This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calderón-Flores, A.
Right arrow Articles by Durán, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calderón-Flores, A.
Right arrow Articles by Durán, S.

 Previous Article  |  Next Article 

Journal of Bacteriology, August 2005, p. 5075-5083, Vol. 187, No. 15
0021-9193/05/$08.00+0     doi:10.1128/JB.187.15.5075-5083.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The Stringent Response Is Required for Amino Acid and Nitrate Utilization, Nod Factor Regulation, Nodulation, and Nitrogen Fixation in Rhizobium etli{dagger}

Arturo Calderón-Flores,1 Gisela Du Pont,1 Alejandro Huerta-Saquero,1 Horacio Merchant-Larios,2 Luis Servín-González,1 and Socorro Durán1*

Departamento de Biología Molecular y Biotecnología,1 Departamento de Biología Celular y Fisiología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D. F. 04510, Mexico2

Received 2 February 2005/ Accepted 11 May 2005


arrow
ABSTRACT
 
A Rhizobium etli Tn5 insertion mutant, LM01, was selected for its inability to use glutamine as the sole carbon and nitrogen source. The Tn5 insertion in LM01 was localized to the rsh gene, which encodes a member of the RelA/SpoT family of proteins. The LM01 mutant was affected in the ability to use amino acids and nitrate as nitrogen sources and was unable to accumulate (p)ppGpp when grown under carbon and nitrogen starvation, as opposed to the wild-type strain, which accumulated (p)ppGpp under these conditions. The R. etli rsh gene was found to restore (p)ppGpp accumulation to a {Delta}relA {Delta}spoT mutant of Escherichia coli. The R. etli Rsh protein consists of 744 amino acids, and the Tn5 insertion in LM01 results in the synthesis of a truncated protein of 329 amino acids; complementation experiments indicate that this truncated protein is still capable of (p)ppGpp hydrolysis. A second rsh mutant of R. etli, strain AC1, was constructed by inserting an {Omega} element at the beginning of the rsh gene, resulting in a null allele. Both AC1 and LM01 were affected in Nod factor production, which was constitutive in both strains, and in nodulation; nodules produced by the rsh mutants in Phaseolus vulgaris were smaller than those produced by the wild-type strain and did not fix nitrogen. In addition, electron microscopy revealed that the mutant bacteroids lacked poly-ß-hydroxybutyrate granules. These results indicate a central role for the stringent response in symbiosis.


arrow
INTRODUCTION
 
Rhizobia are soil bacteria able to colonize the roots of compatible legumes under conditions of nitrogen limitation (31, 39, 46). This symbiotic interaction leads to the formation of organelle-like structures called nodules in the plant roots, in which these bacteria differentiate into N2-fixing forms known as bacteroids (31, 46). Bacteroids in the nodules are surrounded by the plant cell membrane, called the peribacteroidal membrane (31, 42). Bacteroids, the peribacteroidal space, and the peribacteroidal membrane are also referred to as symbiosomes (38). In the process of symbiosome formation, free-living rhizobia move from a variable environment to a more controlled one inside the plant cells by adapting in succession to three different environments: the rhizosphere, the infection thread (IT), and the plant cell cytoplasm (31, 39, 42). Bacteroid differentiation is accompanied by the loss of bacterial cell division and by a switch from a metabolism dedicated to ammonium assimilation to one dedicated to nitrogen fixation (33, 44).

The study of rhizobial metabolic networks that lead to productive nodules is clearly of importance for understanding the symbiotic process. Diverse studies have implicated amino acid metabolism in the bacterial adaptation to nodule conditions, as well as in the metabolic interchange between plant and bacteroids in fully developed nodules (7, 16, 20, 33, 34). The rhizobial metabolic adaptations required for using amino acids inside the IT and ammonium excretion in these circumstances could function as a signal to uncouple ammonium assimilation and nitrogen fixation, which is necessary for symbiosome formation in Rhizobium etli (33). During this process, the NtrC protein disappears (32), and expression of amtB, encoding the ammonium transporter, is down-regulated (43). It is also possible that early ammonium excretion by bacteroids into the IT plays a role in turning on the plant genetic program for nodule formation (33). It has been reported that the R. etli ntrC gene is not necessary for the utilization of amino acids or nitrate as nitrogen sources (30); how R. etli regulates amino acid utilization, the role of this regulation in general metabolism, and its interaction with nitrogen fixation are not known.

The stringent response is a global regulatory system that allows bacteria to adapt to amino acid and/or carbon starvation (5). The stringent response is mediated through the synthesis of guanosine pentaphosphate and guanosine tetraphosphate, collectively named (p)ppGpp (5). In Escherichia coli, amino acid starvation leads to an increase of uncharged tRNA molecules that activate the ribosome-dependent synthesis of (p)ppGpp by the RelA enzyme; in this circumstance, the SpoT protein is responsible for (p)ppGpp hydrolysis (5). SpoT is a bifunctional enzyme that is also capable of (p)ppGpp synthesis in response to carbon deficiency (12, 49). Three classes of bacterial RelA/SpoT orthologs have been described: (i) (p)ppGpp synthetase I or RelA, which synthesizes (p)ppGpp only after amino acid limitation; (ii) (p)ppGpp synthetase II, which synthesizes (p)ppGpp in response to carbon limitation; and (iii) (p)ppGpp synthetase III, which synthesizes (p)ppGpp after both carbon and amino acid limitation (28). Genes encoding proteins homologous to RelA and SpoT (collectively known as rsh genes) have also been found in plants, where they have been implicated in the regulation of chloroplast gene expression in response to plant defense signals (11).

In order to investigate the role of amino acid utilization in R. etli during its symbiosis with Phaseolus vulgaris, we searched for R. etli mutants specifically altered in the utilization of amino acids, either as nitrogen sources or as carbon and nitrogen sources. In this paper, we describe the isolation of a mutant altered in the utilization of amino acids as sole carbon and nitrogen sources. This mutant showed reduced nodulation ability and was impaired in nitrogen fixation. These effects were caused by a mutation in the R. etli rsh gene, which encodes a homolog of RelA and SpoT proteins, involved in the stringent response in other organisms.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and media. Bacterial strains and plasmids used in this study are listed in Table 1. R. etli was grown at 30°C in peptone-yeast (PY) complex medium (5 g/liter peptone, 3 g/liter yeast extract, and 7.0 mM CaCl2) or in minimal medium (MM) (1.2 mM K2HPO4, 0.4 mM MgSO4 · 7H2O, 1.5 mM CaCl2, 0.0005% FeCl3 · 6H2O [pH 6.8]). MOPS-MM contains the same salts as MM, except KH2PO4 was used at 0.4 mM (0.2 mM for labeling experiments); MOPS-MM also contains 0.4 M MOPS (morpholinepropanesulfonic acid), 0.04 M Tricine, 1 mg/ml biotin, and a solution of microelements (4). Succinate, glucose, mannitol, and sucrose were used at 10 mM as carbon sources, whereas glycerol was used at 2%. Ammonium chloride, potassium nitrate, or amino acids were used as nitrogen sources, all at 10 mM. When used as the sole carbon and nitrogen source, amino acids were added at 10 mM. E. coli strains were grown at 37°C in Luria-Bertani complex medium. For determination of the utilization of nitrogen sources, colonies were replica plated onto M9 minimal medium plates and incubated at 30°C. Glucose (0.2%) was used as the carbon source and ammonium, aspartate, or glutamine as nitrogen sources, all at a 10 mM final concentration.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Bacterial strains and plasmids used in this study

