JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, B. M.
Right arrow Articles by Waldor, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, B. M.
Right arrow Articles by Waldor, M. K.

 Previous Article  |  Next Article 

Journal of Bacteriology, June 2005, p. 4005-4014, Vol. 187, No. 12
0021-9193/05/$08.00+0     doi:10.1128/JB.187.12.4005-4014.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Characterization of the Small Untranslated RNA RyhB and Its Regulon in Vibrio cholerae{dagger}

Brigid M. Davis,2* Mariam Quinones,2 Jason Pratt,2 Yanpeng Ding,2,{ddagger} and Matthew K. Waldor1,2

Howard Hughes Medical Institute,1 Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, Massachusetts 021112

Received 23 November 2004/ Accepted 3 March 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Numerous small untranslated RNAs (sRNAs) have been identified in Escherichia coli in recent years, and their roles are gradually being defined. However, few of these sRNAs appear to be conserved in Vibrio cholerae, and both identification and characterization of sRNAs in V. cholerae remain at a preliminary stage. We have characterized one of the few sRNAs conserved between E. coli and V. cholerae: RyhB. Sequence conservation is limited to the central region of the gene, and RyhB in V. cholerae is significantly larger than in E. coli. As in E. coli, V. cholerae RyhB is regulated by the iron-dependent repressor Fur, and it interacts with the RNA-binding protein Hfq. The regulons controlled by RyhB in V. cholerae and E. coli appear to differ, although some overlap is evident. Analysis of gene expression in V. cholerae in the absence of RyhB suggests that the role of this sRNA is not limited to control of iron utilization. Quantitation of RyhB expression in the suckling mouse intestine suggests that iron availability is not limiting in this environment, and RyhB is not required for colonization of this mammalian host by V. cholerae.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the past few years, it has become increasingly clear that small untranslated RNAs (sRNAs) regulate many diverse cellular processes. In Escherichia coli, sRNAs have already been shown to modulate sigma factor production, iron utilization, acid resistance, porin expression, and the response to oxidative stress, and functions still need to be defined for a majority of its more than 50 sRNAs (reviewed in reference 2). The modes of action of sRNAs have also been shown to be diverse. In general, sRNA-based regulation is thought to depend upon base pairing between short regions of complementary sequence in the sRNA and its target mRNA(s), although sRNAs that interact with proteins (e.g., CsrB and 6S RNA) have also been described (32, 40). Pairing between an sRNA and an mRNA can promote or inhibit mRNA translation or increase or decrease mRNA stability, depending upon the RNAs involved (7, 21, 22, 27). The location of the target sequence within an mRNA probably influences the events that follow binding to an sRNA; still, it is not fully understood how sRNA binding has such a range of consequences.

Many of the sRNAs that interact with mRNAs also interact with the RNA-binding protein Hfq. Hfq has homology to eukaryotic Sm proteins and appears to function as an RNA chaperone (12, 25, 43). Hfq interacts with both sRNAs and mRNAs and can foster formation of sRNA:mRNA complexes. mRNA-binding sRNAs generally have reduced stability in strains lacking Hfq, and their regulatory roles are typically impaired in an hfq strain background (12, 25, 36). We recently reported that Vibrio cholerae lacking hfq is severely attenuated in its ability to colonize the small intestines of suckling mice and thus is largely avirulent in this commonly used model host for study of cholera pathogenesis (8). This finding suggested that one or more sRNAs might be critical for V. cholerae virulence. Lenz et al. subsequently identified four redundant sRNAs that together are required for quorum sensing and virulence gene expression in some strains of V. cholerae (18); however, due to the presence of an epistatic mutation, these sRNAs do not appear to be required for the virulence of the strains of V. cholerae used in our study (8). Thus, it is likely that additional sRNAs contribute to V. cholerae pathogenicity.

To date, large-scale identification of bacterial sRNAs has been performed only for E. coli (3, 38, 39, 44). Comparative sequence analyses have suggested that conservation of sRNAs among bacterial species is relatively poor, even in related species such as E. coli and V. cholerae. For example, of 55 sRNAs identified in E. coli as of 2003, only 7 were predicted to exist in its fellow gamma proteobacterium V. cholerae (16). Of these, only two are homologs of regulatory RNAs that depend on Hfq for their activity; the others are homologs of Hfq-independent sRNAs (e.g., SsrA, RnpB) (16). The two predicted Hfq-dependent sRNAs are RyhB (also known as SraI), a putative regulator of iron acquisition and utilization, and Spf (also known as spot 42), a putative regulator of the galactose operon (16). As iron acquisition systems are critical for the virulence of numerous bacterial pathogens, we chose to investigate the role of V. cholerae's putative RyhB homolog.

The discovery of RyhB in E. coli provided an explanation for previously puzzling gene expression by strains lacking the iron-responsive regulator Fur. In the presence of plentiful iron, Fur is active and prevents transcription of genes involved in iron acquisition, such as siderophores and iron-repressible outer membrane receptors (11). Thus, most Fur-regulated genes are not expressed when iron is abundant in the bacterial environment. However, a subset of genes appeared to be positively regulated by both Fur and iron (10, 14). In 2002, it was recognized that some of these genes are down-regulated by ryhB, which is itself repressed by Fur in E. coli (23). Expression of ryhB reduces the transcript abundance of several Fur-dependent genes, including sodB, sdhC, fumA, and bfr. Pairing between the sRNA and target mRNAs, which is promoted by Hfq, appears to promote degradation of these RNAs by RNase E (12, 22). These genes are thereby repressed in response to iron scarcity in a Fur-, RyhB-, and Hfq-dependent manner. This regulatory system allows E. coli to direct a scarce supply of iron towards production of proteins crucial for growth or survival while shutting down genes encoding iron storage proteins (e.g., bfr) and nonessential cellular components that contain iron (e.g., sodB, sdhC, fumA). For historical reasons, RyhB has principally been studied as a regulator of iron utilization; however, E. coli RyhB may also influence processes not related to iron. A complete gene list for the RyhB regulon in E. coli has yet to be reported.

