This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE

 Previous Article  |  Next Article 

Journal of Bacteriology, June 2005, p. 3960-3968, Vol. 187, No. 12
0021-9193/05/$08.00+0     doi:10.1128/JB.187.12.3960-3968.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Transcriptional Regulation of the Flavohemoglobin Gene for Aerobic Nitric Oxide Detoxification by the Second Nitric Oxide-Responsive Regulator of Pseudomonas aeruginosa

Hiroyuki Arai,* Michiko Hayashi, Azusa Kuroi, Masaharu Ishii, and Yasuo Igarashi

Department of Biotechnology, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan

Received 5 February 2005/ Accepted 9 March 2005


arrow
ABSTRACT
 
The regulatory gene for a {sigma}54-dependent-type transcriptional regulator, fhpR, is located upstream of the fhp gene for flavohemoglobin in Pseudomonas aeruginosa. Transcription of fhp was induced by nitrate, nitrite, nitric oxide (NO), and NO-generating reagents. Analysis of the fhp promoter activity in mutant strains deficient in the denitrification enzymes indicated that the promoter was regulated by NO or related reactive nitrogen species. The NO-responsive regulation was operative in a mutant strain deficient in DNR (dissimilatory nitrate respiration regulator), which is the NO-responsive regulator required for expression of the denitrification genes. A binding motif for {sigma}54 was found in the promoter region of fhp, but an FNR (fumarate nitrate reductase regulator) box was not. The fhp promoter was inactive in the fhpR or rpoN mutant strain, suggesting that the NO-sensing regulation of the fhp promoter was mediated by FhpR. The DNR-dependent denitrification promoters (nirS, norC, and nosR) were active in the fhpR or rpoN mutants. These results indicated that P. aeruginosa has at least two independent NO-responsive regulatory systems. The fhp or fhpR mutant strains showed sensitivity to NO-generating reagents under aerobic conditions but not under anaerobic conditions. These mutants also showed significantly low aerobic NO consumption activity, indicating that the physiological role of flavohemoglobin in P. aeruginosa is detoxification of NO under aerobic conditions.


arrow
INTRODUCTION
 
Nitric oxide (NO) plays a key role in a wide variety of biological processes (9). Microbiologically, NO is known as an intermediate of denitrification. Denitrifying bacteria and nitrogen-dissimilating fungi produce NO from nitrite by dissimilatory nitrite reductase (NIR). The produced NO is immediately reduced to nitrous oxide (N2O) by NO reductase (NOR). This process utilizes NO as a terminal electron acceptor for anaerobic respiration. NOR enzymes of Pseudomonas, Paracoccus, and Rhodobacter species are two-component membrane-bound cytochrome bc complexes (NorCB) that are evolutionarily related to the family of heme-copper oxidases for aerobic respiration (6, 8, 33, 50). Ralstonia eutropha and Neisseria species have single-component-type NOR enzymes designated as qNor. qNor is similar to NorCB but lacks the cytochrome c moiety and receives electrons directly from quinols (10, 30). Analysis of finished and unfinished genome sequences showed that some nondenitrifying pathogens have the genes for qNor, suggesting that the enzyme plays a role in escaping host defense by detoxification of NO. Flavohemoglobin, which has NO dioxygenase (NOD) activity under aerobic conditions and NOR activity under anaerobic conditions, is also known to be involved in detoxification of NO (42). Flavohemoglobin is distributed among a wide variety of prokaryotic and eukaryotic microorganisms. The protein comprises two domains: the N-terminal heme-binding domain and the C-terminal flavin-containing domain. In Escherichia coli, the gene for flavohemoglobin is upregulated by NO and nitrosative stresses (38, 41). Recently, some other types of NO-detoxifying proteins, such as cytochrome c' and flavorubredoxin, have been reported (12, 23). The activity counteracting NO toxicity may be important for the survival of many bacteria.

Expression of NO-detoxifying enzymes is usually upregulated by NO. NorCB and other denitrification enzymes are under the control of NO-responsive transcriptional regulators that belong to the cyclic AMP receptor protein (CRP)/FNR (fumarate nitrate reductase regulator) family, such as DNR (dissimilatory nitrate respiration regulator) of Pseudomonas aeruginosa, DnrD of Pseudomonas stutzeri, NNR of Paracoccus denitrificans, and NnrR of Rhodobacter sphaeroides (1, 2, 47, 51, 54). They are phylogenetically classified in two distinct subgroups, DNR type and NnrR type, in the CRP/FNR superfamily (36, 53). Expression of qNor of R. eutropha is regulated by another type of NO-responsive regulator, NorR, which belongs to the {sigma}54-dependent family of transcriptional activators (40). NorR was also found in E. coli and shown to activate the expression of flavorubredoxin in response to NO and reactive nitrogen species (RNS). Flavorubredoxin also has NOR activity, and its gene (norV) is divergently transcribed from the norR gene (14, 22, 23, 31).

P. aeruginosa is an opportunistic pathogen and reduces nitrate to N2 by denitrification under anaerobic conditions. We have reported that the nirS, norC, and nosR promoters for denitrification enzymes NIR, NorCB-type NOR, and N2O reductase (N2OR), respectively, are induced in the presence of NO under the control of DNR (1, 3, 4). Expression of these denitrification genes is limited to anaerobic or low-oxygen conditions. The induction by oxygen depletion is regulated by ANR, which is a global regulator for anaerobic gene expression in P. aeruginosa and is a functional analogue of FNR of E. coli (20). Both ANR and DNR belong to the CRP/FNR family of transcriptional regulators and activate a synthetic promoter that has a consensus FNR-binding motif (26). However, the promoters of the denitrification genes, which have sequences similar to the FNR-binding motif, are activated only by DNR, but not by ANR. Expression of DNR is under the control of ANR. Thus, the ANR-mediated anaerobic induction of the denitrification genes is an indirect event that occurs by way of DNR (2). A genomic analysis of P. aeruginosa strain PAO1 has shown that the strain also has the gene encoding flavohemoglobin (fhp, PA2664). A regulatory gene, PA2665 (fhpR), is located upstream of fhp in a divergent direction. fhpR is similar to the norR genes, which regulate NO-responsive expression of qNor in R. eutropha and flavorubredoxin in E. coli (31, 40). These findings suggested that the fhp gene cluster is involved in denitrification and/or NO metabolism in P. aeruginosa. The consensus FNR-binding motif is not located in the fhp promoter region between fhp and fhpR, indicating that the expression of fhp is independent of DNR or ANR. In this work, we report that the fhp promoter is upregulated by NO in an FhpR-dependent manner and that FhpR and DNR independently mediate NO-responsive regulation of their target promoters. We also report that the fhp gene product plays a role in inducible resistance to NO under aerobic conditions.


