Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Awaya, J. D. Articles by Borthakur, D. Search for Related Content PubMed PubMed Citation Articles by Awaya, J. D. Articles by Borthakur, D.

 Previous Article  |  Next Article 

Journal of Bacteriology, July 2005, p. 4480-4487, Vol. 187, No. 13
0021-9193/05/$08.00+0     doi:10.1128/JB.187.13.4480-4487.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

pyd Genes of Rhizobium sp. Strain TAL1145 Are Required for Degradation of 3-Hydroxy-4-Pyridone, an Aromatic Intermediate in Mimosine Metabolism

Jonathan D. Awaya, Paul M. Fox, and Dulal Borthakur^*

Department of Molecular Biosciences and Bioengineering, University of Hawaii at Manoa, 1955 East-West Road, Honolulu, Hawaii 96822

Received 12 February 2005/ Accepted 1 April 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
Rhizobium sp. strain TAL1145 degrades the Leucaena toxin mimosine and its degradation product 3-hydroxy-4-pyridone (HP). The aim of this investigation is to characterize the Rhizobium genes for HP degradation and transport. These genes were localized by subcloning and mutagenesis on a previously isolated cosmid, pUHR263, containing mid genes of TAL1145 required for mimosine degradation. Two structural genes, pydA and pydB, encoding a metacleavage dioxygenase and a hydrolase, respectively, are required for degradation of HP, and three genes, pydC, pydD, and pydE, encoding proteins of an ABC transporter, are involved in the uptake of HP by TAL1145. These genes are induced by HP, although both pydA and pydB show low levels of expression without HP. pydA and pydB are cotranscribed, while pydC, pydD, and pydE are each transcribed from separate promoters. PydA and PydB show no homology with other dioxygenases and hydrolases in Sinorhizobium meliloti, Mesorhizobium loti, and Bradyrhizobium japonicum. Among various root nodule bacteria, the ability to degrade mimosine or HP is unique to some Leucaena-nodulating Rhizobium strains.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Many soil bacteria can degrade various toxic aromatic compounds, such as benzene, toluene, ethylbenzene, and xylene (10). Mimosine [ß-N-(3-hydroxy-4-pyridone)--aminopropionic acid] is one such aromatic toxin produced by Leucaena and Mimosa spp. (6, 16). Mimosine is known to be toxic to both microorganisms and eukaryotic cells (12, 20). Mimosine is a strong chelator of iron, with a binding constant of 10³⁶ (11). Its degradation product 3-hydroxy-4-pyridone (HP) also chelates iron (14). Chelating action by mimosine and HP inhibits iron-dependent enzymes and thereby blocks biochemical activities by depriving the cells of available iron (17). Mimosine present in the root exudates of Leucaena inhibits the growth of some root nodule bacteria (19). However, some Leucaena-nodulating Rhizobium strains are able to utilize mimosine as a source of carbon and nitrogen (18, 20).

HP is an intermediate of mimosine degradation in Rhizobium (4). The mid genes, required for conversion of mimosine into HP, are located within a 12.6-kb fragment of the TAL1145 chromosome, cloned in cosmids pUHR181 and pUHR263 (5). When pUHR181 was transferred to a Mid^– strain, such as TAL182, the transconjugants degraded mimosine into HP, whereas the transconjugants of TAL182 containing pUHR263 degraded mimosine completely (8). Cosmid pUHR263 contains a 12-kb fragment, which is absent in pUHR181. It was hypothesized that genes for HP degradation are located in this 12-kb region of pUHR263. The objective of this study is to characterize the genes for HP degradation in pUHR263.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains, plasmids, and culture conditions. Bacterial strains and plasmids used in this study are described in Table 1. The Escherichia coli and Rhizobium strains were grown as described previously (20, 21). The growth rates were determined in yeast extract-mannitol (YEM) medium supplemented with 3 mM mimosine or HP and 1 mM FeCl₃ and with the pH adjusted with 1 N HCl to 6.8. Cultures (25 ml) were grown in 250-ml flasks and sampled at 10- to 14-h intervals. Cell density was measured with a spectrophotometer (Spectronic Instruments, Rochester, NY) at 600 nm until cultures reached stationary growth phase. Media samples were analyzed through high-performance liquid chromatography (HPLC) as described below.