In this study, we demonstrate that V. cholerae encodes an iron-regulated homolog of RyhB, although the V. cholerae RyhB is significantly larger that of E. coli. As in E. coli, RyhB and Hfq interact in V. cholerae, and RyhB abundance is reduced in cells lacking Hfq, suggesting that Hfq may stabilize the sRNA. Microarray analyses revealed numerous genes with elevated transcript levels in a ryhB mutant grown with minimal iron. Only a subset of these, rather than the majority, appear to encode iron-containing proteins. Microarray analyses also identified genes with reduced transcript abundance in the ryhB mutant, a class of genes that has not previously been described. The absence of RyhB does not impair the growth of V. cholerae in the murine small intestine; thus, inactivation of RyhB does not account for the attenuation of the V. cholerae hfq mutant in vivo. Analysis of RyhB expression within the small intestine suggests that, in contrast to common assumptions regarding iron availability in mammalian hosts, iron is not limiting in this environment.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains and growth conditions. All strains are derivates of N16961, the V. cholerae El Tor genome strain (15), and are resistant to streptomycin; the fur insertion mutant is also resistant to ampicillin and was always grown in medium containing both antibiotics. Strains were cultured in Luria-Bertani (LB) or M63 minimal medium (4) containing antibiotics (200 µg/ml streptomycin with or without 100 µg/ml ampicillin); the iron chelator dipyridyl was added as indicated. Dipyridyl was added to cultures ~1 h prior to harvesting of cells. Cultures were grown at 37°C.

Strain and plasmid construction. N16961 ryhB (strain BD1591) lacks 256 bp from the intergenic region between VC0106 and VC0107, which spans ryhB. This deletion begins ~80 bp downstream of the upstream gene, VC0106, and ends ~180 bp from the 3' end of the divergently transcribed downstream gene; the deletion should not impair expression of these neighboring genes, and microarray analyses did not reveal changes in their transcript abundance. The deletion was generated by allele exchange using plasmid pBD1588, a pCVD442 derivative, as described previously (9). The insert in pBD1588 was constructed using splicing by overlap extension PCR (17) and the primers 5'GTTTTTAGCGATGGCGATTG3' with 5'ATTGCTGGGACACTTGTTCCCTAAGACGTGG3' and 5'GGAACAAGTGTCCCAGCAATGAGTGGACAAG3' with 5'ATAAAGGTAAGAGGAGCCGTCG3'. Construction of N16961 hfq has been described previously (strain NHfq) (8). Strains with fur deletions (BD1803 and others) were generated by allele exchange using N16961 lac (NLAC) (8) and plasmid pBD1801. The insert in this pCVD442 derivative was constructed as described above using the primers 5'CGTCTAGACAGTGAGAAAATGCTGCCGC3' with 5'CAGAGCGTAATTGGCTGCGTTGTCAAACCC3' and 5'ACGCAGCCAATTACGCTCTGTAAACCGAACCAG3' with 5'GCTCTAGAACCGCTAAACTGCTCAATGGC3'. Mutants were generated at a low frequency but could be obtained via selection of small colonies from sucrose plates. N16961 fur::Ap (strain BD1763) is an insertion mutant made by mating strain N16961 with SM10{lambda}pir(pCML13) (20). N16961 hfqH6 (strain BD1804) was made by allele exchange using plasmid pBD1800. This pCVD442 derivative was constructed as described above using primers 5'GCTCTAGATCAAGCCGTTGAAACGCTCTC3' with 5'TTAGTGATGGTGATGGTGATGCTCTCCAGACTTCTCTGC3' and 5'GAGCATCACCATCACCATCACTAATTCTTTGCACAATTA3' with 5'GCTCTAGACCACGTAAACCAATCCCGC3'. Western blotting was used to screen for strains producing His6-tagged Hfq. Mutations in all other strains were confirmed by Southern blotting and/or PCR.

Northern blot analyses. Wild-type (wt) V. cholerae and mutant V. cholerae were grown in LB medium to an optical density at 600 nm (OD600) of ~1 (late log phase) and then grown for an additional hour with or without 100 µM dipyridyl. Cultures were grown in M63 medium to an OD600 of ~0.25 (mid log phase) and then grown an additional hour with or without 25 µM dipyridyl. Cell pellets from cultures were stored prior to RNA isolation in the RNA stabilization reagent RNAlater (QIAGEN). RNA was isolated using an RNeasy Mini kit and RNase-free DNase set (QIAGEN). RNA isolated with TRIzol yielded equivalent results (not shown). RNA (6 µg) was electrophoresed on glyoxal agarose gels (Ambion) or on polyacrylamide urea gels (National Diagnostics) and transferred to BrightStar (Ambion) or HyBond (Amersham) membranes, respectively. RNA integrity and quantity was confirmed via staining of agarose gels with ethidium bromide prior to transfer. Blots were hybridized in ULTRAhyb (Ambion) to 32P-labeled riboprobes generated by in vitro transcription. Hybridization was at 68°C for all probes except RyhB, which was hybridized at 64°C. The template used to create the ryhB riboprobe was a TOPO clone (Invitrogen) of a PCR product generated with primers 5'CGCGGATCCCGTCTTAGGGAACAAGTGAAGG3' and 5'CCGGAATTCGCAAACGAGGTCAAAGCC3'; it contains almost all of ryhB. Other riboprobes were complementary to internal fragments of the target genes: nucleotides (nt) 214 to 477 of VC2045, nt 56 to 723 of VC1169, nt 166 to 895 of VC1255, nt 165 to 925 of VC2213, and nt 12999 to 13501 of VC1451. Blots were stripped and reprobed as recommended in Strip-EZ hybridization protocols (Ambion).

Purification of HfqH6-interacting RNAs. Cultures of N16961 hfqH6 (BD1804) and N16961 were grown in LB medium to an OD600 of ~0.8; 100 µM dipyridyl was then added, and cultures were grown for an additional 1.5 h. Cell pellets equivalent to 30 OD600 units were frozen, and then cell extracts were prepared in lysis buffer (20 mM Tris [pH 8.0], 150 mM KCl, 1 mM MgCl2, 5 mM ß-mercaptoethanol) as described (40). His6-tagged Hfq (HfqH6) was affinity purified on Ni-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN) from lysate generated from 7.5 OD equivalents. A control purification was done in parallel using lysate from N16961. The lysates were rocked at 4°C for 2 h, and then the Ni-NTA and "depleted" lysates were separated by centrifugation. The matrix was washed with lysis buffer containing 50 mM imidazole; adherent proteins were then eluted with lysis buffer containing 250 mM imidazole. Samples for Northern and Western analyses were generated from starting lysates, depleted lysates, 250 mM imidazole washes, and 250 mM imidazole pellets. Protein samples were prepared from 10% of each fraction, and HfqH6 purification was assessed on Western blots probed with anti His5 antibody (QIAGEN). RNA was extracted from the remaining 90% of each fraction with phenol-chloroform and precipitated with ethanol for further analyses. A total of 25% of each RNA sample was electrophoresed on an agarose gel and then blotted and probed for RyhB as described above.