Antibiotics for R. etli cultures were used at the following final concentrations (in µg/ml): tetracycline (Tc), 10; nalidixic acid (Nal), 20; streptomycin (Sm), 200; kanamycin (Km), 30; spectinomycin (Sp), 200; chloramphenicol (Cm), 15; and gentamicin (Gm), 15. Antibiotics for E. coli cultures were used at the following concentrations (in µg/ml): Km, 30; Tc, 10; Cm, 20; Sp, 200; carbenicillin (Cb), 150; and Gm, 25.

Growth rate determination. For kinetic studies, R. etli cultures were grown overnight at 30°C in 250-ml Erlenmeyer shake flasks containing 100 ml of PY medium. Cells were collected by centrifugation at 6,000 x g at 4°C, washed with sterile MM salts, and used to inoculate 250-ml Erlenmeyer flasks containing 100 ml of MM to an optical density at 540 nm (OD540) of 0.05. Cultures were incubated at 30°C with shaking at 200 rpm. Samples were taken at 0, 4, 8, 12, and 24 h, and the protein content of the cultures was determined by the Lowry et al. method (21).

Tn5 general mutagenesis of R. etli and selection of mutant strain LM01. The pSUP5011 suicide plasmid (41), which carries the Tn5-mob transposon, was introduced by conjugation into the R. etli wild-type strain CE3. Kanamycin-resistant cells were pooled and resuspended in MM containing glutamine as the sole carbon and nitrogen source and 200 µg/ml ampicillin as previously described (6). Surviving cells were washed and plated in PY medium, and isolated colonies were replicated onto MM-succinate-ammonium and MM-glutamine plates to identify those unable to use glutamine as the carbon and nitrogen source.

Rapid plate assay for the E. coli relaxed phenotype. Stringent or relaxed E. coli phenotypes were determined by a rapid method; cells were streaked on SMG plates (45), which contain serine, methionine, and glycine (each at 100 µg/ml), and incubated at 37°C until wild-type strain colonies were formed and then at 30°C for a viability test (45).

Cloning of the LM01 Tn5 insertion. Total DNA from the LM01 mutant was digested with EcoRI and ligated to EcoRI-cut pUC18. E. coli cells were transformed with the ligation and plated on Luria-Bertani plates with Cb and Km to select colonies in which the chromosomal EcoRI fragment with the Tn5 insertion had been cloned.

Plasmid and cosmid conjugation. Plasmids were introduced by transformation into the helper E. coli strain S17-1, as reported previously (15), which was then conjugated with R. etli. Crosses were incubated at 30°C overnight in PY medium plates; cells were harvested, washed, plated onto PY plates with the appropriate antibiotics, and incubated at 30°C. Cosmids from an R. etli genomic library maintained in E. coli HB101 were introduced by conjugation into the LM01 mutant by triparental crosses (6). After overnight incubation, cells were plated in selective media and incubated at 30°C until colonies appeared.

Construction of the rsh::{Omega} AC1 strain. pAC7 was obtained by cloning the 2,234-bp EcoRI fragment of pMGD2234 (containing the 5' region of the R. etli rsh gene) into the EcoRI site of pUC18; the {Omega} element (36) was obtained from pMW157 by SmaI digestion and cloned into the unique EcoRV site of pAC7, located at codon 91 of the R. etli rsh gene, to form pAC39. The pAC39 insert was then cloned into the suicide vector pJQ200 that had been partially digested with EcoRI. Plasmids that carried the pAC39 insert in the polylinker EcoRI site were distinguished from those where the insert had been cloned in the EcoRI site located inside sacB by their sucrose-sensitive phenotype. The plasmid thus obtained, pAC40, was introduced by conjugation into the wild-type R. etli strain CE3. Double recombinants were selected in PY medium with 5% sucrose, Nal, and Sp and checked for Gm sensitivity. One such strain was selected (AC1), and the insertion was confirmed by Southern blotting.

DNA experiments. DNA and cloning experiments were carried out by standard procedures (23). Restriction enzymes, Taq DNA polymerase, and T4 DNA ligase were purchased from Amersham. DNA sequences were obtained in an ABI PRISM model 310, version 3.0 automated DNA sequencer.

Cloning the R. etli rsh structural gene in the expression vector pMMB206. PCR was used to amplify the rsh gene from R. etli CE3 DNA, using the oligonucleotides Relbam5 (GCAGGATCCATGATGCGGCAGTACGCG) and Relhind3 (ATCAAGCTTCTACTCATAGAGTCGTCG), which introduce BamHI and HindIII sites (underlined), respectively. The PCR product was digested with BamHI and HindIII and cloned into the polylinker of pMMB206; this plasmid was named pAC50 (Table 1).

Plant experiments. Phaseolus vulgaris cv. Negro Jamapa seeds were surface sterilized with a 5% sodium hypochlorite solution and germinated; groups of six seedlings were grown in pots with sterile vermiculite as support and inoculated as described previously (6). Nodules were collected 28 days after inoculation and dried in an oven for 48 h at 80°C. Some nodules were treated with sodium hypochlorite and crushed onto PY plates with appropriate antibiotics; isolated colonies were replicated onto MM plates to determine their phenotype. Nitrogenase activity was measured by acetylene reduction as reported previously (6). For dry weight measurements, plants were collected 50 days after inoculation and dried in an oven, without roots, for 48 h at 80°C.

Determination of nod promoter activity. Plasmid pRP30, which carries a nodA-lacZ fusion, was used (47). Cultures were grown in MM with 10 mM succinate as the carbon source and 5 mM ammonium as the nitrogen source; 1.2 µM naringenin was added at the time of inoculation. ß-Galactosidase activity was determined as Miller units after 12 h (27).

Nod factor determination. Nod factors were determined in supernatants of cultures labeled with [1-14C]glucosamine (Amersham) by thin-layer chromatography (TLC) in silica gel plates (18). Naringenin was used as a nod gene inductor at 1.2 µM.