View this table: [in this window] [in a new window]

TABLE 1. Bacterial strains and plasmids used in this study

Detection of mimosine and HP. Cell cultures were centrifuged (5,000 x g), and the supernatants were filtered through 0.2-µm nylon filters. Analysis was done on a Dionex HPLC with Chromeleon software and performed with a reverse-phase C₁₈ column (250 by 4.6 mm; Phenomenex, Torrance, CA) at room temperature with a 0.2% orthophosphoric acid mobile phase at a flow rate of 1 ml/min. A diode array detector monitored absorbance at a range of 200 to 300 nm. The wavelength for the detection of mimosine and HP was determined to be 275 nm. Mimosine and HP had a retention time of 2.8 and 4.8 min, respectively.

DNA manipulation, analysis, and sequencing. Plasmid DNA isolation and manipulations were preformed by standard procedures (13). Nucleotide sequence was determined by automated sequencing at the Molecular Biology and Biotechnology Facilities, University of Hawaii at Manoa. Both strands of the DNA fragment were sequenced using a primer-walking strategy.

Tn3Hogus mutagenesis. Transposon insertion mutagenesis was done as described previously (5). Locations of the Tn3Hogus transposon insertions were determined by sequencing the flanking region of the transposon. For PCR amplification of the flanking region, a reverse gus primer (5'AATTCCACAGTTTTCGCGATC3') from the 5' region of the gus gene and different forward primers from the sequence of the 5.2-kb fragment were used such that they would produce a PCR product of approximately 500 to 1,000 bp. The PCR products were purified and sequenced using the reverse gus primer. From the sequence data, the junctions of the Tn3Hogus insertions were determined.

GUS activity assay. ß-Glucuronidase (GUS) activity assay was performed according to a previously described method (8). Methoxypyridone and pyridone were gifts from Thomas Hemscheidt (Department of Chemistry, University of Hawaii at Manoa), and 1,2 dimethyl-3-hydroxypyrid-4-one was a gift from Hiromu Matsumoto (Department of Molecular Biosciences and Bioengineering, University of Hawaii at Manoa).

Expression and purification of PydA and PydB. pUHR304 and pUHR305 were constructed using primer pairs pydA-UP (5'CGCACATATGAGGAGAAAGTTAATGGCTG 3') and pydA-DWN (5'CGTTAGATCTTATGCTGCTGCGTCGTAG 3') and pydB-UP (5'GCACCATATGCCTCATTTTGAAGACCGAG3') and pydB-DWN (5'GTTGAGATCTATATTGTGGTTGCGGGAAGAGC 3'). Underlining indicates restriction sites. Upstream primers for each contained an NdeI site, and downstream primers contained a BglII site. Amplified products were digested with NdeI and BglII and ligated into pET14b (Novagen, Madison, WI), which produced a His₆ tag at the N terminus. Transformed Origami DE3 E. coli cells (Novagen) containing pUHR304 and pUHR305 were grown in Luria broth at 37°C up to an optical density of 0.4. Cells were induced with 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) and grown for an additional 4 h. Origami cells containing PydA-His₆ and PydB-His₆ proteins were denatured with 6 M guanidine-HCl and purified according to the manufacturer's protocol using immobilized metal affinity chromatography (Clontech, Palo Alto, CA). Purified PydA-His₆ and PydB-His₆ were dialyzed against 0.2 M NaCl-50 mM sodium phosphate buffer overnight at 4°C to remove guanidine-HCl.

Protein analysis. E. coli and Rhizobium proteins were separated with sodium dodecyl sulfate-10% polyacrylamide gels. Protein gels were then transferred to a nitrocellulose membrane (Bio-Rad, Richmond, CA), and Western blotting was performed with an ECL Western blotting analysis system (Amersham Pharmacia Biotech). Primary polyclonal antibodies were developed from purified PydA-His₆ and PydB-His₆ and prepared by Alpha Diagnostic International (San Antonio, TX). The polyclonal antibodies were used at a concentration of 1:3,000.

