particular, the BclA glycoprotein was still present. BclA is not the only glycoprotein in the exosporium of the wild-type parent strain ATCC 10876—ExsJ was described by Todd et al. (37)—so at least two glycoproteins are represented in the wild type. In fact, the glycoprotein stain detected material in the protein profile that had run further into the gel than the material detected by Western blotting as BclA, suggesting again that BclA may not be the only contributor to this glycoprotein profile.

The ExsA protein is very different in amino acid sequence from SafA, apart from N-terminal and C-terminal regions. Given the large differences in sequence between SafA and ExsA, local regions of conservation are likely to be significant for functions conserved in both SafA and ExsA, and could be explored by directed mutagenesis in B. subtilis. The multiple proline-rich tandem repeat sequences in ExsA are likely to be in an extended conformation, but their function is not known—they either could be repetitive regions for binding of other coat proteins or could act as spacers between regions that bind other coat proteins. Speculatively, this could be a mechanism to provide some distance between integument layers, but it would not be obvious why there should be three such regions, each with its own sequence repeat. The number of repeats in genome sequences of different species and strains in the B. cereus/B. anthracis/B. thuringiensis cluster vary slightly, but the sequences are otherwise almost identical. In both the Bacillus halodurans and Oceanobacillus iheyensis genome sequences, the encoded SafA homologues also contain multiple short repeats, whose sequence is not conserved between species, but they are not as extensive as in B. cereus, and again, their significance is unknown.

It is possible that the exosporium defect in the exsA mutants is an indirect consequence of the failure to properly assemble coat layers. However, the protein composition of the exosporium in the wider B. cereus family is now being clarified, and it contains novel proteins (for example BclA, ExsF, BxpA, and ExsK), as well as some that are clearly related to B. subtilis coat proteins (such as a CotB homologue, the CotG analogue ExsB, and CotY/Z homologues) (25, 28, 30, 37). It may be reasonable to consider the exosporium to be a specialized and further decorated outer coat layer, that is, like other coat layers in B. cereus, dependent on the ExsA protein and its interacting partner SpoVID for anchoring to the spore.


arrow
ACKNOWLEDGMENTS
 
We thank J. Kearney for supplying antibodies, Sue Charlton for introducing K.B.-S. to the technologies for exosporium research, and Les Baillie, DSTL, for advice and support. We thank TIGR for access to the unfinished genomic sequence of B. anthracis.

This work was funded by a BBSRC CASE studentship award with DSTL, Porton Down, to K.B.-S. (DSTL contract CU013-14228) and by BBSRC project grant D11666.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Biology and Biotechnology, University of Sheffield, Western Bank, Sheffield S10 2TN, United Kingdom. Phone: 44 114 2224418. Fax: 44 1142222800. E-mail: a.moir{at}sheffield.ac.uk. Back

{dagger} Present address: School of Science and Mathematics, Sheffield Hallam University, Sheffield S1 1WB, United Kingdom. Back