(p)ppGpp determination in E. coli cells. For (p)ppGpp determination in E. coli cells, cultures were uniformly labeled with [32P]H3PO4 (4); 100-µl cultures were grown in microtiter plates (catalog no. 001-010-2201; Dynatech Laboratories, Inc.). Cultures for determination of ribosome-dependent (p)ppGpp synthesis were grown overnight in MOPS-MM with 40 µg/ml of each amino acid and 0.2% glucose, collected by centrifugation, and used to inoculate 100 µl of the same medium (OD600 of 0.05) without serine and with 0.5 g/ml serine hydroxamate and 300 µg/ml valine. When the OD600 reached approximately 0.25, [32P]H3PO4 (no. 64014L; ICN Biomedical) was added to 100 µCi/ml (4). To elicit the stringent response by carbon source starvation, cells were grown overnight in MOPS-MM with 0.02% glucose, collected by centrifugation, and inoculated in fresh medium (OD600 of 0.15). [32P]H3PO4 was added at the time of inoculation (100 µCi/ml), and incubation was continued in a microtiter plate at 30°C and 200 rpm (4). At appropriate intervals, 10 µl of each culture was transferred to a microtiter plate containing 10 µl of dry ice-chilled 14 N formic acid. When all samples were ready, they were thawed and refrozen twice or left on ice for at least 15 min; 5 µl of each sample was spotted in cellulose-polyethyleneimine TLC plates (Sigma-Aldrich) and developed in 1.5 M KH2PO4, pH 3.4. TLC plates were air dried and exposed to X-ray films.

(p)ppGpp determination in R. etli cells. For amino acid starvation experiments, R. etli cultures were growth in MOPS-MM plus 40 µg/ml of each amino acid; after 14 h of growth, cells were inoculated (OD600 of 0.2) in microtiter plates with the same medium without serine and with 0.5 mg/ml serine hydroxamate. In different sets of experiments, amino acids were omitted or reduced to 10, 5, or 1 µg/ml. Four hours after inoculation, [32P]H3PO4 was added to 100 µCi/ml, and samples were then taken at 15-min intervals for 4 h and handled as described above.

For carbon starvation experiments, amino acids were omitted from the MOPS-MM, since most of them can be used as a carbon source by R. etli. Cells were grown in MOPS-MM or MOPS-MM with a reduced glucose concentration (0.02% instead of 0.2%), collected by centrifugation, washed twice, and used to inoculate MOPS-MM with 0.02% glucose (OD600 of 0.2). [32P]H3PO4 (100 µCi/ml) was added immediately after inoculation, and samples were taken at intervals and handled as described above.

For carbon and nitrogen starvation procedures, amino acids were also omitted. Two sets of experiments were made: in one set, cells were grown in MOPS-MM; in the other set, cells were grown in MOPS-MM with reduced glucose and ammonium concentrations (0.02% and 1 mM, respectively). After 14 h of growth, cells were washed twice with distilled water and used to inoculate (OD600 of 0.2) MOPS-MM with 0.02% glucose and 1 mM ammonium. [32P]H3PO4 (100 µCi/ml) was added immediately after inoculation. Samples were taken at intervals for up to 6 h and handled as described above.

Electron microscopy. Nodules were collected by hand 28 days after plant inoculation, immediately split in half with a scalpel, fixed in Karnovsky's aldehyde solution (17) without Ca2+ (pH 7.4), postfixed with 1% OsO4 in Zetterqvist's buffer (51), and embedded in Epon 812. Thin (60- to 90-nm) sections were stained with uranyl acetate and lead citrate.

Nucleotide sequence accession number. The nucleotide sequence of the rsh gene has been deposited in the GenBank database under accession number AY675074.


arrow
RESULTS
 
Isolation of mutant strain LM01 and cloning of the complementing region. A Tn5 insertion library was obtained in the R. etli CE3 wild-type strain and enriched for mutants unable to use glutamine as the sole carbon and nitrogen source, as described in Materials and Methods. Isolated colonies were then tested in MM plates with single amino acids as the nitrogen source. One strain, named LM01, was altered in the ability to use amino acids as the nitrogen source. Kinetic growth experiments in shake flasks indicated a pleiotropic phenotype: the R. etli LM01 mutant did not grow in MM with glutamate, proline, histidine, alanine, aspartate, leucine, or nitrate as the nitrogen source. This phenotype was independent of the carbon source used, and similar results were obtained with succinate, glucose, sucrose, mannitol, or glycerol as the carbon source. The only exception was observed when aspartate was used as the nitrogen source; in this case, growth dependence of LM01 on the carbon source was observed; with succinate, the mutant did not grow, but with glycerol it grew as well as the wild-type CE3 strain; an intermediate growth phenotype was observed when glucose or mannitol were used as carbon sources.

Addition of the 20 amino acids in low concentration (15 µg/ml of each) to MM succinate-nitrate medium improved growth of LM01 only slightly, indicating that the growth defect of LM01 is not due to an amino acid auxotrophy. In addition, LM01 was unable to use either proline or glutamate as the sole carbon and nitrogen source; with other amino acids, only reduced growth was observed. In PY liquid medium, LM01 showed a growth rate similar to that of the wild-type strain (2.97 ± 0.094/h for LM01 versus 3.09 ± 0.051/h for CE3); interestingly, LM01 mutant colonies on PY plates were smaller than wild-type colonies.

An R. etli genomic bank (6) was used to complement the LM01 mutant. Cosmids were crossed from E. coli HB101 to the LM01 mutant, and transconjugants that grew in MM with glutamine as the sole carbon and nitrogen source were selected. Four overlapping cosmids complemented the growth defects in MM-glutamine and the pleiotropic phenotype of LM01. The smallest complementing cosmid, pMGD4, had a 20-kb insert and was selected for further studies. Subcloning experiments further localized the complementing region to 4.4 kb contained in two contiguous EcoRI fragments, cloned together in pMGD44 (Table 1). Full complementation was obtained with pMGD44 but not when the two EcoRI fragments were cloned separately in pMGD2234 and pMGD2203, meaning that the complementing region spans the EcoRI site between both fragments. This was further shown by constructing pMGD44-{Omega}-14, in which an {Omega} element (36) was inserted in the central EcoRI site of pMGD44; this modified cosmid was unable to complement the defects of LM01, confirming that both EcoRI fragments of pMGD44 are indeed required for LM01 mutant complementation. Furthermore, the EcoRI fragment that carries the Tn5 insertion in LM01 hybridized with the insert from pMGD2234.

The Tn5 insertion in LM01 is located in the R. etli rsh gene encoding a member of the RelA/SpoT protein family. To determine precisely the site of the Tn5 insertion in the mutant, the EcoRI fragment that carries the kanamycin resistance gene in LM01 was cloned in pUC18 to give plasmid pAC3, and the DNA sequence on both sides of the transposon was obtained. In addition, the pMGD44 insert was completely sequenced; this sequence revealed an open reading frame (ORF) that spans the central EcoRI site of the pMGD44 insert. The deduced protein sequence from this ORF was used to carry out a BLAST search at the NCBI site (http://www.ncbi.nlm.nih.gov); this search clearly showed that this ORF corresponds to a gene whose product is highly similar to members of the RelA/SpoT family of proteins that regulate the stringent response in bacteria. We therefore refer to this gene as rsh. The sequence of the LM01 fragment showed that the Tn5 insertion is indeed located inside the rsh gene, right after codon 323, and adds six more codons in phase before reaching a UGA stop codon; it is therefore highly possible that a truncated Rsh protein of 329 amino acids is synthesized in the mutant (see below).