arrow
MATERIALS AND METHODS
 
Bacterial strains and growth media. The bacterial strains and plasmids used in this study are described in Table 1. Cells were routinely grown in tryptic soy broth (Difco, Detroit, MI) or Luria-Bertani (LB) medium at 37°C. A synthetic medium described by Wood (56) was used for the promoter assay to analyze the effect of inducers. A minimal medium (VB medium) (10.0 g of K2HPO4, 3.5 g of NaH2PO4, 0.4 g of MgSO4, 4.0 g of citric acid, 5.0 g of glucose, and 2.1 g of NH4Cl per liter, pH 7.2), which was modified from the medium described by Vogel and Bonner (52), was used for the assay of NO tolerance. The concentrations of the antibiotics were as follows (µg/ml): ampicillin, 100, and tetracycline (Tc), 12.5, for E. coli and carbenicillin, 200, and Tc, 150, for P. aeruginosa. When necessary, sodium nitrate, sodium nitrite, sodium nitroprusside (SNP), or S-nitrosoglutathione (GSNO) was added to the medium. NO was added to the headspace of the cultivation vial using a gastight syringe. SNP and GSNO were purchased from Kanto Chemical (Tokyo, Japan) and Wako (Osaka, Japan), respectively, and dissolved in 50 mM MOPS (morpholinopropanesulfonic acid) just before use. NO was purchased from Suzuki Shokan (Tokyo, Japan).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Bacterial strains and plasmids used in this study

DNA manipulations. The recombinant DNA experiments were carried out by standard methods (43). Introduction of DNA into P. aeruginosa strains was carried out by electroporation with a Cell-Porator (BRL Life Technologies Inc., Gaithersburg, MD). Restriction and modification enzymes were purchased from Toyobo (Osaka, Japan) or Takara (Kyoto, Japan). EX Taq (Takara) was used for the PCRs. Synthetic oligonucleotides were prepared by SIGMA Genosis (Hokkaido, Japan).

Construction of lacZ fusion plasmids and ß-galactosidase assay. pFH56, which carries a transcriptional fusion of the fhp promoter region and lacZ, was constructed as follows. An 0.7-kb fragment containing the promoter region between fhp and fhpR was amplified from chromosomal DNA of strain PAO1 by PCR with oligonucleotides hmp5 (GTAGGGATCCGGCAGGCCGCAGTC) and hmp6 (GAGACAAGCTTGTTCACCACCTTG), which are designed to introduce the BamHI and HindIII sites, respectively. The amplified fragment was digested with BamHI and HindIII and inserted into the corresponding sites of the lacZ promoter probe vector pQF50 (16). P. aeruginosa strains were transformed with pFH56 by electroporation. The ß-galactosidase assay was performed by the standard protocol after cultivation for 16 h (43).

For the aerobic cultivation, we used Sakaguchi flasks (flat bottomed with long necks) with gas-permeable plugs (silico plugs). An oxygen-limiting condition was used as a substitute for the anaerobic condition because P. aeruginosa strains could not grow and therefore showed very low ß-galactosidase activity under anaerobic conditions in the absence of terminal electron acceptors or by the disruption of the denitrification genes. For the oxygen-limiting condition, we used a vial (70-ml total volume) containing 20 ml of medium. After inoculation of 200 µl of aerobically grown culture, the vial was fitted with a butyl rubber septum and an aluminum seal. The air in the vial was replaced with argon by flushing the gas through a needle, and oxygen was added into the vial to a concentration of 2% (1 ml) with a gastight syringe. Cultivation was done by gentle shaking. Addition of a small amount of oxygen made the cells grow and produce energy for the expression of ß-galactosidase under a low-oxygen condition until oxygen was consumed.

Construction of mutant strains. Mutant strains of P. aeruginosa were constructed from strain PAO1 by insertion of the Tc resistance gene (tet) by homologous recombination using plasmids that carry disrupted genes. The method of homologous recombination was described previously (5). The fhpR strain PFM4302 was constructed as follows. A 2.2-kb fragment carrying fhpR was amplified by PCR from chromosomal DNA of strain PAO1 with oligonucleotides hmp3 (GACTCCTGACGCATGCAAGG) and hmp4 (CCGTTCTAGAGCAGATGGCG). The latter was designed to introduce an XbaI site. The amplified fragment was digested with SphI and XbaI and inserted into the respective sites of pUC19. The fhpR gene on the resultant plasmid was disrupted by digestion with SalI, end blunting, and ligation with a blunt-ended 1.4-kb EcoRI-AvaI fragment of pBR322, which carried the tet gene, resulting in pFT4302. After strain PAO1 was transformed with pFT4302, a Tc-resistant and carbenicillin-sensitive strain, in which the fhpR gene on the chromosome was replaced with the plasmid-derived disrupted gene by double crossover recombination, was selected and designated strain PFM4302. The mutation was confirmed by PCR (data not shown).

The rpoN strain RN102 was constructed in the same way with plasmid pRNT102. The plasmid was constructed by amplification of a 2.4-kb fragment carrying rpoN with oligonucleotides RpoN1 (TCGCAACGGTCGCAAGGAAGCCCTGG) and RpoN2 (GCAGGGAAGCTTCGATCTTCTGCTTC), ligation of the PCR fragment with pUC18 after digestion with EcoRI and HindIII, and insertion of the tet gene into the rpoN gene at the SacI site. The nirS strain RM488, which was used in previous works (3, 4, 34, 35), was constructed in the same way by using pHA488, which was constructed by putting the tet gene between a 1.5-kb SphI fragment containing the 5' region of nirS and a 2.0-kb EcoRV fragment containing the 3' region of nirS on pUC119.

For construction of the fhp mutant strain PDM2664, which has no antibiotic resistance maker, the Flp-FRT recombination system was used (28). At first, a 2.7-kb fragment carrying fhp and following two genes was amplified with oligonucleotides hmp12 (CAAAACCTTGGATCCGTCAGGAGTC) and hmp15 (ACCAGAAGCTTCGGCGTCTGCGGC) from chromosomal DNA of strain PAO1 and the fragment was ligated with pUC18 after digestion with BamHI and HindIII, resulting in pHA1501. A 1.4-kb EcoRI-AvaI fragment of pBR322, which carried the tet gene, was inserted between the two Flp recognition targets (FRT) of pPS854 (28) at EcoRI and EcoRV sites after the AvaI end was blunted. The tet-FRT cassette from the constructed plasmid pPS854tet was cut out by SacI, end blunted, and inserted at the unique Bpu1102I site in the fhp gene on pHA1501. The resulting plasmid, pDM2664, was used for construction of the fhp mutant by homologous recombination as described above. The tet gene on the chromosome of the mutant, in which the fhp gene was disrupted by insertion of the tet-FRT cassette, was removed by transformation with an Flp recombinase-expressing plasmid, pFLP2 (28). pFLP2 was cured from the mutant by plating cells on tryptic soy broth agar plates containing 5% sucrose. The constructed mutant strain PDM2664 carries the fhp gene disrupted by insertion of a single FRT cassette. The mutation was confirmed by PCR and Southern hybridization (data not shown). pHA1512, which was used for complementation of the fhp mutant, was constructed by insertion of a 1.2-kb fhp-containing PCR fragment amplified with oligonucleotides hmp12 and hmp13 (CCGAAAAAGGGTCGACGCACCTCGC) into pMMB67EH after digestion with BamHI and SalI.