RACE analysis. RNA was isolated from wt cells grown in LB-100 µM dipyridyl, polyadenylated using E. coli Poly(A) polymerase (Ambion), and reverse transcribed using the primer 5'TCACGACTCACTATAGGATCCTTTTTTTTTTTTN3'. cDNA was purified and tailed with poly(dC) using a 5' rapid amplification of cDNA ends (RACE) system kit (Invitrogen). The RyhB 5' end was amplified using the RACE kit AAP primer and 5'TACACTGGAAGCAATGTGAGC3', and the 3' end was amplified using 5'TCACGACTCACTATAGGATCC3' and 5'CGAAACGGCCGAACTTGAGC3'. PCR products were TA cloned in pCRII (Invitrogen) and sequenced.

Sequence analyses. Homology searches were performed using the BLASTN 2.2.9, BLASTN 2.2.10, and BLASTN 2.0MP-WashU algorithms (http://www.ncbi.nlm.nih.gov/BLAST/ and http://tigrblast.tigr.org/cmr-blast/). Sequence alignments were generated using the bl2seq algorithm (http://www.ncbi.nlm.nih.gov/BLAST/) and MacVector (Accelrys). Promoter prediction was done with BPROM (Softberry, Inc., Mt. Kisco, N.Y.).

Microarray analyses. Paired cultures of wt and ryhB cells were grown in M63 to an OD600 of ~0.25 and then supplemented with 25 µM dipyridyl and grown an additional 1 to 1.5 h. Microarray analyses were performed as described (8). Genes were counted as differentially regulated when the ratio of mutant/wt transcripts was either >1.5 or <0.66 in three of three experiments.

Growth analyses. Cells were grown overnight in M63 medium, diluted in fresh medium, and grown to log phase and then rediluted in either M63 or M63 medium plus 25 µM dipyridyl for growth analyses. All cultures were grown in duplicate, and both members of each pair were plotted.

Intestinal colonization assays. In vivo competitions were performed as described (8). Bacteria were harvested from the suckling mouse small intestine ~20 h after inoculation and plated on selective medium for quantitation of bacterial colonization.

Real-time RT-PCR. Quantitative reverse transcription-PCR (RT-PCR) analyses were performed basically as described (29). For analyses of ryhB expression in LB cultures, cells were grown to an OD600 of ~1 and then 100 µM dipyridyl was added to half of the cultures and cells were grown for an additional hour. For analysis of gene expression in the suckling mouse intestine, mice were infected with N16961 as described (8) except that mice were inoculated with 10x more bacteria. RNA was isolated from intestinal homogenates of infected mice by use of TRIzol LS (Invitrogen). Specific oligonucleotide primers (5'GAAGATGTCGCCTAGCAAACG3') (29) were used for RT reactions, along with 2.0 µg of RNA from in vitro-grown N16961 or 12 µg of RNA from intestinal homogenates. PCRs contained 2.5 µl of cDNA and primers 5'GAAGATGTCGCCTAGCAAACG3' and 5'GAGCAGGTTCTTTTTGACACG3' in a total volume of 20 µl. Intestinal homogenates from five infected suckling mice and two independent cultures of N16961 grown in LB medium with or without dipyridyl were assayed.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
V. cholerae encodes a ryhB homolog. Comparisons of the genomic sequences of E. coli and other gram-negative bacteria revealed that several additional species, including V. cholerae, are likely to encode a RyhB homolog (16, 23). We used Northern blotting to confirm that the putative ryhB locus in V. cholerae encodes an iron-regulated transcript. A transcript of ~225 nt was detected in RNA from wt V. cholerae grown in LB medium-0.1 mM dipyridyl and in M63 minimal medium (which contains only 1.7 µM FeSO4·7 H2O) both with and without dipyridyl (Fig. 1A). This transcript was not detected when cells were grown in LB medium alone, which contains 17 µM iron (1). It also was not present in RNA from V. cholerae in which the putative ryhB locus was disrupted, and it was reduced in abundance in RNA from an hfq strain. Together, these results indicate that V. cholerae produces a RyhB homolog whose abundance in the cell is dependent upon iron levels and on Hfq.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 1. Northern blot analyses of ryhB expression and RyhB interactions in V. cholerae. A. RNA was isolated from wild-type N16961 (wt) and from ryhB and hfq derivatives of this strain, which were grown in the media indicated with (+D) or without dipyridyl. RNA was electrophoresed on denaturing acrylamide gels and transferred to membranes by electroblotting before hybridization to a RyhB probe. B. Effect of addition of FeSO4·7 H2O to cells in M63 medium. RNA was electrophoresed on an agarose gel. Total concentration of FeSO4·7 H2O is shown. C. Role of Fur in iron-regulated expression of ryhB. RNA from wt and fur cells grown in LB with or without 100 µM dipyridyl (Dip.) was electrophoresed on an agarose gel. D. RyhB interaction with Hfq. HfqH6 and associated RNAs were affinity purified on Ni-NTA agarose from lysate of an hfq::H6 strain (HfqH6); a control purification was performed in parallel using lysate from wt cells (wt). Protein purification was assessed on Western blots probed with an anti His5 antibody (upper panel), and RyhB purification was assessed on Northern blots of agarose gels (lower panel). Protein and RNA were extracted from total lysates (lanes 1 and 5), "depleted lysates" (lanes 2 and 6), washes containing 250 mM imidazole (lanes 3 and 7), and Ni-NTA agarose pellets after 250 mM imidazole wash (lanes 4 and 8).

 
RyhB transcript abundance was not notably increased when dipyridyl was added to M63, suggesting that limiting iron to 1.7 µM is sufficient to induce maximal expression (Fig. 1A and data not shown). To determine how much iron is sufficient to prevent ryhB expression, we grew the wt strain in M63 supplemented with various amounts of additional FeSO4·7 H2O and assessed RyhB transcript abundance. As little as 3 µM FeSO4·7 H2O was sufficient to reduce RyhB levels, and 6 µM FeSO4·7 H2O lowered its abundance to background levels (Fig. 1B). As V. cholerae requires 0.5 to 1 µM bioavailable iron for growth and survival (31), the range of conditions under which ryhB is expressed is apparently fairly narrow.