The R. etli rsh gene encodes a protein of 744 amino acids that is 54% identical to E. coli SpoT (accession number P17580) and 27% identical to E. coli RelA (accession number AAA03237). The deduced R. etli Rsh protein sequence also displays high similarity to Rsh protein sequences from alpha-proteobacteria, particularly to those of rhizobial species, consistent with the fact that Rsh proteins from alpha-proteobacteria form a separate branch in the RelA/SpoT phylogenetic tree (24, 28). The R. etli Rsh sequence showed the following identities to Rsh proteins of alpha-proteobacteria: 85% to Agrobacterium tumefaciens Rsh (accession number AAR99902); 83% to Sinorhizobium meliloti Rsh (accession number AAG34109); 69% to Mesorhizobium loti Rsh (accession number NP_108006); 69% to Brucella suis Rsh (accession number NP_697666); 68% to Brucella melitensis Rsh (accession number NP_540213); 59% to Bradyrhizobium japonicum Rsh (accession number AAF04327); and 47% to Rhodobacter sphaeroides Rsh (accession number ZP_00005651).

As the sequences of the well-studied E. coli RelA and SpoT proteins are related (26), it is difficult to assign (p)ppGpp hydrolase or (p)ppGpp synthetase activities based solely on sequence comparisons. However, a domain called the HD domain is conserved in a superfamily of metal-dependent phosphohydrolases; histidine (H) and aspartate (D) residues in motif II of the HD domain are thought to be involved in (p)ppGpp degradation, because Rsh and SpoT but not RelA proteins conserve them (1). R. etli Rsh was compared to the Entrez Conserved Domain Database (22) and shown to have a region that can be aligned to the HD domain (pfam01966) of metal-dependent phosphohydrolases. Partial alignment of R. etli Rsh around the conserved motifs I, II, and V of the HD domain shows that the H and D amino acid residues are conserved in this protein; Fig. 1 also shows that the HD domain is highly conserved in Rsh orthologs of rhizobia (1, 22). Partial alignment of the E. coli RelA and SpoT sequences to the HD domain indicates the presence of H and D residues in SpoT but not in RelA (Fig. 1). The presence of only one rsh gene in the genomes of S. meliloti, B. japonicum, M. loti, and Agrobacterium tumefaciens, and the high similarity of R. etli Rsh to the proteins encoded by these genes, suggests that they all perform both (p)ppGpp synthesis and hydrolysis.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 1. The Rsh proteins of the Rhizobiaceae are highly conserved. Shown is an alignment of partial Rsh sequences against motifs I, II, and V of the HD domain of metal-dependent phosphohydrolases. Sequences correspond to Rsh sequences of Rhizobium etli (R.etl), Agrobacterium tumefaciens (A.tum), Sinorhizobium meliloti (S.mel), Mesorhizobium loti (M.lot), Brucella melitensis (B.mel), Brucella suis (B.sui), and Bradyrhizobium japonicum (B.jap) and to E. coli SpoT and RelA. The conserved H and D residues of the second motif are shown in boldface. Asterisks under the alignment indicate conserved amino acids.

Another complete ORF is found upstream of rsh in the pMGD44 sequence; this ORF encodes a 91-amino-acid protein similar to the omega subunit of bacterial RNA polymerase. The omega subunit is a small protein that copurifies with RNA polymerase holoenzyme and has been identified as a dispensable subunit, even though E. coli rpoZ mutants lacking the omega subunit display a phenotype of reduced duplication time (9). Since the Tn5 insertion in LM01 is located downstream of the R. etli rpoZ gene, it is unlikely that the omega subunit is involved in the mutant phenotype, as evidenced by lack of complementation with pMGD2234, which carries the rpoZ gene from R. etli (see below).

Functionality of the R. etli rsh gene in E. coli. In an initial attempt to determine a physiological role for the R. etli rsh gene product, (p)ppGpp accumulation was measured directly in E. coli cultures uniformly labeled with 32P. As seen in Fig. 2A, the R. etli rsh gene did not complement a relA deletion in E. coli, since CF1652/pMGD44 does not accumulate (p)ppGpp during amino acid starvation. As expected from this result, the R. etli rsh gene did not complement the lack of growth at 37°C of E. coli CF1652 ({Delta}relA) in SMG medium (45). On the other hand, it can be seen (Fig. 2B) that the R. etli rsh gene restored (p)ppGpp accumulation during carbon source starvation to a {Delta}relA {Delta}spoT double mutant (CF1693/pMGD44), indicating that the R. etli rsh gene is expressed and produces a functional protein capable of (p)ppGpp synthesis in E. coli.



View larger version (58K):
[in this window]
[in a new window]
  		FIG. 2. The rsh gene of R. etli produces a functional protein in E. coli cells. One-dimensional TLC analysis of total intracellular nucleotides extracted from E. coli cultures uniformly labeled with [32P]H3PO4. (A) Cells were starved for amino acids in MOPS-MM plus 500 µg/ml serine hydroxamate and 300 µg/ml valine. Lane 1, CF1648 (wild type); lane 2, CF1652 {Delta}relA; lane 3, CF1693 {Delta}relA {Delta}spoT; lane 4, CF1652/pMGD44; lane 5, CF1693/pMGD44. (B) E. coli cells were carbon starved in MOPS medium with 0.02% glucose. Lane 1, CF1648; lane 2, CF1652; lane 3, CF1693; lane 4, CF1693/pMGD44.

(p)ppGpp determination in R. etli uniformly labeled cultures. Classical stringent response is experimentally elicited either by serine hydroxamate addition or by carbon source starvation. Previous reports, however, indicate that not all Rhizobium strains that have been tested accumulate (p)ppGpp after serine hydroxamate addition or carbon source exhaustion tests (2, 14). Experiments were designed to find nutritional conditions capable of inducing (p)ppGpp accumulation in 32P uniformly labeled cultures of the R. etli wild-type strain.

In order to probe whether 0.02% glucose or 1 mM ammonium were limiting concentrations for growth, the R. etli CE3 wild-type strain was grown in shake flasks with MM plus 0.02% glucose and ammonium at 1, 3, 5, or 10 mM. The optical density and the protein content in all of these culture conditions were reduced with respect to the 0.2% glucose control, and values were similar in all of the conditions tested, with no observable growth after 12 h. When ammonium concentration was fixed at 1 mM and glucose was added at 0.02, 0.5, 0.1, or 0.2%, growth was reduced with respect to the 10 mM ammonium control, and similar optical density and protein content values were obtained for all of the conditions tested.