RNA extraction and primer extension analysis. Strain PAO1 was cultivated anaerobically in LB medium supplemented with 5 mM sodium nitrite. Total RNA was isolated at mid-log phase by using ISOGEN (Nippon Gene, Toyama, Japan) according to the instructions of the manufacturer and was treated with RNase-free DNase (Nippon Gene). The primer extension reaction was performed with Superscript II (GibcoBRL, Grand Island, NY). The oligonucleotide primers used for the reaction were hmp9 (AGAAATGGGTGATCAGCGCTTCACC) and hmp10 (GCGTTCGTCTTCCGGCAGGTCGCGG), which were complementary to the mRNAs of fhp and fhpR, respectively. The primers were labeled with [{gamma}-32P]ATP (Amersham Pharmacia Biotech) by T4 polynucleotide kinase. The labeled primers and RNA were annealed at 70°C for 10 min. Extension was carried out at 42°C for 30 min. The primer extension products were compared on an 8% polyacrylamide-6 M urea gel with the products of sequence reactions made with the same primers. A pUC18-derivative plasmid that carried the fhp promoter region was used as a template for the sequence reactions.

Assay of NO tolerance and NO consumption activity. For investigation of NO tolerance, cells were grown in 200 µl of VB medium for aerobic conditions or LB supplemented with 40 mM of sodium nitrate for anaerobic conditions in 96-well plates at 37°C. NO donors were added to the medium. The medium was covered with a layer of liquid paraffin for the anaerobic condition. The growth was monitored by turbidity at 590 nm with an EMax precision microplate reader (Molecular Devices, Sunnyvale, CA).

NO consumption activity was measured amperometrically using an Apollo 4000 free radical analyzer equipped with a 2-mm ISO-NOP NO electrode (WPI, Sarasota, FL) according to the method described by Gardner and Gardner (21). Cells were grown in 20 ml of LB medium supplemented with 3 mM SNP to an absorbance of 0.6 at 600 nm, washed with 50 mM potassium phosphate buffer (pH 7.0), and resuspended in 1 ml of the same buffer. The aerobic reaction was performed in a multiport measurement chamber (WPI) containing 2 ml of reaction buffer [50 mM NaH2PO4, 7.6 mM (NH4)2SO4, and 1.7 mM sodium citrate] at 37°C. Two microliters of NO-saturated water was added to the reaction buffer (final NO concentration was about 2 µM), 20 µl of cell suspension was added, and the electrode signal was monitored. The activity was determined by the difference of the rates of NO consumption between before and after addition of the cell suspension. For anaerobic reaction, headspace gas of the chamber was removed by fitting a stopper and the reaction buffer was supplemented with 10 mM glucose. Before addition of NO and cells, oxygen in the reaction mixture was removed by incubation for 10 min with 2 units/ml of glucose oxidase and 130 units/ml of catalase. Oxygen concentration was monitored with an ISO-OXY-2 O2 electrode (WPI). The protein concentration of the cell suspension was determined by the Bradford method using the protein assay kit of Bio-Rad (Hercules, CA) after the cells were lysed by boiling with 0.33 N NaOH. Bovine serum albumin was used as a standard.


arrow
RESULTS
 
The fhp gene of P. aeruginosa. The genomic sequence analysis of P. aeruginosa PAO1 (45) has shown that the strain has a gene, designated fhp, encoding flavohemoglobin (PA2664). The deduced protein consisting of 393 amino acids is 41% and 42% identical to the flavohemoglobins of E. coli and R. eutropha, respectively. A homology search showed that the sequence is also highly similar to flavohemoglobins of other organisms. PA2665, designated fhpR, is located 155 bp upstream of fhp in a divergent orientation. fhpR encodes a protein of 517 amino acids that belongs to the NtrC family of transcriptional regulators (46). The translated sequence of fhpR is highly similar to that of norR of E. coli or R. eutropha with 50% or 52% of amino acids being identical, respectively. The norR (ygaA) gene product of E. coli regulates the expression of its divergently oriented norVW (ygaK-ygbD) operon for flavorubredoxin in the presence of NO (14, 22, 31). NorR of R. eutropha activates the expression of the norAB operon for qNor, which is divergently oriented with norR, in the presence of NO (40). Both flavorubredoxin and qNor catalyze the reduction of NO under anaerobic conditions (10, 24). These data suggested that FhpR of P. aeruginosa also activates the expression of the fhp promoter in the presence of NO.

NO-responsive regulation of the fhp promoter. Transcriptional activity of the fhp promoter in strain PAO1 was determined under both the aerobic and oxygen-limiting conditions by measuring the expression of ß-galactosidase activity from a lacZ fusion plasmid, pFH56 (Table 2). Under the oxygen-limiting condition, the fhp promoter activity was significantly induced by adding nitrate, nitrite, SNP, or GSNO to the medium or gaseous NO to the headspace of the incubation vial. Under the aerobic condition, the promoter activity was induced by SNP and GSNO. Only little induction of the activity was observed when nitrate or nitrite was added to the medium. However, nitrate and nitrite significantly induced the activity at low shaking speed even under the aerobic condition (data not shown). Probably, the expression levels of nitrate reductase and NIR were low under the high-aeration condition and production of NO from nitrate and nitrite was limited. These results indicated that the fhp promoter was activated by NO or related RNS. SNP releases NO+, whereas GSNO releases both NO and NO+, but no significant difference in the induction of the fhp promoter was found between SNP and GSNO.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Effect of inducers on transcription of the fhp promotera

To see the clear effect of N-oxides, the fhp promoter activity was determined in mutant strains that are deficient in the denitrification genes. Strain RM488 was constructed by disruption of nirS, the structural gene for NIR. The fhp promoter activity in RM488 in the presence of nitrite was one-fifth of that in PAO1 under the oxygen-limiting condition. RM488 and PAO1 showed almost the same activity in the presence of SNP. Because RM488 has no enzymatic activity to reduce nitrite to NO, the decrease in the promoter activity in the presence of nitrite must be caused by the limited supply of NO. It is not certain why the fhp promoter still had a significant activity in RM488 in the presence of nitrite. There is a possibility that nitrite also acts as a direct induction signal for FhpR or the signal molecule is also produced from nitrite, not via NIR. It has been reported that NO is produced nonenzymatically from nitrite under acidic conditions (55). The fhp promoter activity was significantly higher when RM488 was cultivated under low-pH conditions (data not shown), suggesting that the activity was caused by the nonenzymatic production of NO.

Strain RM495 is deficient in the norCBD genes for NOR and expected to accumulate NO from nitrite (3). In the presence of nitrite, the fhp promoter activity in RM495 was half of that in PAO1. This was probably because in vivo NIR activity was very low in the nor mutant (59) and production of NO from nitrite was limited. The fhp promoter in RM495 showed higher activity than did that in PAO1 in the presence of SNP. Because of the lack of NOR activity, NO or the RNS produced from SNP might be kept at a suitable concentration for activation of the fhp promoter.

Analysis of the promoter region between fhp and fhpR. The transcriptional start points of fhp and fhpR were determined by primer extension analysis (Fig. 1). The mRNA used for the reverse transcription was prepared from the cells of strain PAO1 grown under anaerobic conditions with nitrite as an electron acceptor. Both genes were transcribed from single start points. Sequences similar to the {sigma}54-binding motif (the –24 and –12 motifs) were found upstream of the transcriptional start point of fhp. The –24 and –12 motifs of the fhp promoter were not GG and GC but GG and GA and were located at –25 and –13, respectively. The sequence similar to the FNR box [TTGAT-(N4)-ATCAA] was not found in the promoter region between fhp and fhpR, suggesting that the anaerobic NO-responsive regulation of the fhp promoter was not mediated directly by ANR or DNR.