Many genes that are expressed in response to iron scarcity have been found to be regulated by the iron-dependent repressor Fur. In V. cholerae, Fur has been shown to control expression of a tonB operon, a heme transport operon, a ferrichrome utilization operon, ferrichrome and vibriobactin receptor genes, and other genes involved in iron utilization (26, 31, 37). Since we had found that ryhB is also expressed in response to iron scarcity, we assessed whether this regulation is dependent upon Fur. We used Northern blots to compare RyhB abundance in wt and fur V. cholerae grown in LB medium and LB-100 µM dipyridyl. Both fur deletion mutants, generated for this study, and fur::Ap insertion mutants, previously reported to be deficient in iron-dependent regulation of Fur targets, were tested. We found that ryhB is expressed in {Delta}fur strains even when iron is available; unexpectedly, ryhB was repressed under this condition in the fur::Ap background (Fig. 1C). These results were observed for at least two independently derived mutants of each class (data not shown). They suggest that Fur regulates ryhB expression in V. cholerae and that Fur function is not fully abrogated in the insertion mutant, which lacks only a small portion of the protein's carboxyl terminus. Residual Fur activity in the insertion mutant could explain the small degree (~2-fold repression) of iron-regulated expression of the vibriobactin, enterobactin, and heme receptor genes viuA, irgA, and hutA previously observed in this strain background (19, 37).

RyhB and Hfq interact in V. cholerae. The reduction in RyhB transcript abundance in the hfq mutant (Fig. 1A) is consistent with a model in which interaction between RyhB and Hfq stabilizes the sRNA. To assess directly whether RyhB-Hfq binding occurs, we determined whether an epitope-tagged Hfq (HfqH6) and RyhB could be copurified from cellular extracts. To maintain an appropriate cellular level of Hfq, sequence encoding the polyhistidine epitope tag was inserted on the V. cholerae chromosome at the 3' end of the endogenous hfq. The resulting strain does not display the slight growth deficiency demonstrated by an hfq mutant, suggesting that the tag does not disrupt Hfq function. We have also found that a plasmid-encoded HfqH6 complements the growth deficiency of an hfq mutant, again suggesting that a tagged protein functions normally (data not shown). We affinity purified HfqH6 from cellular extracts of V. cholerae N16961 hfq::H6 grown in LB-dipyridyl and extracted copurifying RNA from the protein for analysis on Northern blots. ryhB transcripts were readily detectable among RNAs copurified with HfqH6 (Fig. 1D). RyhB was not detected in RNA samples purified in parallel from lysates of wt V. cholerae. These results indicate that there is a specific interaction between RyhB and Hfq in V. cholerae.

Mapping of RyhB transcript ends. The dominant V. cholerae RyhB transcript detected on Northern blots was significantly larger (~225 nt versus 90 nt) than the homologous transcript from E. coli. To identify the additional sequences included in the V. cholerae transcript, we performed 5' and 3' RACE, using RNA from wt cells grown in the presence of an iron chelator. Sequencing the amplification products from these reactions revealed that the V. cholerae RyhB extends an additional ~60 nucleotides at each end relative to its E. coli homolog. These results indicate that the V. cholerae RyhB is 215 nt long, which closely corresponds to the size observed on Northern blots. A stretch of approximately 60 nt within this sequence (nt 92 to 151) is also present in the genomes of other Vibrio species (e.g., V. vulnificus and V. parahaemolyticus). However, only the central region of the transcript (nt 102 to 130) is conserved among more distantly related species (Fig. 2A). The promoter prediction program BPROM detects a putative promoter upstream of the apparent transcriptional start site. This sequence overlaps with a potential Fur-binding site (Fig. 2A) that matches a consensus target at 12 of 19 bases, consistent with our observation that ryhB expression is repressed in an iron- and Fur-dependent manner (Fig. 1C).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. Boundaries, features, and potential base pairing for V. cholerae RyhB. A. Start and end sites of V. cholerae RyhB were determined by 5' and 3' RACE, respectively. Potential binding sites for RNA polymerase (–35 and –10) were identified using BPROM. The candidate Fur binding site (underlined) matches a consensus sequence at 12 of 19 positions. A ~60-nt region is conserved in V. cholerae, V. vulnificus and V. parahaemolyticus. A ~28-nt region (bold) is conserved among vibrios, Yersinia spp., E. coli, Salmonella spp., Photobacterium profundum, and other bacteria. B. Sequence complementarity between V. cholerae RyhB and the leader sequence of sodB. C. Sequence complementarity between V. cholerae RyhB and the 5' end of sdhC. The first translated codon of sdhC is boxed.

 
Identification of genes regulated by RyhB. Two approaches were taken to identifying genes whose transcript abundance might be regulated by RyhB. As regulation in E. coli is thought to be dependent on base pairing between the sRNA and its target mRNAs (12, 22), we first searched the V. cholerae genome for sequences complementary to the ~60-nt conserved core of RyhB. However, this analysis yielded only one sequence (other than ryhB itself) with an E value of less than 0.1: the putative 5' untranslated region of sodB (VC2045), which had an E value of 0.053 in the BLASTN 2.2.9 analysis. A 16-nucleotide sequence beginning 60 bases upstream of the predicted sodB translational start site shows perfect complementarity to a region of RyhB that is conserved both among vibrios and other bacterial species (Fig. 2B). In E. coli, sodB encodes an Fe-containing superoxide dismutase previously shown to be regulated by RyhB. Interestingly, however, sequences corresponding to those that mediate SodB:RyhB RNA base pairing in E. coli (12) were not detected by the BLASTN analysis, although there is some complementarity between these regions. Instead, distinct sequences from both SodB and RyhB RNA were found to maximize potential base pairing between the two transcripts.

To identify additional candidate members of the RyhB regulon, we used DNA microarrays to compare gene expression in wt and ryhB V. cholerae. Both strains were grown in minimal medium (M63) supplemented with dipyridyl in order to maximize differential expression of RyhB-regulated genes. We identified 48 genes whose transcript abundance consistently differed between the wt and mutant strain by at least 1.5-fold under these growth conditions (Table 1). A number of the apparently up-regulated genes are known to encode iron-containing proteins, consistent with RyhB's role in other organisms. These genes include sodB (VC2045), sdhC (VC2091), a fumarate hydratase (VC1304), and gltB1 (VC2373). sodB, sdhC, and fumA (encoding fumarate hydratase) have also been found to be regulated by RyhB in E. coli, indicating that there is some conservation of the RyhB regulon among different organisms. However, no changes in transcript abundance were detected for homologs of other members of the E. coli regulon, such as acnA, ftn, and bfr. Instead, several genes encoding enzymes involved in amino acid synthesis and utilization were found to have increased transcript abundance in the V. cholerae ryhB mutant, including trpAB (VC1169/1170), hutU (VC1203), leuC (VC2492), and kbl (VCA0886). These genes and many others found to have increased transcript abundance in the V. cholerae ryhB mutant have no apparent connection to iron metabolism, though it is possible that a relationship remains to be detected. In addition, most of the genes found to have reduced transcript levels in the ryhB mutant have not been reported to encode iron-containing proteins. Down-regulation of target transcripts has not previously been reported for RyhB; thus, these genes, which lack any obvious common features, are a novel component of this regulon. However, it should be noted that genes identified in the microarray analysis may be affected indirectly or directly by RyhB and that differences in transcript abundance have only been confirmed for a subset of genes (see below).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Genes with transcript abundances differing by 1.5-fold in wt and ryhB V. cholerae

