JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iturbe-Ormaetxe, I.
Right arrow Articles by O'Neill, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iturbe-Ormaetxe, I.
Right arrow Articles by O'Neill, S. L.
Journal of Bacteriology, August 2005, p. 5136-5145, Vol. 187, No. 15
0021-9193/05/$08.00+0     doi:10.1128/JB.187.15.5136-5145.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Distribution, Expression, and Motif Variability of Ankyrin Domain Genes in Wolbachia pipientis{dagger}

Iñaki Iturbe-Ormaetxe, Gaelen R. Burke, Markus Riegler, and Scott L. O'Neill*

School of Integrative Biology, The University of Queensland, St. Lucia, QLD 4072, Brisbane, Australia

Received 11 January 2005/ Accepted 28 April 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The endosymbiotic bacterium Wolbachia pipientis infects a wide range of arthropods, in which it induces a variety of reproductive phenotypes, including cytoplasmic incompatibility (CI), parthenogenesis, male killing, and reversal of genetic sex determination. The recent sequencing and annotation of the first Wolbachia genome revealed an unusually high number of genes encoding ankyrin domain (ANK) repeats. These ANK genes are likely to be important in mediating the Wolbachia-host interaction. In this work we determined the distribution and expression of the different ANK genes found in the sequenced Wolbachia wMel genome in nine Wolbachia strains that induce different phenotypic effects in their hosts. A comparison of the ANK genes of wMel and the non-CI-inducing wAu Wolbachia strain revealed significant differences between the strains. This was reflected in sequence variability in shared genes that could result in alterations in the encoded proteins, such as motif deletions, amino acid insertions, and in some cases disruptions due to insertion of transposable elements and premature stops. In addition, one wMel ANK gene, which is part of an operon, was absent in the wAu genome. These variations are likely to affect the affinity, function, and cellular location of the predicted proteins encoded by these genes.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The gram-negative obligate intracellular bacterium Wolbachia pipientis is extremely widespread, infecting 20 to 75% of all insect species (21, 59), as well as other invertebrates, such as spiders, mites, terrestrial crustaceans, and filarial nematodes (7, 11, 31, 39, 51). Wolbachia is maternally transmitted and can rapidly invade insect populations through the reproductive distortions that it generates in hosts. These include cytoplasmic incompatibility (CI), parthenogenesis, male killing, and reversal of genetic sex determination (33, 38, 47, 48). CI is a type of embryonic lethality that in its simplest form results when Wolbachia-infected males mate with uninfected females. CI provides a reproductive advantage to infected hosts and as a result enhances the transmission of Wolbachia in host populations.

Despite considerable interest in Wolbachia as an agent that might promote insect speciation (5, 10) and as an applied tool for insect pest and disease control (4, 22, 45, 57), little is known about the molecular mechanisms that mediate the various reproductive distortions that it generates. Interestingly, the recent sequencing and annotation of the first Wolbachia genome, that of the strain that naturally infects Drosophila melanogaster (wMel) (60), revealed an unusually large number of genes that encode proteins containing ankyrin repeat (ANK) domains. While these domains are relatively common in both eukaryotic and viral proteins (42) and have been identified in more than 3,600 different proteins to date (29), they are relatively rare in bacteria. The annotation of 23 ANK genes in the wMel genome (2% of the total number of genes) is very atypical compared to the genomes of related {alpha}-Proteobacteria, such as Rickettsia, Anaplasma, and Ehrlichia, whose genomes typically contain only one to three genes encoding ankyrin repeats (2, 12). It has been proposed that the ANK genes in Wolbachia are likely to play a functional role in its unique biology (60).

The ANK domain is typically a 33-residue L-shaped motif containing two antiparallel {alpha}-helices connected by a short loop. ANK domains mediate protein-protein interactions (29, 43) in diverse families of proteins, including cytoskeletal and membrane proteins, transcriptional and developmental regulators, toxins, and CDK (cyclin-dependent kinase) inhibitors (6, 27, 43). Interestingly, the inhibition of CDK1 has been proposed as a possible mechanism explaining the CI phenotype induced by Wolbachia in Nasonia wasps (53, 54). Moreover, in the related intracellular tick-borne pathogen Anaplasma phagocytophilum an ANK protein (AnkA) is secreted into the host cell, where it binds host chromatin, suggesting that it has a role in the regulation of host gene expression (12).