RT-PCR. TAL1145 was cultured in 100 ml of tryptone-yeast extract broth at 28°C for a total of 36 h. After 24 h, 3 mM mimosine or HP was added to the medium, and the culture was grown for an additional 12 h. The culture was centrifuged, and the cells were washed with 100 ml of 0.5 M NaCl. Total RNA was isolated with QIAGEN's (Valencia, CA) RNeasy mini kit according to the manufacturer's protocol. Total RNA was treated with DNase I, incubated at room temperature for 15 min, and heat deactivated for 10 min at 65°C. Dnase I-treated total RNA was used for reverse transcriptase PCR (RT-PCR). RT-PCR was done with 1 µg of total RNA using Promega's (Madison, WI) reverse transcription system according to the manufacturer's recommendations. PCR was performed with 5 µl of the RT-PCR mixture with primers flanking the intergenic regions of pydAB, pydBC, pydCD, and pydDE. Expected PCR products were the following: 500 bp for pydAB using primers pydA-F (5'GGCGGCCTGTCGCATTGGCCT3') and pydB-R (5'ACCAGGCCCGGATCCGTGGAT3'), 300 bp for pydBC with primers pydB-F (5'CGTTGGATCACTTTTCGCGT3') and pydC-R (5'GCTTGAGCTGGGGATCGTAAC3'), 750 bp for pydCD with primers pydC-F (5'CCGTTGATCAAGAACGACCG3') and pydD-R (5'GACTGGCAGCCTGATATCGATC3'), and 700 bp for pydDE with primers pydD-F (5'TTCACAATCTACTGCGCGAATG3') and pydE-R (5'CCAGATCGGTATATTCGCCG3'). Additional PCR analyses were performed to determine pydA, pydC, and pydD expression in 3 mM HP-induced and uninduced cultures. The primers RTA-F (5'CATTCCTGTCATTCCGATCTACAC3') and RTA-R (5'GGCAATTCGCGTTCAACGATA3') yielded an expected 111-bp fragment, primers RTC-F (5'GTTGGATCACTTTTCGCGTCG3') and RTC-R (5'CGTTGAGATGGACCAGCGTTA3') produced a 124-bp product, and primers RTD-F (5'CGCTCTCGTTGAGTGCATCA3') and RTD-R (5'GACCTGGCTCTGTGACCGAT3') amplified a 103-bp fragment. Sigma factor, sigA, was used as a reference gene in PCR to control for the quantity of cDNA produced by RT-PCR. sigA is a housekeeping gene that encodes a sigma factor of an RNA polymerase required for viability under normal growth. Reference primers sigA-F (5'AGGCGCTGATCATCTGGC3') and sigA-R (5'GATCTTCTCAGGGCTCTGGAA3') generated an expected 131-bp PCR product. PCR was also conducted with total RNA not treated with reverse transcriptase as a negative control.

Plant test. Leucaena leucocephala K636 seeds were surface sterilized and germinated according to Parveen et al. (15). The plant experiments were conducted in Leonard jar assemblies containing nitrogen-free plant nutrient solution. Each Leonard jar contained four to five leucaena seedlings, and three replicates were grown for each treatment. One-week-old seedlings were inoculated with approximately 10⁶ rhizobia. Uninoculated control plants were grown to check for cross-contamination. The Leucaena plants were harvested 6 weeks after inoculation to examine nodulation.

Nucleotide sequence accession number. The nucleotide sequence reported was submitted to GenBank and given accession number AY729020.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Isolation of pyd mutants of TAL1145. Tn3Hogus insertion mutants of TAL1145 were constructed using pUHR263::Tn3Hogus derivatives. The pUHR263::Tn3Hogus derivatives were transferred to TAL1145, and the disrupted genes were marker exchanged into the chromosome to obtain mutations in the mid and pyd genes. The mutants were first screened for loss of the ability to grow on mimosine as the sole source of carbon and nitrogen. In this way, 26 mutants that could not utilize mimosine were identified. Restriction mapping of the corresponding pUHR263::Tn3Hogus derivatives for these mutants indicated that the Tn3Hogus insertions in most of the mutants were located on the previously characterized mid genes. However, several mutants in which the Tn3Hogus insertions were located outside the mid gene cluster were identified. These mutants were further screened for the ability to catabolize HP. Five mutants (PF9, JA139, JA140, PF106, and PF101) were selected on the basis of their inability to utilize HP.

Growth of PF9, JA139, JA140, PF106, and PF101 in media containing mimosine and HP. Mutants PF9, JA139, JA140, PF106, and PF101 do not have any auxotrophic defects and can grow as well as TAL1145 in YEM. PF9 and JA140 do not grow in minimal media containing either mimosine or HP as the sole source of carbon and nitrogen. PF106 and PF101 also do not grow on HP but grow slightly with mimosine as the sole source of carbon and nitrogen. When they were grown in YEM supplemented with 3 mM mimosine and 1 mM FeCl₃, they showed growth inhibition to various extents (Fig. 1a). HPLC analysis of the culture supernatants of the mutants at the end of the growth experiment showed that they degraded 90 to 95% of the mimosine in the media and accumulated up to 2 mM HP.