 
Altered expression of several of the genes identified by microarray hybridization was confirmed using Northern blotting. Increased transcript levels for sodB, trpA, and ompA were detected in RNA from the ryhB mutant and from an hfq mutant as well, suggesting that the sRNA and Hfq act in conjunction to regulate expression of these genes (Fig. 3A-C). Northern blotting also confirmed that transcripts for nrdB and rtxA have reduced abundance in the ryhB mutant (Fig. 3D, E). Interestingly, deletion of hfq had a less-pronounced effect on the abundance of these transcripts. We were unable to detect RyhB-dependent changes in transcript abundance for VC2091 (sdhC), as expression levels were apparently too low to be detectable on Northern blots, perhaps because its promoter is not highly active when glucose is used as a carbon source (data not shown and reference 23). However, we did identify sequence near the 5' end of VC2091 that may have the capacity to pair with RyhB (Fig. 2C), suggesting a possible means for regulating the abundance of VC2091 transcripts.



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 3. Northern blot analyses of genes identified in microarray analyses as differentially expressed in wt and ryhB V. cholerae. RNA was isolated from wt, ryhB, and hfq V. cholerae grown in M63-dipyridyl. Blots were hybridized to riboprobes complementary to transcripts of VC2045 (A), VC1169 (B), VC2213 (C), VC1255 (D), and VC1451 (E).

 
Deletion of ryhB does not impair growth of V. cholerae in iron-poor media or in vivo. Since pathogenic V. cholerae may occupy environments in which iron is scarce and since RyhB is thought to contribute to efficient iron utilization, we assessed whether deletion of ryhB impaired growth of V. cholerae when the supply of iron was limited. Comparison of the growth of wt and ryhB V. cholerae in M63, which contains only 1.7 µM FeSO4·7 H2O and has been shown to induce RyhB expression (Fig. 1A), revealed that their levels of growth were equivalent under this condition (Fig. 4A). In addition, we found that after several (>3) hours of growth in M63-25 µM dipyridyl the ryhB mutant grew slightly more rapidly than the wt strain (Fig. 4B). Thus, disruption of RyhB-dependent gene regulation is clearly not detrimental to growth of V. cholerae under iron-limiting conditions.



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 4. Comparative growth analyses of wt and ryhB V. cholerae in vitro and in the suckling mouse. Growth curves for wt and ryhB V. cholerae grown in M63 (A) and M63-25 µM dipyridyl (B) are shown. Cultures for each strain were grown in duplicate; both measurements were plotted. C. Competitive indices for wt and ryhB V. cholerae grown in the suckling mouse (in vivo) and in LB medium (in vitro). The competitive index is defined as follows: (mutantouput/wtoutput)/(mutantinput/wtinput). Thus, a competitive index of <1.0 indicates a strain with a competitive disadvantage.

 
We also assessed whether V. cholerae requires ryhB to colonize the small intestines of suckling mice, which are an established model host for study of cholera pathogenesis. Previous analyses revealed that high-affinity iron acquisition systems are important for murine intestinal colonization by V. cholerae (34) but also suggested that multiple iron sources are available in this environment and that iron may not be in limited supply (6, 24). To determine whether RyhB-dependent regulation of iron utilization is important for intraintestinal survival in a murine host, we performed in vivo competition assays. These experiments did not reveal a statistically significant difference between growth of the ryhB and wt strains in the small intestine of the suckling mouse (Fig. 4C). Thus, proper control of the RyhB regulon is clearly not critical for survival of V. cholerae in a murine host, and inappropriate expression of this regulon cannot account for the attenuation of an hfq mutant in this model system.

The degree of iron availability in the suckling mouse intestine has not been directly assayed, and conflicting results concerning in vivo expression of iron-regulated genes have been published (6, 13). Since we had characterized V. cholerae expression of RyhB in response to various iron levels, we assessed whether the degree of RyhB expression in the murine small intestine is indicative of an iron-replete or an iron-deficient environment. We used quantitative RT-PCR to determine the abundance of ryhB transcripts relative to those of a control gene (rpoB) in RNA isolated following growth of wt V. cholerae in the murine intestine and other environments. Levels of rpoB transcripts are relatively constant; thus, changes in the transcript ratio are indicative of changes in the abundance of RyhB. In wt cells grown in LB, the mean transcript ratio was 2.35; this defines the ratio for "uninduced" levels of RyhB (Table 2). In contrast, the mean transcript ratio for V. cholerae grown in LB-100 µM dipyridyl was 4,775, a finding consistent with the RyhB induction observed under these conditions on Northern blots. For RNA obtained from five murine small intestines infected with V. cholerae, the transcript ratio ranged from 9.9 to 192.1, with a mean value of 56.5 (Table 2); thus, the highest transcript ratio measured for the intestinal samples is almost 10-fold lower than the lowest ratio for cells cultured in LB-dipyridyl. The lack of overlap between these data sets suggests that, overall, the murine small intestine is not a highly inducing environment, although it appears that a small amount of RyhB induction takes place there, perhaps in a subset of cells. The slight increase in the ryhB/rpoB ratio in intestinal samples compared to cells grown in LB medium may also reflect differences between the bacterial growth phases, as preliminary data suggest that cells grown to a lower density in LB medium also have an increased transcript ratio (data not shown). Nonetheless, it is clear that ryhB transcripts in V. cholerae isolated from infected mice are far less abundant than in cells grown in the presence of an iron chelator, suggesting that the suckling mouse model of V. cholerae infection is not highly limited for iron.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Relative abundance of ryhB and rpoB transcripts in N16961 grown in LB with or without dipyridyl and in the suckling mouse small intestine