Considering the potential importance of ANK motifs in mediating protein-protein interactions and their profusion in Wolbachia, we performed a comparative study to examine the distribution, transcription, and sequence variation of ANK genes from nine different Wolbachia strains (Table 1). These strains all infect Drosophila and are capable of generating a range of different CI crossing types, and in some cases they are unable to cause CI (17). The latter strains are known to be incapable of inducing CI in males but still retain the capacity to rescue CI in females (mod/resc+) (8, 26), or they are incapable of either inducing or rescuing CI (mod/resc).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Wolbachia strains and Drosophila hosts used in this work

 

    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fly stocks and Wolbachia strains. The Wolbachia and Drosophila strains used in this work are listed in Table 1. Wolbachia strains were selected on the basis of the extent to which they cause CI (strong, weak, or non-CI inducers) in their hosts and their modification/rescue phenotypes. Wolbachia infections were maintained in fly stocks reared on standard corn flour-sugar-yeast medium at 25°C. Clearing of Wolbachia infections with tetracycline was performed as described elsewhere (18).

Dot blot analysis. DNA was extracted from D. melanogaster or Drosophila simulans female flies harboring the different Wolbachia strains (Table 1). Flies were homogenized and extracted by using either the Holmes-Bonner protocol (20) or an STE extraction method (32). DNA from tetracycline-treated D. melanogaster yw67c23 (wMel-T) and D. simulans Riverside-DSR (wRi-T) flies was also extracted and used as negative controls. DNA was spotted onto Zeta-Probe nylon filters (Bio-Rad), cross-linked by UV irradiation, and hybridized at 65°C overnight in 0.5 M sodium phosphate buffer, pH 7.0, 7% sodium dodecyl sulfate, 1 mM EDTA. Following hybridization the membranes were washed under medium-stringency conditions at 65°C (15-min washes in 2x SSC, 1x SSC, and then 0.5x SSC, all containing 0.1% sodium dodecyl sulfate [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate]). Autoradiography was performed with a PhosphorImager screen (Molecular Dynamics).

The probes for the 23 different ANK genes (see Fig. S1 in the supplemental material) were PCR amplified from Wolbachia wMel genomic DNA using specific primers (see Table S1 in the supplemental material). The Wolbachia surface protein gene wsp was amplified with primers 81F and 691R (9) and probed as a control for Wolbachia DNA. The PCR cycling conditions were as follows: 94°C for 3 min, followed by 94°C for 30 s, 50°C for 30 s, and 72°C for 3 min for 35 cycles and then 72°C for 10 min. The reaction mixture (final volume, 20 µl) contained each primer at a concentration of 500 nM, each deoxynucleoside triphosphate at a concentration of 200 µM, 1.5 mM MgCl2, 100 ng of wMel DNA, and 1 U of Taq polymerase (Promega). The reaction buffer contained 10 mM Tris (pH 9.0), 50 mM KCl, and 0.1% Triton X-100. PCR products were separated in 1% agarose gels, stained with ethidium bromide, and gel purified using gel extraction kits (QIAGEN). They were radioactively labeled with [{alpha}-32P]dATP (Amersham Pharmacia) using a Random Primed DNA labeling kit (Roche) and were cleaned prior to hybridization with a PCR purification kit (QIAGEN).

RT-PCR. Total RNA was extracted from Drosophila harboring the different Wolbachia strains using Trizol (Invitrogen), followed by chloroform extraction and isopropanol precipitation. The RNA preparation was treated with RNase-free RQ1 DNase (Promega), and first-strand cDNA was synthesized from 5 µg of total RNA using reverse transcriptase (RT) (Superscript III; Invitrogen) and random primers (Promega) at 42°C for 60 min. The cDNA was treated with RNase H prior to the PCR. Negative controls to detect genomic DNA contamination were processed in the same way, except that no reverse transcriptase was added to the reaction mixture. cDNA synthesized using RNA from tetracycline-treated Drosophila flies was used as a Wolbachia-free negative control. PCR amplification was performed as described previously using 1 µl of cDNA as the template and the primers listed in Table S1 in the supplemental material. Each RT-PCR was repeated three times using independent RNA extracts and cDNA synthesis reactions. Negative controls showed no PCR amplification. In order to characterize expression of the WD0512-WD0513-WD0514 operon (see Fig. 2B), the following primers spanning the intergenic regions were used: P1 (5'-CTAATGCAAACCCATGAAACCCTGC-3'), P2 (5'-CCATTTATAATAGCTGGGGCTATGG-3'), P3 (5'-GAGAATTATCTTGATAGAGTTGTACC-3'), and P4 (5'-CGATATTGTTTTAGAGAAAACAAAGG-3').