View larger version (18K): [in this window] [in a new window]

FIG. 1. Growth of Rhizobium strains in YEM containing 3 mM mimosine and 1 mM FeCl3 (a) and with 3 mM HP and 1 mM FeCl3 (b). The data points and error bars represent the means and standard deviations of three replicates, respectively.

None of the above five mutants could utilize HP in minimal medium, and the presence of HP in a complete medium inhibited the growth of three of these mutants to different extents. In YEM medium supplemented with 3 mM HP, mutants PF101 and PF106 grew as well as TAL1145. On the other hand, 3 mM HP caused complete growth inhibition of JA139 and JA140 and partial growth inhibition of PF9 in YEM (Fig. 1b). HPLC analysis showed that over 90 to 98% of HP still remained in the media after the stationary growth phase of these mutants, including PF101 and PF106, which were not inhibited by HP. These results establish that these five mutants are defective in HP degradation or transport.

Complementation of mutants PF9, JA139, JA140, PF106, and PF101. Restriction mapping showed that the Tn3Hogus insertions in mutants PF9, JA139, JA140, PF106, and PF101 were located on a 5.2-kb EcoRI fragment in cosmid pUHR263 but not present in cosmid pUHR181. This 5.2-kb EcoRI fragment of pUHR263 was subcloned in both orientations to obtain plasmids pUHR281 and pUHR283. Both pUHR281 and pUHR283 complement PF9, JA139, JA140, PF106, and PF101 for mimosine and HP degradation. The complemented mutants could grow on minimal medium containing mimosine or HP as the sole source of carbon and nitrogen. In YEM containing 3 mM mimosine or HP, these strains grew as well as TAL1145 and degraded mimosine or HP completely. A 3.1-kb PstI fragment from pUHR263 that overlaps with the 5.2-kb EcoRI fragment can also complement PF9 but not PF101, PF106, JA139, or JA140 (Fig. 2). EcoRI-PstI fragments subcloned from the 5.2-kb EcoRI fragment in plasmids pUHR328 and pUHR329 (1.1 kb and 1.4 kb, respectively) also complemented PF9 but not the other four mutants for mimosine degradation. However, a 2.2-kb EcoRI-HindIII subcloned fragment (pUHR322) complemented PF9, JA139, and JA140.

View larger version (22K): [in this window] [in a new window]

FIG. 2. Restriction map of cosmid pUHR263 isolated from Rhizobium sp. strain TAL1145 library containing genes for mimosine and HP degradation. A 5.2-kb fragment within pUHR281 contained pydA, pydB, pydC, pydD, and pydE (open arrows). Solid arrows indicate Tn3Hogus insertions and directions of TAL1145 mutants defective in HP degradation. B, BamHI; E, EcoRI; H, HindIII; P, PstI.

Nucleotide sequence analysis. Sequencing of the 5.2-kb EcoRI fragment in pUHR281 revealed five open reading frames in the same direction (Fig. 2). Since these genes complemented mutants defective in HP degradation (pyridone degradation), these open reading frames were named pydA, pydB, pydC, pydD, and pydE. The characteristics of the proteins encoded by these genes are shown in Table 2.

View this table: [in this window] [in a new window]

TABLE 2. Characteristics of proteins encoded by the pyd genes

RT-PCR analysis of pyd genes. To establish the operon structure of the pyd genes, RT-PCR was conducted using total RNA extracted from TAL1145 and primers developed for amplification of intergenic regions as well as within pydA, pydB, pydC, pydD, and pydE. PCR products were amplified within all of the pyd genes (Fig. 3). Primers flanking the intergenic region of pydAB successfully amplified PCR products. However, no PCR products were observed for pydBC, pydCD, and pydDE. This implicates that pydAB is transcribed as a single transcriptional unit, whereas pydC, pydD, and pydE are transcribed as separate transcriptional units. No PCR products were amplified from RNA samples alone.