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have characterized the sRNA RyhB and its regulon in V. cholerae. As in E. coli, expression of RyhB is repressed by iron and Fur, and RyhB abundance is influenced by the RNA chaperone Hfq. Hfq and RyhB can be copurified from V. cholerae, and high levels of RyhB are only detectable in the presence of Hfq, suggesting that, as in E. coli, Hfq stabilizes this sRNA. There is a high degree of similarity between the central regions of RyhB from V. cholerae and E. coli; however, the majority of the sRNA sequence is not conserved between these two organisms, and the V. cholerae sequence is >100 nucleotides longer than the E. coli sequence. More-extensive conservation can be detected among putative RyhB homologs of various vibrio species, but even the putative V. parahaemolyticus and V. vulnificus homologs are not significantly similar to V. cholerae RyhB outside of the central 60 nucleotides. Despite the differences between the RyhBs of V. cholerae and E. coli, our analyses suggest that they have overlapping roles. Several of the genes known to be regulated by RyhB in E. coli are differentially expressed in ryhB and wt V. cholerae, suggesting that RyhB controls their expression in V. cholerae as well. In particular, RyhB appears to down-regulate transcript abundance for nonessential iron-containing proteins, including superoxide dismutase, succinate dehydrogenase, fumarate hydratase, and glutamate synthase. However, our analyses suggest that, at least in V. cholerae, RyhB's cellular role extends beyond regulation of iron utilization, as numerous genes with no apparent connection to iron were found to be differentially expressed in a ryhB mutant. Several genes of the E. coli RyhB regulon do not appear to be controlled by RyhB in V. cholerae, suggesting that sRNAs can gain or lose a subset of targets as organisms evolve.

Candidate members of the RyhB regulon were primarily identified using microarray analyses. We identified 48 genes whose transcript abundances differed by at least 1.5-fold between the wt and ryhB strains of V. cholerae in three independent experiments. However, it is possible that selection of these criteria prevented identification of additional legitimate RyhB targets. For example, genes with an average transcript increase of >1.5-fold in the three experiments, but with one value of <1.5-fold due to experimental variation, have not been included in our definition of the RyhB regulon. Relaxing the selection criteria to encompass these genes would result in the inclusion of 65 additional genes, a number of which appear to lie within operons containing genes meeting the more stringent criteria (see Table S1 in the supplementary material). Thus, it is likely that some, though probably not all, of these additional genes are genuine members of the RyhB regulon. It remains to be seen whether these genes, as well as those meeting the more stringent selection criteria, are also regulated by RyhB in other organisms, as to date microarray analyses have not been reported for other organisms.

Genes identified through the microarray analyses may be regulated either directly or indirectly by RyhB. It will be particularly interesting to assess whether any of the genes with decreased transcript abundance in the ryhB mutant are direct targets of RyhB, as to date RyhB has been shown only to promote transcript instability. However, another sRNA, GadY, was recently reported to promote accumulation of a target mRNA (27), and it is certainly possible that RyhB has a similar affect on some of its targets. Sequence analyses suggest that at least some of the up-regulated genes—sodB and perhaps sdhC—are direct targets of RyhB, but this awaits experimental confirmation.

Identification of direct sRNA targets is challenging, both for RyhB and for other sRNAs, and the targets of most sRNAs described to date remain unknown. Known sRNA targets have largely been identified through sequence analyses and through screening of candidates suggested by phenotypic analyses and other studies. Potential for base pairing between candidate transcripts and sRNAs can often be detected; however, this pairing is often not extensive enough for detection with algorithms such as BLASTN. For example, sequence comparisons of E. coli sRNA:mRNA pairs reveals that many have fewer than 15 contiguous base pairs (e.g., DsrA:RpoS, RprA:RpoS, RyhB:SodB, and RyhB:SdhC/D) (12, 23, 30). BLASTN analyses of the V. cholerae genome only detect one region whose RyhB sequence similarity has an E value of <0.1 (sodB, as mentioned above, with 16 contiguous bases). Regions with higher scores (15 or fewer contiguous base pairs or longer regions of interrupted similarity) can also be identified; however, inspection of microarray data suggests that none of these are targets of RyhB, at least under the growth conditions analyzed (data not shown). V. cholerae RyhB and sdhC are not found to have similar sequences in such analyses, despite the potential pairing shown in Fig. 2C. Thus, although some sRNA targets have been identified via sequence comparisons, it is becoming increasingly evident that new approaches are needed for efficient identification and/or confirmation of sRNA targets.

It is also worth noting that maximal potential base pairing between V. cholerae RyhB and the mRNA for sodB does not utilize segments of either RNA shown to mediate interaction in E. coli. Unlike the complementary sequences shown in Fig. 2B for V. cholerae, the E. coli sequences overlap with the sodB start codon and thus are expected to interfere with mRNA translation; the mechanistic consequences of the pairing shown in Fig. 2B are less obvious. A similar situation is found for sdhC. The proposed RyhB target site in the E. coli transcript (at the 3' end) (23) is not well conserved in the V. cholerae gene, and this region of V. cholerae sequence is not likely to pair with V. cholerae RyhB; however, alternate regions of the V. cholerae genes appear to have better capacity for pairing (Fig. 2C). It would be fascinating if the sRNA:mRNA transcript pairs in V. cholerae and E. coli contained the same RNA partners but did not utilize homologous subsequences.

Thus far, conservation of sRNAs among bacterial species appears to be fairly limited. It may be that many sRNAs evolved relatively recently, e.g., after the divergence of related species such as V. cholerae and E. coli. Alternatively, it may be that sRNAs were present in a common ancestor of related species but that they have evolved so rapidly that no homology remains. Such evolution might occur if no selective pressures promote conservation of the sRNAs or if changes in the target genes promote selection of strains with compensatory changes in the sRNAs. For sRNAs present in multiple organisms, such as RyhB, the full extent of regulon conservation is not yet known, although we have found both similarities and differences between the sets of genes controlled by RyhB in V. cholerae and E. coli. In the future, once complete regulons have been reported for multiple organisms, it will be possible to perform more-thorough analyses of the extent to which regulons change as species diverge. Such analyses may also lead to the identification of additional sRNAs like PrrF1 and PrrF2, functional homologs of RyhB produced in Pseudomonas aeruginosa that lack any apparent sequence homology (41).

Our studies yielded somewhat unexpected results concerning Fur-mediated repression in V. cholerae. We found that ryhB is highly expressed in {Delta}fur strains both in the presence and absence of available iron but that ryhB expression is still iron regulated in fur::Ap strains. Such fur::Ap insertion mutants have been widely used for characterization of Fur-dependent repression in V. cholerae, as the mutation largely abolishes iron-dependent regulation of a number of Fur targets. Our finding that residual Fur function in such strains is apparently sufficient to repress ryhB suggests that V. cholerae Fur has a high affinity for the ryhB promoter relative to those of other target genes. On the basis of analyses of Fur binding sites in E. coli and other bacteria, the V. cholerae ryhB promoter would not be expected to be a preferred binding site for Fur, as it matches a consensus sequence at only 12 of 19 positions and lacks both palindromic structure and complete GATAAT repeats (11). However, sequence comparisons have also revealed that amino acids adjacent to the putative DNA binding domain of V. cholerae Fur differ from those of most Fur homologs; consequently, a consensus Fur box in V. cholerae may ultimately be found to differ from that in other organisms (28).