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 1. Transcriptional start points and structure of the fhp and fhpR promoters. A and B. The transcriptional start points of fhp (A) and fhpR (B) were determined by primer extension analysis. Lanes RT, the primer extension products from strain PAO1 grown anaerobically in the presence of sodium nitrite; lanes A, T, G, and C, sequence ladders generated with the same primers. C. Structure of the intergenic promoter region between fhpR and fhp. Transcriptional start points are indicated by boldface and small arrows. A motif for binding of {sigma}54 is shown in boldface, and consensus –24 and –12 motifs are boxed. Consensus NorR-binding motifs are boxed. The IHF-binding motif is double underlined. Sequences of the primers used for the primer extension analysis are overlined by arrows. Putative ribosome binding sites are underlined.

The binding sites of NorRs from E. coli and R. eutropha were reported recently (7, 49). Both NorRs bound to three loci in their target norVW and norAB promoter regions, respectively. The conserved NorR-binding motif was GT-(N7)-AC. The three-tandem repeat of the binding motifs was also found in the intergenic region between fhp and fhpR (Fig. 1) (7, 49). Binding of integration host factor (IHF) was reported in the case of the E. coli norVW promoter (49). A sequence similar to the IHF consensus sequence (29) was also found upstream of the three NorR-binding motifs.

Role of regulators in the NO-responsive activation of the fhp promoter. Analysis of the fhp promoter sequence suggested the involvement of FhpR and {sigma}54 in the NO-responsive expression of flavohemoglobin. To confirm this, mutant strains deficient in the gene for FhpR (fhpR) or {sigma}54 (rpoN) were constructed and designated strains PFM4302 and RN102, respectively, and the transcriptional activity of the fhp promoter in the constructed strains was measured (Table 2). The fhp promoter activity was very low even in the presence of nitrite or SNP in both strains, PFM4302 and RN102, indicating that both FhpR and {sigma}54 are necessary for transcription of fhp. A slight induction of the promoter activity by nitrite or SNP was found in PFM4302, which was probably by the action of truncated FhpR proteins expressed in the strain.

To exclude the possibility that ANR and/or DNR acts indirectly on the anaerobic NO-responsive regulation of the fhp promoter, the transcriptional activity was measured in mutant strains PAO6261 and RM536, which are deficient in the anr and dnr genes, respectively (1, 57). The activities in the presence of nitrite in both PAO6261 and RM536 were comparable to that in PAO1. Nitrite could not be enzymatically reduced to NO because NIR was not expressed in either mutant strain. Because expression of NOR was also restricted in the mutant strains, a trace of nonenzymatically produced NO from nitrite might be effective for activation of the promoter. The fhp promoter activity in the presence of SNP was lower in PAO6261 and higher in RM536 than in PAO1. The differences in the activities were significant (P < 0.05), but the reason for the differences was not clear.

Expression of the denitrification genes in the fhpR or rpoN mutant strain. We have reported that transcription activation of the genes for denitrification enzymes NIR, NOR, and N2OR is mediated by DNR (1, 2, 4). The roles of FhpR and {sigma}54 in the transcription of these genes were investigated by measuring the promoter activities using the plasmids pHA531 (nirS::lacZ), pHA533 (norC::lacZ), and pHA1243 (nosR::lacZ), which carry the transcriptional fusions of the promoters for the structural genes of NIR, NOR, and N2OR, respectively (Table 3). The nitrite-dependent activation of the all promoters was operative in the mutant strains. These results clearly indicated that the NO-responsive regulations mediated by FhpR and DNR are independent from each other. All promoters had lower activity in PFM4302 than in PAO1, but the differences were not significant. The nirS and nosR promoters showed twofold-higher activity in RN102 than in PAO1. The norC promoter activity was also higher in RN102 than in PAO1, though the difference was not significant. These results indicated that {sigma}54 has some repressive effect on these denitrification promoters.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Effect of the fhpR and rpoN genes on transcription of the denitrification genesa

Aerobic NO detoxification by flavohemoglobin. The physiological role of flavohemoglobin is thought to be detoxification of NO by its NOD and NOR activities (42). The function of the fhp gene product for resistance to nitrosative stress was investigated by measuring growth in the presence of NO-generating reagents under both aerobic and anaerobic conditions (Fig. 2). The aerobic growth of strains PDM2664 (fhp) and PFM4302 (fhpR) was significantly inhibited by the addition of 5 mM GSNO compared to strains PAO1 and RM495 (norCBD) in minimal medium (VB medium). The growth defect was rescued by expression of the recombinant fhp gene with plasmid pHA1512 (data not shown). A similar result was obtained when S-nitroso-N-acetyl-D,L-penicillamine (SNAP) was used, but a significant difference was not observed when SNP was used (data not shown). When LB medium was used, SNP inhibited the growth of strains PDM2664 and PFM4302 as in the cases of GSNO and SNAP (data not shown). Probably, NO was not fully produced from SNP in the minimal medium because SNP requires thiols for production of NO.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 2. Study of the NO resistance of wild-type and mutant strains. Strain PAO1 (wild type), PDM2664 (fhp), PFM4302 (fhpR), and RM495 (norCBD) were grown aerobically in minimal medium (A) or anaerobically in LB medium containing 40 mM NaNO3 (B). Open symbols and filled symbols indicate growth without and with 5 mM GSNO, respectively. The growth curves are representative of at least two independent cultures.

Under the anaerobic condition, the growth of strains PDM2664 and PFM4302 in the presence of GSNO was not significantly different from that of strain PAO1, indicating that flavohemoglobin does not have a crucial role for resistance to NO under the anaerobic condition. The growth of strain RM495 was significantly poor because of the lack of NOR (NorCB). The slight growth was probably because liquid paraffin did not shut out oxygen completely. The result also indicated that flavohemoglobin does not complement the function of NorCB as NOR.

The final optical density of strain PDM2664 in the absence of GSNO under the anaerobic condition was higher than that of strain PAO1. Strain PAO1 showed poor growth when the fhp gene was overexpressed by transformation with pHA1512 (data not shown). These results suggested that flavohemoglobin has a negative effect on the anaerobic growth of P. aeruginosa. The growth rate of strain PFM4302 in the absence of GSNO under the anaerobic condition was slightly lower than that of strain PAO1, suggesting that fhp is not the only regulon of FhpR.

Table 4 shows the aerobic NO consumption activity (NOD activity) of the aerobically grown cells. Strains PDM2664 and PFM4302 showed extremely low activity compared to strain PAO1. Strain RM495 has almost the same activity as does strain PAO1, indicating that the aerobic NO consumption was not by the NOR activity of NorCB. Actually, the anaerobic NO consumption activity of the cell extract of aerobically grown strain PAO1 was very low (<0.1 nmol of NO/min/mg of protein) because NorCB was not expressed in the aerobically grown cells. When the recombinant fhp gene was expressed in strains PDM2664 and PFM4302 by transformation with pHA1512, the activity was twofold higher than that of strain PAO1. These results clearly demonstrated that the tolerance to the NO-generating reagents of P. aeruginosa under the aerobic condition is caused by the NOD activity of flavohemoglobin.