View larger version (56K): [in this window] [in a new window]

FIG. 3. Analysis of the pyd gene cluster by RT-PCR. (a) Gel electrophoresis of the RT-PCR products using primers designed to amplify the intergenic regions of pydA-pydB (lane 1), pydB-pydC (lane 2), pydC-pydD (lane 3), and pydD-pydE (lane 4). Negative control PCRs containing total RNA without addition of reverse transcriptase were included in this assay (data not shown). RT-PCR amplified a fragment within pydA, pydB, pydC, pydD, and pydE in lanes 5 to 9, respectively. Positive control PCR products for pydD-pydE (lane 10), pydC-pydD (lane 11), and pydB-pydC (lane 12) using TAL1145 genomic DNA as the template are also shown. The sizes of the DNA fragments in the marker lanes (M) are indicated. (b) Organization of the pyd gene cluster, with arrows showing the approximate positions of the primers designed for RNA amplification in RT-PCR assays. (c) Transcriptional organization of the pyd genes. Bold arrows represent the transcriptional units deduced from RT-PCR experiments.

Induction of pydA, pydB, pydC, and pydD by mimosine, HP, and HP analogs. Western analysis revealed that pydA and pydB are expressed at low levels and induced to higher levels in the presence of mimosine and HP (Fig. 4). Therefore, GUS activity assays were performed to examine the expression levels of these genes induced by mimosine, HP, and HP analogs. The pydA::gus fusion mutant (PF9) showed low levels of GUS activity in the absence mimosine or HP. It showed a 39-fold increase in GUS activity in the presence of mimosine and a 113-fold increase in the presence of HP (Table 3). On the other hand, the pydB::gus fusion mutant (JA140) had no GUS activity in the absence of mimosine or HP. It showed induced GUS activity in the presence of mimosine or HP (Table 3). Mimosine and HP also induced GUS activities in the gus fusion mutants of pydC (PF106) and pydD (PF101). Both mutants had an increase in GUS activity, suggesting that HP activates the transcription of these genes (Table 3). To verify the induction of the pyd genes in the presence of HP, RT-PCR was performed on total RNA extracted from TAL1145 using primers developed for amplification within pydA, pydC, and pydD. Amplification of pydB was not performed because pydA and pydB are cotranscribed. Increased amplification of PCR products was detected for pydA, pydC, and pydD in the HP-induced cultures (Fig. 5). PCR analysis further supports the induction of the pyd genes by HP.

View larger version (29K): [in this window] [in a new window]

FIG. 4. PydA and PydB in Rhizobium detected by Western blot analysis using polyclonal antibodies specific for PydA (a) and PydB (b). Fifty micrograms of total protein was loaded for each sample. Lane 1, TAL1145 induced with mimosine; lane 2, uninduced TAL1145; lane 3, TAL1145 induced with HP.

View this table: [in this window] [in a new window]

TABLE 3. The induction of GUS activities in TAL1145 mutants containing pydA::gus, pydB::gus, pydC::gus, and pydD::gus fusions by mimosine, HP, or HP analogs

View larger version (70K): [in this window] [in a new window]

FIG. 5. RT-PCR analysis of RNA extracted from uninduced (u) and HP-induced (i) cultures of TAL1145 using primers specific for pydA, pydC, pydD, and sigA. Sizes of the fragments in the marker lane (M) are shown.

Induced GUS activity was also examined with 1 mM concentrations of the HP analogs shown in Fig. 6. Among these compounds, only 1,2 dimethyl-3-hydroxypyrid-4-one induced pydA, pydB, pydC, and pydD (Table 3). The other three compounds did not induce the transcription of these pyd genes.

View larger version (18K): [in this window] [in a new window]

FIG. 6. The structures of mimosine, HP, and HP analogs.

Induction of pydA. To determine if mimosine, HP, or both are inducers of pydA, the induction of pydA was determined by measuring GUS activity of the pydA::gus mutant, PF9, at sequential time intervals: 0, 2, 6, 8, and 12 h after mimosine induction (Fig. 7). PF9 converts mimosine into HP that accumulates in the growth medium. If the GUS activity of PF9 correlates with the presence of mimosine in the medium and decreases with the disappearance of mimosine, this would indicate that mimosine induces pydA transcription, whereas if the GUS activity coincides with the accumulation of HP as a result of mimosine degradation, this would indicate that the transcription of pydA is induced by HP. As seen in Fig. 7b, the mimosine concentration in the medium decreased with time and completely disappeared after 8 h. The disappearance of mimosine corresponded with the appearance and gradual accumulation of HP in the medium. The GUS activities of the PF9 cells started to increase sometime between 2 and 6 h, with the accumulation of HP in the medium. After 8 h, mimosine completely disappeared and HP accumulated to a concentration of 690 µM in the medium. The highest GUS activity was observed at 12 h in the presence of 780 µM HP and no mimosine in the medium (Fig. 7a). Similar induction results were observed by measuring GUS activity of the pydA::gus mutant in the presence of HP (Fig. 7c and d). In another parallel experiment, both mimosine and HP were added initially to the medium, and 200 µM mimosine was added every 2 h to sustain the amount of mimosine in the culture (Fig. 7e and f). The GUS activities of PF9 cells had similar induction results from 0 to 8 h for both the mimosine and HP treatments. However, from 8 to 12 h there was no increase in GUS activity, implying that mimosine may act as a repressor of pydA. A GUS activity assay of the pydA::gus mutant with 1 mM, 2 mM, and 3 mM HP resulted in no observed suppression of GUS activity at 8 to 12 h (data not shown), suggesting that mimosine, but not HP, repressed the transcription of pydA.