arrow
REFERENCES
 
    1
  1. Bagyan, I., and P. Setlow. 2002. Localization of the cortex lytic enzyme CwlJ in spores of Bacillus subtilis. J. Bacteriol. 184:1219-1224.[Abstract/Free Full Text]
  2. 2
  3. Barlass, P. J., C. W. Houston, M. O. Clements, and A. Moir. 2002. Germination of Bacillus cereus spores in response to L-alanine and to inosine: the roles of gerL and gerQ operons. Microbiology 148:2089-2095.[Abstract/Free Full Text]
  4. 3
  5. Behravan, J., H. Chirakkal, A. Masson, and A. Moir. 2000. Mutations in the gerP locus of Bacillus subtilis and Bacillus cereus affect access of germinants to their targets in spores. J. Bacteriol. 182:1987-1994.[Abstract/Free Full Text]
  6. 4
  7. Boland, F. M., A. Atrih, H. Chirakkal, S. J. Foster, and A. Moir. 2000. Complete spore-cortex hydrolysis during germination of Bacillus subtilis 168 requires SleB and YpeB. Microbiology 146:57-64.[Abstract/Free Full Text]
  8. 5
  9. Bone, E. J., and D. J. Ellar. 1989. Transformation of Bacillus thuringiensis by electroporation. FEMS Lett. 58:171-178.
  10. 6
  11. Camilli, A., D. A. Portnoy, and P. Youngman. 1990. Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions. J. Bacteriol. 172:3738-3744.[Abstract/Free Full Text]
  12. 7
  13. Charlton, S., A. J. G. Moir, L. Baillie, and A. Moir. 1999. Characterization of the exosporium of Bacillus cereus. J. Appl. Microbiol. 87:241-245.[CrossRef][Medline]
  14. 8
  15. Clements, M. O., and A. Moir. 1998. Role of the gerI operon of Bacillus cereus 569 in the response of spores to germinants. J. Bacteriol. 180:6729-6735.[Abstract/Free Full Text]
  16. 9
  17. Gerhardt, P., and E. Ribi. 1964. Ultrastructure of the exosporium enveloping spores of Bacillus cereus. J. Bacteriol. 88:1774-1789.[Abstract/Free Full Text]
  18. 10
  19. Ivanova, N., A. Sorokin, I. Anderson, N. Galleron, B. Candelon, V. Kapatral, A. Bhattacharyya, G. Reznik, N. Mikhailova, A. Lapidus, L. Chu, M. Mazur, E. Goltsman, N. Larsen, M. D'Souza, T. Walunas, Y. Grechkin, G. Pusch, R. Haselkorn, M. Fonstein, S. D. Ehrlich, R. Overbeek, and N. Kyrpides. 2003. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423:87-91.[CrossRef][Medline]
  20. 11
  21. Koshikawa, T., M. Yamazaki, M. Yoshimi, S. Ogawa, A. Yamada, K. Watabe, and M. Torii. 1989. Surface hydrophobicity of spores of Bacillus spp. J. Gen. Microbiol. 135:2717-2722.[Abstract/Free Full Text]
  22. 12
  23. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  24. 13
  25. Leatherbarrow, A. J. H., M. A. Yazdi, J. P. Curson, and A. Moir. 1998. The gerC locus of Bacillus subtilis, required for menaquinone biosynthesis, is concerned only indirectly with spore germination. Microbiology 144:2125-2130.[Abstract/Free Full Text]
  26. 14
  27. Matz, L. L., T. C. Beaman, and P. Gerhardt. 1970. Chemical composition of exosporium from spores of Bacillus cereus. J. Bacteriol. 101:196-201.[Abstract/Free Full Text]
  28. 15
  29. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain-reaction. Genetics 120:621-623.[Abstract/Free Full Text]
  30. 16
  31. Ohye, D. F., and W. G. Murrell. 1973. Exosporium and spore coat formation in Bacillus cereus T. J. Bacteriol. 115:1179-1190.[Abstract/Free Full Text]
  32. 17
  33. Ozin, A. J., T. Costa, A. O. Henriques, and C. P. Moran. 2001. Alternative translation initiation produces a short form of a spore coat protein in Bacillus subtilis. J. Bacteriol. 183:2032-2040.[Abstract/Free Full Text]
  34. 18
  35. Ozin, A. J., A. O. Henriques, H. Yi, and C. P. Moran. 2000. Morphogenetic proteins SpoVID and SafA form a complex during assembly of the Bacillus subtilis spore coat. J. Bacteriol. 182:1828-1833.[Abstract/Free Full Text]
  36. 19
  37. Ozin, A. J., C. S. Samford, A. O. Henriques, and C. P. Moran. 2001. SpoVID guides SafA to the spore coat in Bacillus subtilis. J. Bacteriol. 183:3041-3049.[Abstract/Free Full Text]
  38. 20
  39. Paidhungat, M., K. Ragkousi, and P. Setlow. 2001. Genetic requirements for induction of germination of spores of Bacillus subtilis by Ca2+-dipicolinate. J. Bacteriol. 183:4886-4893.[Abstract/Free Full Text]
  40. 21
  41. Peterson, G. L. 1977. A simplification of the protein assay of Lowry which is more generally applicable. Anal. Biochem. 83:346-356.[CrossRef][Medline]
  42. 22