Addition of serine hydroxamate to R. etli 32P-labeled cultures grown in MOPS-MM did not induce (p)ppGpp accumulation in any of the amino acid concentrations tested; neither did carbon limitation in 0.02% glucose. When CE3 cells were grown for 14 h in MOPS-MM with 0.2% glucose and 10 mM ammonium and then transferred to MOPS-MM with 0.02% glucose and 1 mM ammonium, (p)ppGpp was not accumulated, but when cells where grown under both carbon and nitrogen limitation for 14 h and then transferred to carbon- and nitrogen-limited MOPS-MM, (p)ppGpp could be detected. Figure 3 shows that CE3 and LM01/pMGD44 did accumulate (p)ppGpp in response to prolonged limitation of both carbon and nitrogen sources, but LM01 did not.



View larger version (84K):
[in this window]
[in a new window]
  		FIG. 3. R. etli rsh mutants are affected in (p)ppGpp synthesis during carbon and nitrogen starvation. Shown is a one-dimensional TLC analysis of total intracellular nucleotides extracted from R. etli cultures uniformly labeled with [32P]H3PO4. Cells were grown in MOPS-MM with 1 mM ammonium and 0.02% glucose. Lane 1, CE3 (wild type); lane 2, LM01 (rsh::Tn5); lane 3, AC1 (rsh::{Omega}); lane 4, LM01/pMGD44; lane 5, AC1/pMGD44.

Symbiotic phenotype of the R. etli rsh mutant. Seedlings of P. vulgaris cv. Negro Jamapa were inoculated with the LM01 mutant. As shown in Table 2, the dry weight of LM01 nodules was reduced to about 40% of the value obtained with the CE3 wild-type strain. Nodules of LM01-inoculated plants were small and pale white; the number of nodules was not uniform in all plants, and most of them presented an increased number of pseudonodules. The leaves of LM01-inoculated plants showed signs of chlorosis. Acetylene reduction in LM01 nodules could not be detected. Bacteria could be recovered from pseudonodules induced by the mutant, and they were shown to maintain Km resistance and to be impaired in the utilization of single amino acids as nitrogen source; this indicates that the altered phenotype of these nodules is indeed due to inoculation of the mutant. The shoot dry weight at 50 days postinoculation in LM01-inoculated plants was similar to that of noninoculated plants, showing that the mutant is devoid of nitrogen fixation activity (Table 2). The LM01/pMGD44 strain showed nodulation and nitrogen fixation levels as high as those of the wild-type strain (Table 2). These results indicate that the rsh gene is involved in both the free-living and symbiotic states of R. etli.


View this table:
[in this window]
[in a new window]
  		TABLE 2. The R. etli rsh mutants are defective in symbiosis

Nodules were harvested 28 days after inoculation and prepared for electron microscopy as described in Materials and Methods. As shown in Fig. 4B and D, LM01 nodules showed more bacteroids per plant cell. Mutant bacteroids appeared pleomorphic, as opposed to those of the CE3 wild-type strain (Fig. 4A and C); fewer plant cells were invaded in nodules from LM01-inoculated plants than in CE3-inoculated plants. In addition, LM01 bacteroids did not possess poly-ß-hydroxybutyrate granules (Fig. 4B). The LM01/pMGD44 bacteroids showed a wild-type morphology, demonstrating that the deep disruption of symbiosis observed with the LM01 mutant could be complemented with the R. etli rsh gene.



View larger version (205K):
[in this window]
[in a new window]
  		FIG. 4. R. etli rsh mutants are affected in nodulation. Ultrastructural differentiation of bacteroids elicited by wild-type CE3 (A and C) and mutant LM01 (B and D) strains. Bars: A and B, 500 nm; C and D, 2 µm. Note that LM01 mutant bacteroids are pleomorphic and devoid of poly-ß-hydroxybutyrate (PHB) granules (indicated by an arrow).

Nod factor production by the LM01 mutant. In rhizobia symbiosis, Nod factors are responsible for initiating the plant-microbe interaction, and their synthesis is regulated at different levels (39). The stringent response mutant of S. meliloti produces Nod factors like the wild type but overproduces succinoglycan, which is needed for correct nodulation (48). In order to test if the reduced nodulation ability of the R. etli LM01 mutant is due to deregulation of Nod factor production, nodA gene expression was monitored using plasmid pRP30, which harbors an R. etli nodA-lacZ fusion (47). Figure 5 shows that nodA expression in the LM01 mutant was constitutive, as opposed to the wild type, where it was expressed only after induction by naringenin. Conjugation of pMGD44 to LM01/pRP30 restored naringenin inducibility of nodA gene expression (Fig. 5). To determine whether nodA expression was correlated with Nod factor production, Nod factors were identified by thin-layer chromatography in supernatants of induced and noninduced cultures incubated with [1-14C]glucosamine (18). As observed in Fig. 6, Nod factor production correlated with ß-galactosidase activity, indicating that the rsh mutation in LM01 renders R. etli constitutive for Nod factor production.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 5. Transcription of nodA gene is constitutive in R. etli rsh mutants. A nodA-lacZ transcriptional fusion, carried by plasmid pRP30 (47), was used to examine the effect of rsh mutations on nodA gene expression. Cultures were grown for 12 h in MM with 5 mM ammonium. Naringenin was used as inducer at 1.2 µM; values are expressed as Miller units ± standard deviation. (1) CE3 (wild type); (2) LM01 (rsh::Tn5); (3) LM01/pMGD44; (4) AC1 (rsh::{Omega}).



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 6. Nod factor production is constitutive in the R. etli LM01 mutant. One-dimensional TLC was performed to determine the presence of Nod factors (which migrate at the position shown by two arrows) in supernatants of R. etli cultures grown in MM with 5 mM ammonium plus [1-14C]glucosamine. (1) CE3 (wild type); (2) LM01 (rsh::Tn5); (3) LM01/pMGD44. –, without inducer; +, with 1.2 µM naringenin.

Construction of a second R. etli rsh mutant and its complementation by a truncated Rsh protein. As described previously, the Tn5 insertion in LM01 would allow the synthesis of a truncated Rsh protein of 329 amino acids. To test whether this truncated protein retains some activity, the chromosomal EcoRI fragment from LM01 that carries the Tn5 insertion was cloned in pUC18, resulting in plasmid pAC3 (Table 1); pAC3 and pMGD44-{Omega}-14 (which would allow the synthesis of truncated proteins of 329 and 384 amino acids, respectively) were introduced by transformation into the {Delta}relA {Delta}spoT E. coli strain CF1693 which is unable to synthesize (p)ppGpp (49) (Table 1). pMGD44-{Omega}-14 showed partial complementation of the E. coli CF1693 strain, while pAC3 did not.