View larger version (34K): [in this window] [in a new window]

FIG. 7. The change in GUS activity in the pydA::gus mutant PF9 at different times following induction with mimosine, HP, or both mimosine and HP. In graphs a, c, and e, the induced GUS activity due to mimosine (open squares), HP (open triangles), both mimosine and HP (crosses), or glucose (open circles) in the PF9 cells at the end of a specific time period was calculated by subtracting the GUS activity in the preceding period. The PF9 cultures were grown in minimal media containing 1 mM concentrations of mimosine, HP, both mimosine and HP, or glucose. Graphs b, d, and f show the concentrations of mimosine (solid squares) and HP (solid triangles) in the culture supernatants of PF9 at different times corresponding to the GUS activities shown in graphs a, c, and e, respectively. Data and error bars represent the means and standard deviations of three replicates.

Expression of pyd genes in other rhizobia. Cosmid pUHR263 was transferred to other closely related soil bacteria, such as Agrobacterium tumefaciens EHA105, Rhizobium etli TAL182, S. meliloti NZP4013, and Burkholderia sp. BURK25, to determine if the mid and pyd genes are expressed in these bacteria. All cultures were grown at 28°C in YEM supplemented with 1 mM mimosine or HP. The transconjugants of Rhizobium etli TAL182 and A. tumefaciens EHA105 completely degraded both mimosine and HP in the media. The transconjugants of S. meliloti and Burkholderia could not degrade mimosine or HP, although their growth was not inhibited by these compounds. When the transconjugants of R. etli and A. tumefaciens containing only pydA and pydB in a plasmid were grown in the presence of HP, the R. etli transconjugants could degrade HP completely, whereas the transconjugants of A. tumefaciens degraded HP only partially (Table 4). However, among the transconjugants of these bacteria containing either pydA or pydB, only the R. etli transconjugants containing pydA in a plasmid could utilize HP. Thus, pydA alone could confer the ability to degrade HP in R. etli but not in other bacteria.

View this table: [in this window] [in a new window]

TABLE 4. The ability of R. etli and A. tumefaciens transconjugants to degrade mimosine and HP

Top Abstract Introduction Materials and Methods Results Discussion References

 
This investigation provides functional analyses of the genes involved in the degradation and transport of HP in Rhizobium. HP dioxygenase and HP hydrolase, encoded by pydA and pydB, are the two enzymes that are required for HP degradation. Dioxygenase and hydrolase are also found in all bacteria that degrade other aromatic compounds. Based on the homologies with other metacleavage dioxygenases, the HP dioxygenase appears to be a class III metacleavage enzyme involved in an extradiol cleavage reaction. S. meliloti, M. loti, and B. japonicum contain five, four, and nine genes, respectively, encoding dioxygenases in the genome. PydA has no similarities with any of these rhizobial dioxygenases. A possible metacleavage degradation model for HP is presented in Fig. 8.

View larger version (14K): [in this window] [in a new window]

FIG. 8. The proposed pathway of HP degradation determined by the pyd genes in Rhizobium sp. strain TAL1145.