View this table:
[in this window]
[in a new window]
  		TABLE 4. Aerobic NO consumption activity of P. aeruginosa mutant strainsa


arrow
DISCUSSION
 
Two major types of bacterial NO-responsive transcriptional regulators have been reported so far. One is the DNR/NnrR type, which belongs to the CRP/FNR family of transcriptional regulators, and the other is the NorR/FhpR type, which belongs to the {sigma}54-dependent NtrC family of transcriptional regulators. In this work, we revealed that both types of regulators act independently in P. aeruginosa. DNR activates the genes for denitrification, which utilizes NO as an electron acceptor under anaerobic conditions. FhpR activates the fhp gene for flavohemoglobin, which detoxifies NO under aerobic conditions.

Transcription of the flavohemoglobin gene is regulated by FhpR in P. aeruginosa, but this is not always the case in other organisms. In E. coli, the NO-responsive regulation of the hmp gene is mediated by FNR (13, 41). In R. eutropha, the fhp gene is preceded by a sequence similar to the consensus FNR-binding motif, suggesting that the gene is regulated by an orthologue of FNR or DNR (11). In Bacillus subtilis, induction of the hmp gene for flavohemoglobin by nitrosative stress is mediated by a two-component ResDE system and an unidentified ResDE-independent system (39). Some ß- and {gamma}-proteobacteria also have genes for NorR and FhpR orthologues. These genes are located upstream of the genes for NOR or NOD in a divergent transcriptional organization. In Pseudomonas putida, Pseudomonas fluorescens, Azotobacter vinelandii, Burkholderia fungorum, Burkholderia sp. strain TH2, and Vibrio cholerae, the fhpR orthologues are found upstream of the flavohemoglobin genes as in the case of P. aeruginosa. In R. eutropha, NorR is encoded upstream of the norAB operon for qNor (40). In Ralstonia solanacearum, norR is located upstream of norA, but norB is located at a different locus. In Salmonella enterica, Salmonella enterica serovar Typhimurium, Shigella flexneri, and Vibrio vulnificus, the NorR orthologues are encoded upstream of the norVW orthologues for flavorubredoxin and NADH/flavorubredoxin oxidoreductase as in the case of E. coli species (22, 23). These gene arrangements indicate that NorR/FhpR orthologues are specialized for regulation of the enzymes that have NOR or NOD activity, regardless of the type of the enzymes. There seems to be no rule for the combination of the NO-responsive regulators and their target genes for NO-metabolizing enzymes. However, phylogenetic analysis of the NorR/FhpR-type regulators revealed that they are divided into three groups, which accord with the types of the adjacent NOR or NOD (Fig. 3). The tree is similar to the phylogenetic tree of 16S rRNA genes (data not shown), suggesting that the combination of the genes for NorR/FhpR-type regulators and NO-metabolizing enzymes is not the result of random horizontal genetic transference. One exception is that the regulator of V. cholerae is encoded in the vicinity of the flavohemoglobin gene, even though it is phylogenetically grouped with the regulators encoded in the vicinity of norVW.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3. Molecular phylogenetic tree for the NorR/FhpR-type transcriptional regulators. Multiple sequence alignment was done using ClustalW. Tree topology and evolutionary distance estimations were done by the neighbor-joining method (Phylip 3.5). XylR of P. putida was used as an outgroup. The numbers indicated at the nodes are bootstrap values calculated from 100 replications using the Seqboot, Protdist, Neighbor, and Consense programs of the Phylip 3.5 program package. The genes for NO-metabolizing enzymes located adjacent to the regulatory genes are indicated on the right side of the tree.

The results presented in this work indicated that the induction signal for the FhpR-dependent fhp promoter is NO in P. aeruginosa. The fhpR promoter activity measured with the lacZ fusion plasmid was very low and did not vary according to the presence of N oxides or oxygen (data not shown), suggesting that FhpR itself is an NO-responsive regulator as in the case of the NorRs of R. eutropha and E. coli (22, 40). Most of the NtrC family regulators are paired with cognate sensory kinases that sense signal molecules and transduce the signal by phosphorylation of the response regulators. However, it is likely that NorR and FhpR directly sense NO or RNS, as in the case of the aromatic compound-sensing regulators XylR and DmpR (44), because the genes for cognate sensory kinases are not found in the vicinity of any genes for the NorR and FhpR orthologues. The direct signal sensing by these regulators was also suggested by the finding that their N-terminal domains are similar to the GAF domains, which are found in many signal-transducing proteins (40). It is not certain whether the NO molecule is directly sensed by FhpR. It is possible that RNS or a nitrosated compound derived from NO is the signal molecule because dissolved oxygen could not be completely eliminated from the incubation vial even under the anaerobic conditions. Another possibility is that NO is sensed by nitrosation of an amino acid residue or an unidentified cofactor of FhpR.

The induction pattern of the fhp promoter under the oxygen-limiting conditions was similar to that of the DNR-dependent norC, nosR, or nirQ promoters (3, 4). FhpR and DNR probably recognize the same induction signal, though they regulate their target promoters independently. RpoN ({sigma}54) was required for activation of the fhp promoter by FhpR, whereas it was not necessary for the DNR-dependent denitrification promoters. The denitrification promoters showed rather higher activities in the rpoN mutant. It has been reported that disruption of the rpoN gene causes reduced NIR activity in P. stutzeri (25). The expression levels of the NIR and NOR proteins were low in the rpoN strain, but the transcripts for nirS and norC were not affected by the mutation, suggesting that {sigma}54 is not directly required for transcription of the genes for NIR and NorCB. Probably, {sigma}54 is required for activation of NIR on the translational or posttranslational level. The rpoN mutation also caused low NIR activity in P. aeruginosa (27). Totten et al. showed that rpoN was not necessary for the anaerobic growth with nitrate as a terminal electron acceptor (48). The rpoN strain RN102 also grew under anaerobic conditions by denitrification, but the growth was very poor (data not shown). The high transcriptional activity of the denitrification promoters in strain RN102 probably serves to compensate for the low activities of denitrification enzymes.