  43. Radnedge, L., P. G. Agron, K. K. Hill, P. J. Jackson, L. O. Ticknor, P. Keim, and G. L. Andersen. 2003. Genome differences that distinguish Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis. Appl. Environ. Microbiol. 69:2755-2764.[Abstract/Free Full Text]
  44. 23
  45. Rasko, D. A., J. Ravel, O. A. Okstad, E. Helgason, R. Z. Cer, L. X. Jiang, K. A. Shores, D. E. Fouts, N. J. Tourasse, S. V. Angiuoli, J. Kolonay, W. C. Nelson, A. B. Kojsto, C. M. Fraser, and T. D. Read. 2004. The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res. 32:977-988.[Abstract/Free Full Text]
  46. 24
  47. Read, T. D., S. N. Peterson, N. Tourasse, L. W. Baillie, I. T. Paulsen, K. E. Nelson, H. Tettelin, D. E. Fouts, J. A. Eisen, S. R. Gill, E. K. Holtzapple, O. A. Okstad, E. Helgason, J. Rilstone, M. Wu, J. F. Kolonay, M. J. Beanan, R. J. Dodson, L. M. Brinkac, M. Gwinn, R. T. DeBoy, R. Madpu, S. C. Daugherty, A. S. Durkin, D. H. Haft, W. C. Nelson, J. D. Peterson, M. Pop, H. M. Khouri, D. Radune, J. L. Benton, Y. Mahamoud, L. X. Jiang, I. R. Hance, J. F. Weidman, K. J. Berry, R. D. Plaut, A. M. Wolf, K. L. Watkins, W. C. Nierman, A. Hazen, R. Cline, C. Redmond, J. E. Thwaite, O. White, S. L. Salzberg, B. Thomason, A. M. Friedlander, T. M. Koehler, P. C. Hanna, A. B. Kolsto, and C. M. Fraser. 2003. The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423:81-86.[CrossRef][Medline]
  48. 25
  49. Redmond, C., L. W. J. Baillie, S. Hibbs, A. J. G. Moir, and A. Moir. 2004. Identification of proteins in the exosporium of Bacillus anthracis. Microbiology 150:355-363.[Abstract/Free Full Text]
  50. 26
  51. Sousa, J. C. F., M. T. Silva, and G. Balassa. 1976. An exosporium-like outer layer in Bacillus subtilis spores. Nature 263:53-54.[CrossRef][Medline]
  52. 27
  53. Staden, R. 1990. Finding protein coding regions in genomic sequences. Methods Enzymol. 183:163-180.[Medline]
  54. 28
  55. Steichen, C., P. Chen, J. F. Kearney, and C. L. Turnbough. 2003. Identification of the immunodominant protein and other proteins of the Bacillus anthracis exosporium. J. Bacteriol. 185:1903-1910.[Abstract/Free Full Text]
  56. 29
  57. Sterlini, J. M., and J. Mandelstam. 1969. Commitment to sporulation in Bacillus subtilis and its relationship to development of actinomycin resistance. Biochem J. 113:29-37.[Medline]
  58. 30
  59. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2002. A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol. Microbiol. 45:169-178.[CrossRef][Medline]
  60. 31
  61. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2003. Polymorphism in the collagen-like region of the Bacillus anthracis BclA protein leads to variation in exosporium filament length. J. Bacteriol. 185:1555-1563.[Abstract/Free Full Text]
  62. 32
  63. Takamatsu, H., A. Imamura, T. Kodama, K. Asai, N. Ogasawara, and K. Watabe. 2000. The yabG gene of Bacillus subtilis encodes a sporulation specific protease which is involved in the processing of several spore coat proteins. FEMS Microbiol. Lett. 192:33-38.[CrossRef][Medline]
  64. 33
  65. Takamatsu, H., T. Kodama, A. Imamura, K. Asai, K. Kobayashi, T. Nakayama, N. Ogasawara, and K. Watabe. 2000. The Bacillus subtilis yabG gene is transcribed by SigK RNA polymerase during sporulation, and yabG mutant spores have altered coat protein composition. J. Bacteriol. 182:1883-1888.[Abstract/Free Full Text]
  66. 34
  67. Takamatsu, H., T. Kodama, T. Nakayama, and K. Watabe. 1999. Characterization of the yrbA gene of Bacillus subtilis, involved in resistance and germination of spores. J. Bacteriol. 181:4986-4994.[Abstract/Free Full Text]
  68. 35
  69. Thackray, P. D., J. Behravan, T. W. Southworth, and A. Moir. 2001. GerN, an antiporter homologue important in germination of Bacillus cereus endospores. J. Bacteriol. 183:476-482.[Abstract/Free Full Text]
  70. 36
  71. Thorne, C. B. 1968. Transducing bacteriophage for Bacillus cereus. J. Virol. 2:657-662.[Abstract/Free Full Text]
  72. 37
  73. Todd, S. J., A. J. G. Moir, M. J. Johnson, and A. Moir. 2003. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. J. Bacteriol. 185:3373-3378.[Abstract/Free Full Text]
  74. 38
  75. Vagner, V., E. Dervyn, and S. D. Ehrlich. 1998. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144:3097-3104.[Abstract/Free Full Text]