In order to construct a new rsh mutant of R. etli devoid of any activity, the {Omega} element was introduced in the unique EcoRV site of the R. etli rsh gene; this insertion would allow the synthesis of a 98-amino-acid truncated protein. This mutant strain, called AC1, had the same phenotype as LM01 regarding utilization of amino acids, (p)ppGpp accumulation, nodA gene activity, and symbiotic phenotypes (Table 2; Fig. 3 and 5). However, when pMGD44-{Omega}-14, encoding the truncated Rsh protein of 384 amino acids, was introduced into the AC1 mutant, utilization of amino acids as nitrogen and carbon-nitrogen sources was restored. This result was unexpected, as the same plasmid failed to complement LM01.

The R. etli rsh gene was cloned in the expression vector pMMB206 (29), resulting in plasmid pAC50; this plasmid fully complements both LM01 and AC1 for amino acid utilization, showing that only the Rsh protein is implicated in this phenotype. Unexpectedly, when AC1/pAC50 was used to inoculate P. vulgaris plants, an intermediate phenotype in nodule color and size was observed (Table 2). Bacteria recovered from plants inoculated with AC1/pAC50 proved to be a mixed population of cells carrying the plasmid and cells that had lost it. Approximately 90% of 400 colonies recovered from several pseudonodules had lost the plasmid. The nitrogen source utilization and antibiotic resistance phenotypes in these colonies were correlated.


arrow
DISCUSSION
 
The regulation of amino acid utilization has not been extensively studied in rhizobia, even though amino acid metabolism is apparently implicated in symbiosome development. Here we report the initial characterization of stringent response mutants of R. etli. Our results show that mutations in a single gene, rsh, that encodes a member of the RelA/SpoT family of proteins deeply affect its ability to use amino acids as nitrogen sources or as sole carbon and nitrogen sources and eliminates (p)ppGpp accumulation. In E. coli, a similar phenotype was obtained in CF1693, a {Delta}relA {Delta}spoT double mutant impaired in the use of aspartate and glutamine; this phenotype is related to the (p)ppGpp null condition, since E. coli CF1652 ({Delta}relA) was still able to use these amino acids as nitrogen sources (49). These results suggests that the rsh gene encodes the only protein capable of (p)ppGpp synthesis and hydrolysis in R. etli, as has been observed for other members of the alpha-proteobacteria, including S. meliloti (48). The two R. etli rsh mutants characterized in this work, LM01 and AC1, display a pleiotropic phenotype; like E. coli CF1693, they are affected in amino acid and nitrate utilization; however, they are not auxotrophs, unlike E. coli strains that are (p)ppGpp null (49). Also, R. etli failed to accumulate (p)ppGpp after amino acid starvation elicited by addition of serine hydroxamate, and the same was true when the rsh gene was expressed in a {Delta}relA mutant of E. coli. While it is possible that the C-terminal domain of R. etli Rsh cannot interact with E. coli ribosomes, as reported for the Rsh protein of Streptococcus dysgalactiae subsp. equisimilis (24), it is also possible that the R. etli Rsh protein is devoid of RelA activity. In E. coli, a link between glutamine utilization, the Ntr system, and (p)ppGpp has been reported (35), and it is possible that the phenotype of R. etli rsh mutants can be partially explained by interactions between nitrogen utilization regulons and (p)ppGpp levels.

Our experiments show that a truncated protein consisting of the first 384 amino acids of the R. etli Rsh protein (Rsh384) was sufficient for complementing the growth phenotype of the AC1 mutant; therefore, this truncated protein must be capable of (p)ppGpp synthesis, consistent with structural studies on the S. dysgalactiae Rsh protein (13). Unexpectedly, the LM01 mutant (which produces a shorter Rsh of 329 amino acids, Rsh329) could not be complemented by Rsh384. This result suggests that Rsh329 retains some function responsible for the observed negative complementation. It has been suggested that bifunctional RelA/SpoT homologs exist in two conformations that result in reciprocal activity states, one geared for synthesis and one for hydrolysis of (p)ppGpp; specific mutations can selectively eliminate the ability of these proteins to switch conformations, resulting in mutant proteins with only one of the activities (13). Since the hydrolase domain is located at the extreme N terminus of Rsh proteins (10, 13), it is likely that the truncated Rsh329 is capable of (p)ppGpp hydrolysis and unable to change to a conformation where this activity is absent or reduced. This might impede (p)ppGpp accumulation, resulting in the observed negative complementation. LM01 could be complemented by the full-length rsh gene, suggesting that the (p)ppGpp-synthesizing activity of Rsh384 is not as efficient as that of the wild type, underscoring the importance of the C-terminal regulatory domain (13, 24).

Rhizobia are free-living bacteria that are also capable of forming a symbiotic interaction; therefore, they have developed a complex adaptation program for symbiosome formation in which metabolic and genetic regulation interact. The R. etli rsh mutants reported here were affected in symbiosis, as the number of nodules was reduced and nodules produced by these mutants were not effective in nitrogen fixation. This suggests a central role for (p)ppGpp and the stringent response in the metabolic adaptation of R. etli to nodule conditions. Amino acid utilization, deeply affected in the mutants described in this work, appears to play an important role in this adaptation. This is consistent with the finding that nodules produced by mutants of Rhizobium leguminosarum bv. viciae unable to transport amino acids are affected in symbiosis (20). It has been reported that the NtrC protein is down-regulated during bacteroid formation in R. etli (32) and that nod gene expression is a function of the nitrogen status of the cell (25). The fact that Nod factors are expressed constitutively in these mutants, and that they are unable to use amino acids, suggests some important role of the stringent response and (p)ppGpp in controlling the nitrogen status of the cells. This could be major determinant in the inability of R. etli rsh mutants to establish and maintain a productive symbiosis. If utilization of limiting amino acids is necessary for establishing symbiosis, or if ammonium excretion due to amino acid catabolism is a signal for nodule development (33), it is clear that the inability to respond to these nitrogen conditions would affect proper differentiation of cells into bacteroids. It could also be that some other aspect of the stringent response is responsible for establishing and maintaining communication with plant signals in order to establish a productive symbiosis.

In this work, we showed that (p)ppGpp participates in metabolic adaptation in R. etli and in the coordination of interactions between metabolism and genetic regulation leading to symbiosis. This underscores the importance of the stringent response in the development of this bacterial species and highlights the need to study the regulation of central metabolism and its interactions in rhizobia. Further studies are needed to know the details of this adaptive regulation during symbiosis.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grant IN219001 from the Dirección General de Asuntos del Personal Académico of the Universidad Nacional Autónoma de México (UNAM). A.C.-F. was supported by Programa de Becas Nacionales para Estudios de Posgrado and PAEP, also from UNAM.