Gardner and Gardner reported that flavohemoglobin of E. coli is involved in detoxification of NO under aerobic and microaerobic conditions and has no or only minor effects under anaerobic conditions (21). The turnover rate of the NOR activity of flavohemoglobin was negligible compared with that of the NOD activity. Anaerobic detoxification of NO in E. coli is mediated by another enzyme, flavorubredoxin, which has NOR activity (23). In contradiction to those results, Justino et al. recently reported that flavohemoglobin of E. coli is involved in anaerobic NO detoxification (32). We showed in this study that the physiological role of flavohemoglobin of P. aeruginosa is detoxification of NO by its NOD activity under the aerobic conditions. The function of flavohemoglobin as NOR in P. aeruginosa is doubtful, because fhp does not complement the growth of the norCBD mutant under an anaerobic denitrifying condition (Fig. 2) and the anaerobic NO consumption activity of strain PAO1 was very low even when flavohemoglobin was expressed (data not shown). Recent studies have shown that the airway mucus of cystic fibrosis (CF) patients is anaerobic and that P. aeruginosa forms an anaerobic biofilm within it. Disruption of norCB caused cell death in the anaerobic biofilm due to accumulation of toxic NO (27, 58). The results of these studies also indicated that flavohemoglobin could not detoxify NO under the anaerobic conditions. Although flavohemoglobin could never be a functional analogue of NorCB, it might have some effect in CF mucus, because both the norCB and fhp genes were significantly upregulated in a mucoid strain (17, 18). We showed that the fhp promoter has high activity under the oxygen-limiting conditions (Table 2). The activity was also high under the anaerobic conditions (data not shown). These results were in conflict with the results that the function of flavohemoglobin is the aerobic detoxification of NO. The high fhp promoter activity under the low- or no-oxygen conditions might be only because the induction signal for FhpR, viz., NO or RNS, was stable under these conditions, but the physiological role of flavohemoglobin under the anaerobic conditions remains to be investigated. P. aeruginosa is exposed to exogenous or endogenous NO when it grows in such locations as CF mucus or under the denitrifying conditions. The oxygen concentration may be kept low but varies in such habitats. Expression of flavohemoglobin even under the anaerobic conditions may be advantageous for survival at the aerobic-anaerobic interface or under fluctuation between aerobic and anaerobic conditions.


arrow
ACKNOWLEDGMENTS
 
We thank H. P. Schweizer for providing plasmids pFLP2 and pPS854.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biotechnology, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan. Phone: (81)-3-5841-5144. Fax: (81)-3-5841-5272. E-mail: aharai{at}mail.ecc.u-tokyo.ac.jp. Back