Journal of Bacteriology, June 2005, p. 3800-3806, Vol. 187, No. 11
0021-9193/05/$08.00+0     doi:10.1128/JB.187.11.3800-3806.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Senior, A., Moir, A. (2008). The Bacillus cereus GerN and GerT Protein Homologs Have Distinct Roles in Spore Germination and Outgrowth, Respectively. J. Bacteriol. 190: 6148-6152 [Abstract] [Full Text]  
  • Brahmbhatt, T. N., Janes, B. K., Stibitz, E. S., Darnell, S. C., Sanz, P., Rasmussen, S. B., O'Brien, A. D. (2007). Bacillus anthracis Exosporium Protein BclA Affects Spore Germination, Interaction with Extracellular Matrix Proteins, and Hydrophobicity. Infect. Immun. 75: 5233-5239 [Abstract] [Full Text]  
  • Thompson, B. M., Waller, L. N., Fox, K. F., Fox, A., Stewart, G. C. (2007). The BclB Glycoprotein of Bacillus anthracis Is Involved in Exosporium Integrity. J. Bacteriol. 189: 6704-6713 [Abstract] [Full Text]  
  • Giorno, R., Bozue, J., Cote, C., Wenzel, T., Moody, K.-S., Mallozzi, M., Ryan, M., Wang, R., Zielke, R., Maddock, J. R., Friedlander, A., Welkos, S., Driks, A. (2007). Morphogenesis of the Bacillus anthracis Spore. J. Bacteriol. 189: 691-705 [Abstract] [Full Text]  
  • Costa, T., Isidro, A. L., Moran, C. P. Jr., Henriques, A. O. (2006). Interaction between Coat Morphogenetic Proteins SafA and SpoVID. J. Bacteriol. 188: 7731-7741 [Abstract] [Full Text]  
  • Johnson, M. J., Todd, S. J., Ball, D. A., Shepherd, A. M., Sylvestre, P., Moir, A. (2006). ExsY and CotY Are Required for the Correct Assembly of the Exosporium and Spore Coat of Bacillus cereus. J. Bacteriol. 188: 7905-7913 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bailey-Smith, K.
Right arrow Articles by Moir, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bailey-Smith, K.
Right arrow Articles by Moir, A.