Downstream of the pydA and pydB genes, there are three genes, pydC, pydD, and pydE, encoding proteins of an ABC transporter. Mutations in these genes make the Rhizobium strain unable to degrade HP, suggesting that these genes are required for HP transport. Mimosine is transported into the Rhizobium cells through an ABC transporter encoded by the midABC genes (5). When mimosine is used as a nutrient in the growth medium, the pydC and pydD mutants accumulate a small amount of HP in the medium. This indicates that after conversion of mimosine into HP inside the Rhizobium cells, a small amount of HP is released into the medium through diffusion. HP seems to be cycled back into the cells through the transporter encoded by pydC, pydD, and pydE. Like mimosine, HP also chelates iron. Therefore, HP cycling may allow Rhizobium to take up a second iron molecule during the degradation of a single mimosine molecule. Moreover, some amounts of mimosine may be naturally degraded to HP in the rhizosphere of Leucaena. The pyd transporter in Rhizobium may have evolved for transporting the available HP from the environment.

All five pyd genes identified in this study are required for HP degradation by TAL1145. However, the transconjugants of A. tumefaciens strain EHA105 containing only pydA and pydB can degrade HP, suggesting that this strain can transport HP through other transporters. Surprisingly, the transconjugant of R. etli TAL182 containing pydA alone can utilize HP, suggesting that this strain has other genes that substitute the functions of both the transporter and hydrolase required for HP utilization. On the other hand, the transconjugants of S. meliloti containing all five pyd genes or even the entire cluster of mid and pyd genes could not degrade HP or mimosine. It is possible that besides mid and pyd genes, other genes encoding a transcription factor or a cofactor may be involved in mimosine degradation, and these genes may be missing in S. meliloti. The cleavage product of HP by dioxygenase may be toxic to Rhizobium in the absence of a hydrolase required for complete breakdown of HP into pyruvate and formate. It is likely that the pydB mutant accumulated this toxic intermediate and therefore did not survive in the presence of HP.

Based on RT-PCR results, pydA and pydB appear to be transcribed as a single transcriptional unit, whereas pydC, pydD, and pydE are each transcribed as a separate transcriptional unit. Western analysis shows that both pydA and pydB are expressed at low levels. In the presence of HP, the expression of pydA is increased 113-fold, suggesting that pydA is induced by HP. Similarly, the expression of pydB is also induced by HP. Although mimosine seems to enhance the expression of pydA, our time course analysis shows that HP, but not mimosine, induces pydA. Degradation of mimosine produced HP, which induced pydAB. However, if mimosine persists in the media even in the presence of HP, mimosine appears to repress the transcription of pydA.

There are other mimosine-degrading soil bacteria in the rhizosphere of L. leucocephala. We have isolated several strains of a Klebsiella sp. that degrade mimosine. Synergistes jonesii is a gram-negative rumen bacterium from cattle that also degrades HP (1). However, genes for mimosine or HP degradation have not been isolated from these bacteria. Characterization of the pydAB genes from these bacteria will establish whether they contain similar HP dioxygenase and hydrolase enzymes. The root exudates of different plants may have many aromatic compounds that are utilized by rhizosphere bacteria. Mimosine is a good example of a specific aromatic compound secreted by Leucaena roots. The elucidation of mimosine or HP degradation pathways by Rhizobium will enhance our understanding of the role of a specific root-exuded compound in rhizosphere colonization and ecology.

 
We thank Judith Denery and Q. X. Li for help and use of the HPLC.

This research was supported through USDA-NRI grant 2002-35107-11659.