Our study also suggests a potential shortcoming of the suckling mouse model for studies of cholera pathogenesis. Analyses of RyhB expression in the murine intestine indicate that iron is not in limited supply in this environment, as was unexpectedly predicted from analyses of the virulence of V. cholerae lacking several iron acquisition systems (24, 35). In contrast, several studies have reported that iron is scarce within ligated rabbit ileal loops (33, 42), which are also used for studies of V. cholerae virulence. Though ligated loops may also have limitations as a model system, substantial overlap has been observed between genes expressed by V. cholerae in this environment and V. cholerae shed within stool from human cholera patients (5). This set of genes includes several genes known to be induced by iron limitation, suggesting that at least some cells within the human host face conditions of iron scarcity. Still, it is likely that bacteria shed from the host are not equivalent in gene expression to bacteria that have penetrated the intestinal mucus layer and formed microcolonies on the epithelial surface. It is generally assumed that iron is sequestered and not readily available to bacteria that colonize a human (or other mammalian) host; however, we are not aware of any studies directly assessing iron levels in the human small intestine. Thus, while our data suggest that commonly held assumptions about the intestinal environment are probably not accurate with respect to suckling mice, definitive data regarding the availability of iron to bacteria colonizing the human small intestine have yet to be generated.


    ACKNOWLEDGMENTS
 
We thank L. Sonenshein, A. Kane, and P. Budde for critical reading of the manuscript, A. Camilli for supplying pCML13, and the NEMC GRASP Center for preparation of plates and media.

This work was funded by National Institutes of Health grants AI42347 and AI59698 and P30DK-34928 to the NEMC GRASP Digestive Center and by the Howard Hughes Medical Institute.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-2778. Fax: (617) 636-2723. E-mail: brigid.davis{at}tufts.edu. Back

{dagger} Supplementary material for this article may be found at http://jb.asm.org/. Back