arrow
REFERENCES
 
    1
  1. Arai, H., Y. Igarashi, and T. Kodama. 1995. Expression of the nir and nor genes for denitrification of Pseudomonas aeruginosa requires a novel CRP/FNR-related transcriptional regulator, DNR, in addition to ANR. FEBS Lett. 371:73-76.[CrossRef][Medline]
    2. 2
  2. Arai, H., T. Kodama, and Y. Igarashi. 1997. Cascade regulation of the two CRP/FNR-related transcriptional regulators (ANR and DNR) and the denitrification enzymes in Pseudomonas aeruginosa. Mol. Microbiol. 25:1141-1148.[CrossRef][Medline]
    3. 3
  3. Arai, H., T. Kodama, and Y. Igarashi. 1999. Effect of nitrogen oxides on expression of the nir and nor genes for denitrification in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 170:19-24.[CrossRef][Medline]
    4. 4
  4. Arai, H., M. Mizutani, and Y. Igarashi. 2003. Transcriptional regulation of the nos genes for nitrous oxide reductase in Pseudomonas aeruginosa. Microbiology 149:29-36.[Abstract/Free Full Text]
    5. 5
  5. Arai, H., Y. Zhang, Y. Sambongi, Y. Igarashi, and T. Kodama. 1995. Production of recombinant cytochrome c-551 in a Pseudomonas aeruginosa mutant strain. J. Ferment. Bioeng. 79:489-492.[CrossRef]
    6. 6
  6. Bartnikas, T. B., I. E. Tosques, W. P. Laratta, J. Shi, and J. P. Shapleigh. 1997. Characterization of the nitric oxide reductase-encoding region in Rhodobacter sphaeroides 2.4.3. J. Bacteriol. 179:3534-3540.[Abstract/Free Full Text]
    7. 7
  7. Büsch, A., A. Pohlmann, B. Friedrich, and R. Cramm. 2004. A DNA region recognized by the nitric oxide-responsive transcriptional activator NorR is conserved in ß- and {gamma}-proteobacteria. J. Bacteriol. 186:7980-7987.[Abstract/Free Full Text]
    8. 8
  8. Carr, G. J., and S. J. Ferguson. 1990. The nitric oxide reductase of Paracoccus denitrificans. Biochem. J. 269:423-429.[Medline]
    9. 9
  9. Cooper, C. E. 1999. Nitric oxide biochemistry. Biochim. Biophys. Acta 1411:217-488.[Medline]
    10. 10
  10. Cramm, R., A. Pohlmann, and B. Friedrich. 1999. Purification and characterization of the single-component nitric oxide reductase from Ralstonia eutropha H16. FEBS Lett. 460:6-10.[CrossRef][Medline]
    11. 11
  11. Cramm, R., R. A. Siddiqui, and B. Friedrich. 1994. Primary sequence and evidence for a physiological function of the flavohemoprotein of Alcaligenes eutrophus. J. Biol. Chem. 269:7349-7354.[Abstract/Free Full Text]
    12. 12
  12. Cross, R., D. Lloyd, R. K. Poole, and J. W. Moir. 2001. Enzymatic removal of nitric oxide catalyzed by cytochrome c' in Rhodobacter capsulatus. J. Bacteriol. 183:3050-3054.[Abstract/Free Full Text]
    13. 13
  13. Cruz-Ramos, H., J. Crack, G. Wu, M. N. Hughes, C. Scott, A. J. Thomson, J. Green, and R. K. Poole. 2002. NO sensing by FNR: regulation of the Escherichia coli NO-detoxifying flavohaemoglobin, Hmp. EMBO J. 21:3235-3244.[CrossRef][Medline]
    14. 14
  14. da Costa, P. N., M. Teixeira, and L. M. Saraiva. 2003. Regulation of the flavorubredoxin nitric oxide reductase gene in Escherichia coli: nitrate repression, nitrite induction, and possible post-transcription control. FEMS Microbiol. Lett. 218:385-393.[CrossRef][Medline]
    15. 15
  15. Dunn, N. W., and B. W. Holloway. 1971. Pleiotrophy of p-fluorophenylalanine-resistant and antibiotic hypersensitive mutants of Pseudomonas aeruginosa. Genet. Res. 18:185-197.[Medline]
    16. 16
  16. Farinha, M. A., and A. M. Kropinski. 1990. Construction of broad-host-range plasmid vectors for easy visible selection and analysis of promoters. J. Bacteriol. 172:3496-3499.[Abstract/Free Full Text]
    17. 17
  17. Firoved, A. M., and V. Deretic. 2003. Microarray analysis of global gene expression in mucoid Pseudomonas aeruginosa. J. Bacteriol. 185:1071-1081.[Abstract/Free Full Text]
    18. 18
  18. Firoved, A. M., S. R. Wood, W. Ornatowski, V. Deretic, and G. S. Timmins. 2004. Microarray analysis and functional characterization of the nitrosative stress response in nonmucoid and mucoid Pseudomonas aeruginosa. J. Bacteriol. 186:4046-4050.[Abstract/Free Full Text]
    19. 19
  19. Fürste, J. P., W. Pansegrau, R. Frank, H. Blöcker, P. Scholz, M. Bagdasarian, and E. Lanka. 1986. Molecular-cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene 48:119-131.[CrossRef][Medline]
    20. 20
  20. Galimand, M., M. Gamper, A. Zimmermann, and D. Haas. 1991. Positive FNR-like control of anaerobic arginine degradation and nitrate respiration in Pseudomonas aeruginosa. J. Bacteriol. 173:1598-1606.[Abstract/Free Full Text]
    21. 21
  21. Gardner, A. M., and P. R. Gardner. 2002. Flavohemoglobin detoxifies nitric oxide in aerobic, but not anaerobic, Escherichia coli. Evidence for a novel inducible anaerobic nitric oxide-scavenging activity. J. Biol. Chem. 277:8166-8171.[Abstract/Free Full Text]
    22. 22
  22. Gardner, A. M., C. R. Gessner, and P. R. Gardner. 2003. Regulation of the nitric oxide reduction operon (norRVW) in Escherichia coli. Role of NorR and {sigma}54 in the nitric oxide stress response. J. Biol. Chem. 278:10081-10086.[Abstract/Free Full Text]
    23. 23
  23. Gardner, A. M., R. A. Helmick, and P. R. Gardner. 2002. Flavorubredoxin, an inducible catalyst for nitric oxide reduction and detoxification in Escherichia coli. J. Biol. Chem. 277:8172-8177.[Abstract/Free Full Text]
    24. 24
  24. Gomes, C. M., A. Giuffrè, E. Forte, J. B. Vicente, L. M. Saraiva, M. Brunori, and M. Teixeira. 2002. A novel type of nitric-oxide reductase. Escherichia coli flavorubredoxin. J. Biol. Chem. 277:25273-25276.[Abstract/Free Full Text]
    25. 25
  25. Härtig, E., and W. G. Zumft. 1998. The requirement of RpoN (sigma factor {sigma}54) in denitrification by Pseudomonas stutzeri is indirect and restricted to the reduction of nitrite and nitric oxide. Appl. Environ. Microbiol. 64:3092-3095.[Abstract/Free Full Text]
    26. 26
  26. Hasegawa, N., H. Arai, and Y. Igarashi. 2001. Two c-type cytochromes, NirM and NirC, encoded in the nir gene cluster of Pseudomonas aeruginosa act as electron donors for nitrite reductase. Biochem. Biophys. Res. Commun. 288:1223-1230.[CrossRef][Medline]
    27. 27
  27. Hassett, D. J., J. Cuppoletti, B. Trapnell, S. V. Lymar, J. J. Rowe, S. S. Yoon, G. M. Hilliard, K. Parvatiyar, M. C. Kamani, D. J. Wozniak, S.-H. Hwang, T. R. McDermott, and U. A. Ochsner. 2002. Anaerobic metabolism and quorum sensing by Pseudomonas aeruginosa biofilms in chronically infected cystic fibrosis airways: rethinking antibiotic treatment strategies and drug targets. Adv. Drug Deliv. Rev. 54:1425-1443.[CrossRef][Medline]
    28. 28
  28. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86.[CrossRef][Medline]
    29. 29
  29. Holtel, A., K. N. Timmis, and J. L. Ramos. 1992. Upstream binding sequences of the XylR activator protein and integration host factor in the xylS gene promoter region of the Pseudomonas TOL plasmid. Nucleic Acids Res. 20:1755-1762.[Abstract/Free Full Text]
    30. 30
  30. Householder, T. C., E. M. Fozo, J. A. Cardinale, and V. L. Clark. 2000. Gonococcal nitric oxide reductase is encoded by a single gene, norB, which is required for anaerobic growth and is induced by nitric oxide. Infect. Immun. 68:5241-5246.[Abstract/Free Full Text]
    31. 31
  31. Hutchings, M. I., N. Mandhana, and S. Spiro. 2002. The NorR protein of Escherichia coli activates expression of the flavorubredoxin gene norV in response to reactive nitrogen species. J. Bacteriol. 184:4640-4643.[Abstract/Free Full Text]
    32. 32
  32. Justino, M. C., J. B. Vicente, M. Teixeira, and L. M. Saraiva. 2005. New genes implicated in the protection of anaerobically grown Escherichi coli against nitric oxide. J. Biol. Chem. 280:2636-2643.[Abstract/Free Full Text]
    33. 33
  33. Kastrau, D. H., B. Heiss, P. M. Kroneck, and W. G. Zumft. 1994. Nitric oxide reductase from Pseudomonas stutzeri, a novel cytochrome bc complex. Phospholipid requirement, electron paramagnetic resonance and redox properties. Eur. J. Biochem. 222:293-303.[Medline]
    34. 34
  34. Kawasaki, S., H. Arai, Y. Igarashi, and T. Kodama. 1995. Sequencing and characterization of the downstream region of the genes encoding nitrite reductase and cytochrome c-551 (nirSM) from Pseudomonas aeruginosa: identification of the gene necessary for biosynthesis of heme d1. Gene 167:87-91.[CrossRef][Medline]
    35. 35
  35. Kawasaki, S., H. Arai, T. Kodama, and Y. Igarashi. 1997. Gene cluster for dissimilatory nitrite reductase (nir) from Pseudomonas aeruginosa: sequencing and identification of a locus for heme d1 biosynthesis. J. Bacteriol. 179:235-242.[Abstract/Free Full Text]
    36. 36
  36. Körner, H., H. J. Sofia, and W. G. Zumft. 2003. Phylogeny of the bacterial superfamily of Crp-Fnr transcription regulators: exploiting the metabolic spectrum by controlling alternative gene programs. FEMS Microbiol. Rev. 27:559-592.[CrossRef][Medline]
    37. 37
  37. Lide, D. R. (ed.). 1999. CRC handbook of chemistry and physics, 80th ed., p. 8-87. CRC Press, Inc., Boca Raton, Fla.
    38. 38
  38. Membrillo-Hernández, J., M. D. Coopamah, A. Channa, M. N. Hughes, and R. K. Poole. 1998. A novel mechanism for upregulation of the Escherichia coli K-12 hmp (flavohaemoglobin) gene by the ‘NO releaser’, S-nitrosoglutathione: nitrosation of homocysteine and modulation of MetR binding to the glyA-hmp intergenic region. Mol. Microbiol. 29:1101-1112.[CrossRef][Medline]
    39. 39
  39. Nakano, M. M. 2002. Induction of ResDE-dependent gene expression in Bacillus subtilis in response to nitric oxide and nitrosative stress. J. Bacteriol. 184:1783-1787.[Abstract/Free Full Text]
    40. 40
  40. Pohlmann, A., R. Cramm, K. Schmelz, and B. Friedrich. 2000. A novel NO-responding regulator controls the reduction of nitric oxide in Ralstonia eutropha. Mol. Microbiol. 38:626-638.[CrossRef][Medline]
    41. 41
  41. Poole, R. K., M. F. Anjum, J. Membrillo-Hernández, S. O. Kim, M. N. Hughes, and V. Stewart. 1996. Nitric oxide, nitrite, and Fnr regulation of hmp (flavohemoglobin) gene expression in Escherichia coli K-12. J. Bacteriol. 178:5487-5492.[Abstract/Free Full Text]
    42. 42
  42. Poole, R. K., and M. N. Hughes. 2000. New functions for the ancient globin family: bacterial responses to nitric oxide and nitrosative stress. Mol. Microbiol. 36:775-783.[CrossRef][Medline]
    43. 43
  43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
    44. 44
  44. Shingler, V. 1996. Signal sensing by {sigma}54-dependent regulators: derepression as a control mechanism. Mol. Microbiol. 19:409-416.[CrossRef][Medline]
    45. 45
  45. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. L. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K.-S. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. W. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964.[CrossRef][Medline]
    46. 46
  46. Studholme, D. J., and R. Dixon. 2003. Domain architectures of {sigma}54-dependent transcriptional activators. J. Bacteriol. 185:1757-1767.[Free Full Text]
    47. 47
  47. Tosques, I. E., J. Shi, and J. P. Shapleigh. 1996. Cloning and characterization of nnrR, whose product is required for the expression of proteins involved in nitric oxide metabolism in Rhodobacter sphaeroides 2.4.3. J. Bacteriol. 178:4958-4964.[Abstract/Free Full Text]
    48. 48
  48. Totten, P. A., J. C. Lara, and S. Lory. 1990. The rpoN gene product of Pseudomonas aeruginosa is required for expression of diverse genes, including the flagellin gene. J. Bacteriol. 172:389-396.[Abstract/Free Full Text]
    49. 49
  49. Tucker, N. P., B. D'Autréaux, D. J. Studholme, S. Spiro, and R. Dixon. 2004. DNA binding activity of the Escherichia coli nitric oxide sensor NorR suggests a conserved target sequence in diverse proteobacteria. J. Bacteriol. 186:6656-6660.[Abstract/Free Full Text]
    50. 50
  50. van der Oost, J., A. P. N. de Boer, J.-W. L. de Gier, W. G. Zumft, A. H. Stouthamer, and R. J. M. van Spanning. 1994. The heme-copper oxidase family consists of three distinct types of terminal oxidases and is related to nitric oxide reductase. FEMS Microbiol. Lett. 121:1-9.[Medline]
    51. 51
  51. Van Spanning, R. J. M., A. P. N. De Boer, W. N. Reijnders, S. Spiro, H. V. Westerhoff, A. H. Stouthamer, and J. Van der Oost. 1995. Nitrite and nitric oxide reduction in Paracoccus denitrificans is under the control of NNR, a regulatory protein that belongs to the FNR family of transcriptional activators. FEBS Lett. 360:151-154.[CrossRef][Medline]
    52. 52
  52. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithinase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 218:97-106.[Free Full Text]
    53. 53
  53. Vollack, K.-U., E. Härtig, H. Körner, and W. G. Zumft. 1999. Multiple transcription factors of the FNR family in denitrifying Pseudomonas stutzeri: characterization of four fnr-like genes, regulatory responses and cognate metabolic processes. Mol. Microbiol. 31:1681-1694.[CrossRef][Medline]
    54. 54
  54. Vollack, K.-U., and W. G. Zumft. 2001. Nitric oxide signaling and transcriptional control of denitrification genes in Pseudomonas stutzeri. J. Bacteriol. 183:2516-2526.[Abstract/Free Full Text]
    55. 55
  55. Weitzberg, E., and J. O. N. Lundberg. 1998. Nonenzymatic nitric oxide production in humans. Nitric Oxide 2:1-7.[CrossRef][Medline]
    56. 56
  56. Wood, P. M. 1978. Periplasmic location of the terminal reductase in nitrite respiration. FEBS Lett. 92:214-218.[CrossRef][Medline]
    57. 57
  57. Ye, R. W., D. Haas, J.-O. Ka, V. Krishnapillai, A. Zimmermann, C. Baird, and J. M. Tiedje. 1995. Anaerobic activation of the entire denitrification pathway in Pseudomonas aeruginosa requires Anr, an analog of Fnr. J. Bacteriol. 177:3606-3609.[Abstract/Free Full Text]
    58. 58
  58. Yoon, S. S., R. F. Hennigan, G. M. Hilliard, U. A. Ochsner, K. Parvatiyar, M. C. Kamani, H. L. Allen, T. R. DeKievit, P. R. Gardner, U. Schwab, J. J. Rowe, B. H. Iglewski, T. R. McDermott, R. P. Mason, D. J. Wozniak, R. E. W. Hancock, M. R. Parsek, T. L. Noah, R. C. Boucher, and D. J. Hassett. 2002. Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Dev. Cell 3:593-603.[CrossRef][Medline]
    59. 59
  59. Zumft, W. G. 1993. The biological role of nitric oxide in bacteria. Arch. Microbiol. 160:253-264.[CrossRef][Medline]