 
* Corresponding author. Mailing address: Department of Molecular Biosciences & Bioengineering, University of Hawaii at Manoa, 1955 East-West Road, Honolulu, HI 96822. Phone: (808) 956-6600. Fax: (808) 956-3542. E-mail: dulal{at}hawaii.edu.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Allison, M. J., W. R. Mayberry, C. S. Mcweeney, and D. A. Stahl. 1992. Synergistes jonesii, gen. nov., sp. nov.: a rumen bacterium that degrades toxic pyridine-diols. Syst. Appl. Microbiol. 15:522-529.
2
2. Beringer, J. E., J. L. Beynon, A. V. Buchanan-Wollaston, P. R. Hirsch, and A. W. B. Johnston. 1978. Introduction of drug resistance transposon Tn5 into Rhizobium. Nature 276:633-634.[CrossRef]
3
3. Borthakur, D., and X. Gao. 1996. A 150-Mda plasmid in Rhizobium etli strain TAL182 contains genes for nodulation competitiveness on Phaseolus vulgaris L. Can. J. Microbiol. 42:903-910.[Medline]
4
4. Borthakur, D., and M. Soedarjo. 1999. Isolation and characterization of a DNA fragment containing genes for mimosine degradation from Rhizobium sp. strain TAL1145, p. 91-96. In E. Martinez and G. Hernández (ed.), Highlights of nitrogen fixation research. Kluwer Academic/Plenum Publishers, New York, N.Y.
5
5. Borthakur, D., M. Soedarjo, P. M. Fox, and D. T. Webb. 2003. The mid genes of Rhizobium sp. strain TAL1145 are required for degradation of mimosine into 3-hydroxy-4-pyridone and inducible by mimosine. Microbiology 149:537-546.[Abstract/Free Full Text]
6
6. Brewbaker, J. L., and J. W. Hylin. 1965. Variations in mimosine content among Leucaena species and related mimosaceae. Crop Sci. 5:348-349.[Free Full Text]
7
7. Ditta, G., T. Schmidhauser, E. Yakobson, P. Lu, X.-W. Liang, D. R. Finlay, D. Guiney, and D. R. Helinski. 1985. Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid 13:149-153.[CrossRef][Medline]
8
8. Fox, P. M., and D. Borthakur. 2001. Selection of several classes of mimosine-degradation-defective Tn3Hogus-insertion mutants of Rhizobium sp. strain TAL1145 on the basis of mimosine-inducible GUS activity. Can. J. Microbiol. 47:488-494.[CrossRef][Medline]
9
9. George, M. L. C., J. W. P. Young, and D. Borthakur. 1994. Genetic characterization of Rhizobium sp. strain TAL1145 that nodulates tree legumes. Can. J. Microbiol. 40:208-215.[Medline]
10
10. Jindrova, E., M. Chocova, K. Demnerova, and V. Brenner. 2002. Bacterial aerobic degradation of benzene, toluene, ethylbenzene and xylene. Folia Microbiol. 47:83-93.
11
11. Katoh, S., J. Toyama, I. Kodama, K. Kamiya, T. Akita, and T. Abe. 1992. Protective action of iron-chelating agents (catechol, mimosine, diferoxamine, and kojic acid) against ischemia-reperfusion injury of isolated neonatal rabbit hearts. Eur. Surg. Res. 24:349-355.[Medline]
12
12. Lalande, M. 1990. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp. Cell Res. 186:332-339.[CrossRef][Medline]
13
13. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
14
14. Molenda, J. J., M. A. Basinger, T. P. Hanusa, and M. M. Jones. 1994. Synthesis and iron (III) binding properties of 3-hydroxypyrid-4-ones derived from kojic acid. J. Inorg. Biochem. 155:131-146.
15
15. Parveen, N., D. T. Webb, and D. Borthakur. 1996. Leucaena leucocephala nodules formed by a surface polysaccharide defective mutant of Rhizobium sp. strain TAL1145. Mol. Plant-Microbe Interact. 9:364-372.
16
16. Renz, J. 1936. Über das mimosin. Z. Physiol. Chem. 244:153-158.
17
17. Serrano, E. P., L. L. Ilag, and E. M. T. Mendoza. 1983. Biochemical mechanisms of mimosine toxicity to Sclerotium rolfsii Sacc. Aust. J. Biol. Sci. 36:445-454.
18
18. Soedarjo, M., and D. Borthakur. 1998. Mimosine, a toxin produced by the tree-legume Leucaena provides a nodulation competition advantage to mimosine-degrading Rhizobium strains. Soil Biol. Biochem. 30:1605-1613.[CrossRef]
19
19. Soedarjo, M., and D. Borthakur. 1996. Mimosine produced by the tree-legume Leucaena provides growth advantages to some Rhizobium strains that utilize it as a source of carbon and nitrogen. Plant Soil 186:87-92.[CrossRef]
20
20. Soedarjo, M., T. K. Hemscheidt, and D. Borthakur. 1994. Mimosine, a toxin present in leguminous trees (Leucaena spp.), induces a mimosine-degrading enzyme activity in some strains of Rhizobium. Appl. Environ. Microbiol. 60:4268-4272.[Abstract/Free Full Text]
21
21. Vincent, J. M. 1970. A manual for the practical study of root nodule bacteria. IBP handbook no. 15. Blackwell Scientific Publications, Oxford, United Kingdom.

---

Journal of Bacteriology, July 2005, p. 4480-4487, Vol. 187, No. 13
0021-9193/05/$08.00+0     doi:10.1128/JB.187.13.4480-4487.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Awaya, J. D. Articles by Borthakur, D. Search for Related Content PubMed PubMed Citation Articles by Awaya, J. D. Articles by Borthakur, D.