We thank Michael Cashel of the National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Md., for providing us E. coli strains CF1548, CF1652, and CF1693 and Carmen Quinto of IBT for providing us pRP30 plasmid. We also thank Luz María Martínez for technical work, Adriana Corvera for her advice in Nod factor determination, and David Romero and Jorge Membrillo for critically reviewing the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Apdo. Postal 70228, México D.F. C.P. 04510, México. Phone: 52 (55) 56-22-38-80. Fax: 52 (55) 56-22-38-55. E-mail: sduranv{at}servidor.unam.mx. Back

{dagger} This work is dedicated to the memory of Jorge Calderón. Back


arrow
REFERENCES
 
    1
  1. Aravind, L., and E. V. Koonin. 1998. The HD domain defines a new superfamily of metal-dependent phosphohydrolases. Trends Biochem. Sci. 23:469-472.[CrossRef][Medline]
    2. 2
  2. Belitsky, B., and C. Kari. 1982. Absence of accumulation of ppGpp and RNA during amino acid starvation in Rhizobium meliloti. J. Biol. Chem. 257:4677-4679.[Abstract/Free Full Text]
    3. 3
  3. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of the DNA in Escherichia coli. J. Mol. Biol. 41:459-472.[CrossRef][Medline]
    4. 4
  4. Cashel, M. 1994. Detection of (p)ppGpp accumulation patterns in Escherichia coli mutants. Methods Mol. Genet. 3:341-356.
    5. 5
  5. Cashel, M., D. R. Gentry, V. J. Hernandez, and D. Vinella. 1996. The stringent response, p. 1458-1495. In F. C. Neidhart, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, K. W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. I. ASM Press, Washington, D.C.
    6. 6
  6. Durán, S., L. Sánchez-Linares, A. Huerta-Saquero, G. Du Pont, A. Huerta-Zepeda, and J. Calderón. 1996. Identification of two glutaminases in Rhizobium etli. Biochem. Genet. 34:453-465.[CrossRef][Medline]
    7. 7
  7. Ercolano, E., R. Mirabella, M. Merrick, and M. Chiurazzi. 2001. The Rhizobium leguminosarum glnB gene is down regulated during symbiosis. Mol. Gen. Genet. 264:555-564.[CrossRef][Medline]
    8. 8
  8. Friedman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. M. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its use in genetic analysis of Rhizobium mutants. Gene 18:289-296.[CrossRef][Medline]
    9. 9
  9. Gentry, D. R., and R. R. Burgess. 1989. rpoZ encoding the omega subunit of E. coli RNA polymerase is in the same operon as spoT. J. Bacteriol. 171:1271-1277.[Abstract/Free Full Text]
    10. 10
  10. Gentry, D. R., and M. Cashel. 1996. Mutational analysis of the Escherichia coli spoT gene identifies distinct but overlapping regions involved in ppGpp synthesis and degradation. Mol. Microbiol. 19:1373-1384.[CrossRef][Medline]
    11. 11
  11. Givens, R. M., M.-H. Lin, D. J. Taylor, U. Mechold, J. O. Berry, and V. J. Hernandez. 2004. Inducible expression, enzymatic activity, and origin of higher plant homologues of bacterial RelA/SpoT stress proteins in Nicotiana tabacum. J. Biol. Chem. 279:7495-7504.[Abstract/Free Full Text]
    12. 12
  12. Hernandez, V. J., and H. Bremer. 1991. Escherichia coli ppGpp synthetase II activity requires spoT. J. Biol. Chem. 266:5991-5999.[Abstract/Free Full Text]
    13. 13
  13. Hogg, T., U. Mechold, H. Malke, M. Cashel, and R. Hilgenfeld. 2004. Conformational antagonism between opposing active sites in a bifunctional RelA/SpoT homolog modulates (p)ppGpp metabolism during the stringent response. Cell 117:57-68.[CrossRef][Medline]
    14. 14
  14. Howorth, S. M., and R. R. England. 1999. Accumulation of ppGpp in symbiotic and free-living nitrogen-fixing bacteria following amino acid starvation. Arch. Microbiol. 171:131-134.[CrossRef][Medline]
    15. 15
  15. Inoue, H., H. Nojima, and H. Okayama. 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96:23-28.[CrossRef][Medline]
    16. 16
  16. Kahn, M. L., J. Kraus, and J. E. Somerville. 1985. A model of nutrient exchange in the Rhizobium-legume symbiosis, p. 193-199. In H. Evans, P. Bottomley, and W. E. Newton (ed.), Nitrogen fixation research progress. M. J. Nijhoff, New York, N.Y.
    17. 17
  17. Karnovsky, M. J. 1965. A formaldehyde-glutaraldehyde fixative of high osmolarity for use in electron microscopy. J. Cell Biol. 27:137.
    18. 18
  18. Laeremans, T., I. Caluwaerts, C. Verreth, M. A. Rogel, J. Vanderleyden, and E. Martínez-Romero. 1996. Isolation and characterization of the Rhizobium tropici Nod factor sulfation genes. Mol. Plant-Microbe Interact. 9:492-500.[Medline]
    19. 19
  19. Leong, S. A., G. Ditta, and D. R. Helinski. 1982. Heme synthesis in Rhizobium. Identification of a cloned gene coding for delta-aminolevulinic acid synthetase from Rhizobium meliloti. J. Biol. Chem. 257:8724-8730.[Abstract/Free Full Text]
    20. 20
  20. Lodwig, E. M., A. H. Hosie, A. Bourdes, K. Findlay, D. Allaway, R. Karunakaran, J. A. Downie, and P. S. Poole. 2003. Amino acid cycling drives nitrogen fixation in the legume-Rhizobium symbiosis. Nature 422:722-726.[CrossRef][Medline]
    21. 21
  21. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275.[Free Full Text]
    22. 22
  22. Maerchler-Bauer, A., J. B. Anderson, C. De Weese-Scott, N. D. Fedorova, L. Y. Geer, S. He, D. I. Hurwitz, J. D. Jackson, A. R. Jacobs, C. J. Lanczycki, C. A. Liebert, C. Liu, T. Madej, T., G. H. Marchler, R. Mazumder, A. N. Nikolskaya, A. R. Panchenko, B. S. Rao, B. A. Shoemaker, V. Simonyan, J. S. Song, P. A. Thiessen, S. Vasudevan, Y. Wang, R. A. Yamashita, J. J. Yin, and S. H. Bryant. 2003. CDD: a curated entrez database of conserved domain alignments. Nucleic Acids Res. 31:383-387.[Abstract/Free Full Text]
    23. 23
  23. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
    24. 24
  24. Mechold, U., H. Murphy, L. Brown, and M. Cashel. 2002. Intramolecular regulation of the opposing (p)ppGpp catalytic activities of Relseq, the Rel/Spo enzyme from Streptococcus equisimilis. J. Bacteriol. 184:2878-2888.[Abstract/Free Full Text]
    25. 25