{ddagger} Present address: Tufts-NEMC, 750 Washington St., Box 041, Boston, MA 02111. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abdul-Tehrani, H., A. J. Hudson, Y.-S. Chang, A. R. Timms, C. Hawkins, J. M. Williams, P. M. Harrison, J. R. Guest, and S. C. Andrews. 1999. Ferritin mutants of Escherichia coli are iron deficient and growth impaired, and fur mutants are iron deficient. J. Bacteriol. 181:1415-1428.[Abstract/Free Full Text]
  2. Altuvia, S. 2004. Regulatory small RNAs: the key to coordinating global regulatory circuits. J. Bacteriol. 186:6679-6680.[Free Full Text]
  3. Argaman, L., R. Hershberg, J. Vogel, G. Bejerano, E. G. Wagner, H. Margalit, and S. Altuvia. 2001. Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr. Biol. 11:941-950.[CrossRef][Medline]
  4. Asubel, F. M., R. Brent, R. E. Kingston, D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1995. Current protocols in molecular biology. John Wiley and Sons, Inc., New York, N.Y.
  5. Bina, J., J. Zhu, M. Dziejman, S. Faruque, S. Calderwood, and J. Mekalanos. 2003. ToxR regulon of Vibrio cholerae and its expression in vibrios shed by cholera patients. Proc. Natl. Acad. Sci. USA 100:2801-2806.[Abstract/Free Full Text]
  6. Camilli, A., D. T. Beattie, and J. J. Mekalanos. 1994. Use of genetic recombination as a reporter of gene expression. Proc. Natl. Acad. Sci. USA 91:2634-2638.[Abstract/Free Full Text]
  7. Chen, S., A. Zhang, L. B. Blyn, and G. Storz. 2004. MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. J. Bacteriol. 186:6689-6697.[Abstract/Free Full Text]
  8. Ding, Y., B. M. Davis, and M. K. Waldor. 2004. Hfq is essential for Vibrio cholerae virulence and downregulates sigma E expression. Mol. Microbiol. 53:345-354.[CrossRef][Medline]
  9. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310-4317.[Abstract/Free Full Text]
  10. Dubrac, S., and D. Touati. 2000. Fur positive regulation of iron superoxide dismutase in Escherichia coli: functional analysis of the sodB promoter. J. Bacteriol. 182:3802-3808.[Abstract/Free Full Text]
  11. Escolar, L., J. Perez-Martin, and V. de Lorenzo. 1999. Opening the iron box: transcriptional metalloregulation by the Fur protein. J. Bacteriol. 181:6223-6229.[Free Full Text]
  12. Geissmann, T. A., and D. Touati. 2004. Hfq, a new chaperoning role: binding to messenger RNA determines access for small RNA regulator. EMBO J. 23:396-405.[CrossRef][Medline]
  13. Goldberg, M. B., V. J. DiRita, and S. B. Calderwood. 1990. Identification of an iron-regulated virulence determinant in Vibrio cholerae, using TnphoA mutagenesis. Infect. Immun. 58:55-60.[Abstract/Free Full Text]
  14. Gruer, M. J., and J. R. Guest. 1994. Two genetically-distinct and differentially-regulated aconitases (AcnA and AcnB) in Escherichia coli. Microbiology 140(Pt. 10):2531-2541.[Abstract]
  15. Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, L. Umayam, S. R. Gill, K. E. Nelson, T. D. Read, H. Tettelin, D. Richardson, M. D. Ermolaeva, J. Vamathevan, S. Bass, H. Qin, I. Dragoi, P. Sellers, L. McDonald, T. Utterback, R. D. Fleishmann, W. C. Nierman, O. White, S. L. Salzberg, H. O. Smith, R. R. Caldwell, J. J. Mekalanos, J. C. Venter, and C. M. Fraser. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477-483.[CrossRef][Medline]
  16. Hershberg, R., S. Altuvia, and H. Margalit. 2003. A survey of small RNA-encoding genes in Escherichia coli. Nucleic Acids Res. 31:1813-1820.[Abstract/Free Full Text]
  17. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68.[CrossRef][Medline]
  18. Lenz, D. H., K. C. Mok, B. N. Lilley, R. V. Kulkarni, N. S. Wingreen, and B. L. Bassler. 2004. The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell 118:69-82.[CrossRef][Medline]
  19. Litwin, C. M., and S. B. Calderwood. 1994. Analysis of the complexity of gene regulation by fur in Vibrio cholerae. J. Bacteriol. 176:240-248.[Abstract/Free Full Text]
  20. Litwin, C. M., and S. B. Calderwood. 1993. Cloning and genetic analysis of the Vibrio vulnificus fur gene and construction of a fur mutant by in vivo marker exchange. J. Bacteriol. 175:706-715.[Abstract/Free Full Text]
  21. Majdalani, N., C. Cunning, D. Sledjeski, T. Elliott, and S. Gottesman. 1998. DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription. Proc. Natl. Acad. Sci. USA 95:12462-12467.[Abstract/Free Full Text]
  22. Masse, E., F. E. Escorcia, and S. Gottesman. 2003. Coupled degradation of a small regulatory RNA and its mRNA targets in Escherichia coli. Genes Dev. 17:2374-2383.[Abstract/Free Full Text]
  23. Masse, E., and S. Gottesman. 2002. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 99:4620-4625.[Abstract/Free Full Text]
  24. Mey, A. R., and S. M. Payne. 2001. Haem utilization in Vibrio cholerae involves multiple TonB-dependent haem receptors. Mol. Microbiol. 42:835-849.[CrossRef][Medline]
  25. Moller, T., T. Franch, P. Hojrup, D. R. Keene, H. P. Bachinger, R. G. Brennan, and P. Valentin-Hansen. 2002. Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction. Mol. Cell 9:23-30.[CrossRef][Medline]
  26. Occhino, D. A., E. E. Wyckoff, D. P. Henderson, T. J. Wrona, and S. M. Payne. 1998. Vibrio cholerae iron transport: haem transport genes are linked to one of two sets of tonB, exbB, exbD genes. Mol. Microbiol. 29:1493-1507.[CrossRef][Medline]
  27. Opdyke, J. A., J.-G. Kang, and G. Storz. 2004. GadY, a small-RNA regulator of acid response genes in Escherichia coli. J. Bacteriol. 186:6698-6705.[Abstract/Free Full Text]
  28. Panina, E. M., A. A. Mironov, and M. S. Gelfand. 2001. Comparative analysis of FUR regulons in gamma-proteobacteria. Nucleic Acids Res. 29:5195-5206.[Abstract/Free Full Text]
  29. Quinones, M., H. K. Kimsey, and M. K. Waldor. 2004. LexA cleavage is required for CTX prophage induction. Mol. Cell 17:291-300.
  30. Repoila, F., N. Majdalani, and S. Gottesman. 2003. Small non-coding RNAs, co-ordinators of adaptation processes in Escherichia coli: the RpoS paradigm. Mol. Microbiol. 48:855-861.[CrossRef][Medline]
  31. Rogers, M. B., J. A. Sexton, G. J. DeCastro, and S. B. Calderwood. 2000. Identification of an operon required for ferrichrome iron utilization in Vibrio cholerae. J. Bacteriol. 182:2350-2353.[Abstract/Free Full Text]
  32. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol. Microbiol. 29:1321-1330.[CrossRef][Medline]
  33. Sciortino, C. V., and R. A. Finkelstein. 1983. Vibrio cholerae expresses iron-regulated outer membrane proteins in vivo. Infect. Immun. 42:990-996.[Abstract/Free Full Text]
  34. Seliger, S. S., A. R. Mey, A. M. Valle, and S. M. Payne. 2001. The two TonB systems of Vibrio cholerae: redundant and specific functions. Mol. Microbiol. 39:801-812.[CrossRef][Medline]
  35. Sigel, S. P., J. A. Stoebner, and S. M. Payne. 1985. Iron-vibriobactin transport system is not required for virulence of Vibrio cholerae. Infect. Immun. 47:360-362.[Abstract/Free Full Text]
  36. Sledjeski, D. D., C. Whitman, and A. Zhang. 2001. Hfq is necessary for regulation by the untranslated RNA DsrA. J. Bacteriol. 183:1997-2005.[Abstract/Free Full Text]
  37. Tashima, K. T., P. A. Carroll, M. B. Rogers, and S. B. Calderwood. 1996. Relative importance of three iron-regulated outer membrane proteins for in vivo growth of Vibrio cholerae. Infect. Immun. 64:1756-1761.[Abstract]
  38. Vogel, J., V. Bartels, T. H. Tang, G. Churakov, J. G. Slagter-Jager, A. Huttenhofer, and E. G. Wagner. 2003. RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria. Nucleic Acids Res. 31:6435-6443.[Abstract/Free Full Text]
  39. Wassarman, K. M., F. Repoila, C. Rosenow, G. Storz, and S. Gottesman. 2001. Identification of novel small RNAs using comparative genomics and microarrays. Genes Dev. 15:1637-1651.[Abstract/Free Full Text]
  40. Wassarman, K. M., and G. Storz. 2000. 6S RNA regulates E. coli RNA polymerase activity. Cell 101:613-623.[CrossRef][Medline]
  41. Wilderman, P. J., N. A. Sowa, D. J. FitzGerald, P. C. FitzGerald, S. Gottesman, U. A. Ochsner, and M. L. Vasil. 2004. Identification of tandem duplicate regulatory small RNAs in Pseudomonas aeruginosa involved in iron homeostasis. Proc. Natl. Acad. Sci. USA 101:9792-9797.[Abstract/Free Full Text]
  42. Xu, Q., M. Dziejman, and J. J. Mekalanos. 2003. Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro. Proc. Natl. Acad. Sci. USA 100:1286-1291.[Abstract/Free Full Text]
  43. Zhang, A., K. M. Wassarman, J. Ortega, A. C. Steven, and G. Storz. 2002. The Sm-like Hfq protein increases OxyS RNA interaction with target mRNAs. Mol. Cell 9:11-22.[CrossRef][Medline]
  44. Zhang, A., K. M. Wassarman, C. Rosenow, B. C. Tjaden, G. Storz, and S. Gottesman. 2003. Global analysis of small RNA and mRNA targets of Hfq. Mol. Microbiol. 50:1111-1124.[CrossRef][Medline]


Journal of Bacteriology, June 2005, p. 4005-4014, Vol. 187, No. 12
0021-9193/05/$08.00+0     doi:10.1128/JB.187.12.4005-4014.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, B. M.
Right arrow Articles by Waldor, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, B. M.
Right arrow Articles by Waldor, M. K.


Home Help [Feedback] [For Subscribers] [Archive]