Journal of Bacteriology, June 2005, p. 3960-3968, Vol. 187, No. 12
0021-9193/05/$08.00+0     doi:10.1128/JB.187.12.3960-3968.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Van Alst, N. E., Wellington, M., Clark, V. L., Haidaris, C. G., Iglewski, B. H. (2009). Nitrite Reductase NirS Is Required for Type III Secretion System Expression and Virulence in the Human Monocyte Cell Line THP-1 by Pseudomonas aeruginosa. Infect. Immun. 77: 4446-4454 [Abstract] [Full Text]  
  • Narisawa, N., Haruta, S., Arai, H., Ishii, M., Igarashi, Y. (2008). Coexistence of Antibiotic-Producing and Antibiotic-Sensitive Bacteria in Biofilms Is Mediated by Resistant Bacteria. Appl. Environ. Microbiol. 74: 3887-3894 [Abstract] [Full Text]  
  • Nishimura, T., Teramoto, H., Vertes, A. A., Inui, M., Yukawa, H. (2008). ArnR, a Novel Transcriptional Regulator, Represses Expression of the narKGHJI Operon in Corynebacterium glutamicum. J. Bacteriol. 190: 3264-3273 [Abstract] [Full Text]  
  • Ceyssens, P.-J., Mesyanzhinov, V., Sykilinda, N., Briers, Y., Roucourt, B., Lavigne, R., Robben, J., Domashin, A., Miroshnikov, K., Volckaert, G., Hertveldt, K. (2008). The Genome and Structural Proteome of YuA, a New Pseudomonas aeruginosa Phage Resembling M6. J. Bacteriol. 190: 1429-1435 [Abstract] [Full Text]  
  • Van Alst, N. E., Picardo, K. F., Iglewski, B. H., Haidaris, C. G. (2007). Nitrate Sensing and Metabolism Modulate Motility, Biofilm Formation, and Virulence in Pseudomonas aeruginosa. Infect. Immun. 75: 3780-3790 [Abstract] [Full Text]  
  • Schreiber, K., Krieger, R., Benkert, B., Eschbach, M., Arai, H., Schobert, M., Jahn, D. (2007). The Anaerobic Regulatory Network Required for Pseudomonas aeruginosa Nitrate Respiration. J. Bacteriol. 189: 4310-4314 [Abstract] [Full Text]  
  • Rinaldo, S., Arcovito, A., Brunori, M., Cutruzzola, F. (2007). Fast Dissociation of Nitric Oxide from Ferrous Pseudomonas aeruginosa cd1 Nitrite Reductase: A NOVEL OUTLOOK ON THE CATALYTIC MECHANISM. J. Biol. Chem. 282: 14761-14767 [Abstract] [Full Text]  
  • Nakano, M. M., Geng, H., Nakano, S., Kobayashi, K. (2006). The Nitric Oxide-Responsive Regulator NsrR Controls ResDE-Dependent Gene Expression.. J. Bacteriol. 188: 5878-5887 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»