  25. Mendoza, A., A. Leija, E. Martinez-Romero, G. Hernández, and J. Mora. 1995. The enhancement of ammonium assimilation in Rhizobium etli prevents nodulation of Phaseolus vulgaris. Mol. Plant-Microbe Interact. 8:584-592.[Medline]
    26. 26
  26. Metzger, S., E. Sarubbi, G. Glaser, and M. Cashel. 1989. Protein sequences encoded by the relA and the spoT genes of Escherichia coli are interrelated. J. Biol. Chem. 264:9122-9125.[Abstract/Free Full Text]
    27. 27
  27. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
    28. 28
  28. Mittenhuber, G. 2001. Comparative genomics and evolution of genes encoding bacterial (p)ppGpp synthetases/hydrolase (the Rel, RelA and SpoT proteins). J. Mol. Microbiol. Biotechnol. 3:585-600.[Medline]
    29. 29
  29. Morales, V. M., A. Bäckman, and M. Bagdasarian. 1991. A series of wide-host-range low-copy-number vectors that allow direct screening for recombinants. Gene 97:39-47.[CrossRef][Medline]
    30. 30
  30. Moreno, S., E. J. Patriarca, M. Chiurazzi, R. Meza, R. Defez, A. Lamberti, A. Riccio, M. Iaccarino, and G. Espín. 1992. Phenotype of a Rhizobium leguminosarum ntrC mutant. Res. Microbiol. 143:161-171.[Medline]
    31. 31
  31. Mylona, P., K. Pawlowsky, and T. Bisseling. 1995. Symbiotic nitrogen fixation. Plant Cell 7:869-885.[CrossRef][Medline]
    32. 32
  32. Patriarca, E. J., R. Taté, E. Fedorova, A. Riccio, R. Defez, and M. Iaccarino. 1996. Down regulation of the Rhizobium ntr system in the determinate nodule of Phaseolus vulgaris identifies a specific developmental zone. Mol. Plant-Microbe Interact. 9:243-251.
    33. 33
  33. Patriarca, E. J., R. Tatè, and M. Iaccarino. 2002. Key role of bacterial NH4+ metabolism in rhizobium-plant symbiosis. Microbiol. Mol. Biol. Rev. 66:203-222.[Abstract/Free Full Text]
    34. 34
  34. Poole, P., and D. Allaway. 2000. Carbon and nitrogen metabolism in Rhizobium. Adv. Microb. Physiol. 43:117-163.[Medline]
    35. 35
  35. Powell, B. S., and D. L. Court. 1998. Control of ftsZ expression, cell division, and glutamine metabolism in Luria-Bertani medium by the alarmone ppGpp in Escherichia coli. J. Bacteriol. 180:1053-1062.[Abstract/Free Full Text]
    36. 36
  36. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313.[CrossRef][Medline]
    37. 37
  37. Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 127:15-21.[CrossRef][Medline]
    38. 38
  38. Roth, E., K. Jeon, and G. Stacey. 1988. Homology in endosymbiotic systems: the term "symbiosome," p. 220-225. In R. Palacios and D. P. S. Verma (ed.), Molecular genetics of plant-microbe interactions. American Phytopathological Society, St. Paul, Minn.
    39. 39
  39. Schultze, M., and A. Kondorosi. 1998. Regulation of symbiotic root nodule development. Annu. Rev. Genet. 32:33-57.[CrossRef][Medline]
    40. 40
  40. Segovia, L., J. P. W. Young, and E. Martínez-Romero. 1993. Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. nov. Int. J. Syst. Bacteriol. 43:374-377.[Abstract/Free Full Text]
    41. 41
  41. Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/Technology 1:784-791.[CrossRef]
    42. 42
  42. Tate, R., E. J. Patriarca, A. Riccio, R. Defez, and M. Iaccarino. 1994. Development of Phaseolus vulgaris root nodules. Mol. Plant-Microbe Interact. 7:582-589.
    43. 43
  43. Tate, R., A. Riccio, M. Merrick, and E. J. Patriarca. 1998. The Rhizobium etli amtB gene coding for an NH4+ transporter is down regulated early during bacteroid differentiation. Mol. Plant-Microbe Interact. 11:188-198.[Medline]
    44. 44
  44. Tate, R., M. Cermola, A. Riccio, M. Iaccarino, M. Merrick, R. Favre, and E. J. Patriarca. 1999. Ectopic expression of the Rhizobium etli amtB gene affects the symbiosome differentiation process and nodule development. Mol. Plant-Microbe Interact. 12:515-525.[CrossRef]
    45. 45
  45. Uzan, M., and A. Danchin. 1976. A rapid test for the relA mutation in E. coli. Biochem. Biophys. Res. Commun. 69:751-758.[CrossRef][Medline]
    46. 46
  46. Van Rhijn, P., and J. Vanderleyden. 1995. The Rhizobium-plant symbiosis. Microbiol. Rev. 59:124-142.[Abstract/Free Full Text]
    47. 47
  47. Vázquez, M., A. Dávalos, A. de las Peñas, F. Sánchez, and C. Quinto. 1991. Novel organization of the common nodulation genes in Rhizobium leguminosarum bv. phaseoli strains. J. Bacteriol. 173:1250-1258.[Abstract/Free Full Text]
    48. 48
  48. Wells, D. H., and S. R. Long. 2002. The Sinorhizobium meliloti stringent response affects multiple aspects of symbiosis. Mol. Microbiol. 43:1115-1127.[CrossRef][Medline]
    49. 49
  49. Xiao, H., M. Kalman, K. Ikehara, S. Zemel, G. Glaser, and M. Cashel. 1991. Residual guanosine 3',5'-bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations. J. Biol. Chem. 266:5980-5990.[Abstract/Free Full Text]
    50. 50
  50. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33:103-119.[CrossRef][Medline]
    51. 51
  51. Zetterqvist, H. 1956. The ultrastructural organization of the columnar absorbing cells of the mouse jejunum. Ph.D. thesis. Karolinska Institute, Stockholm, Sweden.

Journal of Bacteriology, August 2005, p. 5075-5083, Vol. 187, No. 15
0021-9193/05/$08.00+0     doi:10.1128/JB.187.15.5075-5083.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Gan, H. M., Buckley, L., Szegedi, E., Hudson, A. O., Savka, M. A. (2009). Identification of an rsh Gene from a Novosphingobium sp. Necessary for Quorum-Sensing Signal Accumulation. J. Bacteriol. 191: 2551-2560 [Abstract] [Full Text]  
  • Humann, J. L., Ziemkiewicz, H. T., Yurgel, S. N., Kahn, M. L. (2009). Regulatory and DNA Repair Genes Contribute to the Desiccation Resistance of Sinorhizobium meliloti Rm1021. Appl. Environ. Microbiol. 75: 446-453 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calderón-Flores, A.
Right arrow Articles by Durán, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calderón-Flores, A.
Right arrow Articles by Durán, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»