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. WD0512-WD0513-WD0514 is an operon that is not present in the Wolbachia wAu strain. (A) Dot blot hybridization analysis of the WD0512, WD0513, and WD0514 genes in all the Wolbachia strains used in this study. A control dot blot for the wsp gene was also included. Spot 1, wMel; spot 2, wMel-T, tetracycline treated; spot 3, wMelPop; spot 4, wRi; spot 5, wRi-T, tetracycline treated; spot 6, wAu1; spot 7, wAu2; spot 8, wAu3; spot 9, negative control; spot 10, wAu4; spot 11, wNo; spot 12, wMau; spot 13, wCer2; spot 14, wAu4; spot 15, wMelCS; spot 16, wHa. Spot 9 contained extraction buffer and was used as a negative control. Spot 14 was a duplicate of spot 10 and was used as a reproducibility control. (B) RT-PCR demonstrating the expression of the three genes as a single transcript in the wMel and wMelPop Wolbachia strains. Lanes 1 to 3, primers spanning the junction between WD0512 and WD0513 (P1+P2); lanes 4 to 6, negative controls (–RT); lanes 7 to 9, primers spanning the junction between WD0513 and WD0514 (P3+P4); lanes 10 to 12, negative controls (–RT). (C) RT-PCR of WD0514 in the wMel, wAu, and wMelPop Wolbachia strains, showing no expression of this gene in wAu. Negative controls, in which no reverse transcriptase was added during the cDNA synthesis (–RT), were included.

 
Characterization of the genomic region around WD0514 in the Wolbachia wAu strain. For sequencing of the genomic region flanking WD0514, DNA was extracted from the Wolbachia wAu strain, digested using either the EcoRI or SpeI restriction endonuclease (New England Biolabs), and ligated overnight at 12°C into pBluescript II SK (Stratagene). The ligation mixtures were diluted 1:20, and 1 µl was used as a template for PCRs performed with various forward primers specific for several open reading frames (ORFs) adjacent to WD0514 and reverse primers specific for pBluescript, such as primer M13R (5'-CAGGAAACAGCTATGAC-3') or T7 (5'-TAATACGACTCACTATAGGG-3'). The PCR conditions were the same as those described above for the RT-PCR analysis, except that Expand High Fidelity Taq polymerase (Roche) was used. PCR bands were cloned into the pGEM-T Easy vector (Promega) and sequenced with the T7 and M13R universal primers using an AB Big Dye terminator kit (version 3.1) with fluorescent sequencing and AmpliTaq DNA polymerase (Perkin-Elmer), and they were analyzed with an AB 3730xl-96 capillary sequencer. Sequencing was done at the Australian Genome Research Facility. Sequence similarity searches were performed using the BLAST algorithm (1) at the National Center for Biotechnology Information. Analysis and assembly of the sequences were done using the EditSeq, SeqMan, and MegAlign components of the Lasergene sequence analysis software package (DNAStar Inc., Madison, Wis.). The primers used to confirm the insertion size (see Fig. 3B) were P5 (5'-GCAGCCATGCTCGGTAA-3') and P6 (5'-ACTTTGGAGTTAAAACCGTA-3'). These primers are 28.25 kb apart in the wMel genome and anneal to single-copy genes (WD0505 and WD0523, respectively).



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. (A) wMel genomic region surrounding the WD0514 ANK gene, showing the genes that are missing in the wAu and wCer2 strains. (B) (Top panel) PCR for the region in various Wolbachia strains using primers P5 and P6 specific for the single-copy genes WD0505 and WD0523, which are 28.25 kb apart in the wMel genome. The PCR showed that the missing fragment in wAu is 21.86 kb long (28.25 kb minus 6.39 kb), and in wCer2 is 23.77 kb long (28.25 kb minus 4.48 kb). (Bottom panel) Positive PCR control for Wolbachia DNA using primers for the wsp gene. Tetracycline-treated flies (wMel-T and wRi-T) were cleared of Wolbachia. (C) Genes surrounding the WD0512-WD0513-WD0514 operon in the wMel genome. The annotation and sequence of the genes shown can be found at the Comprehensive Microbial Resource at www.tigr.org.

 
Sequencing of ANK genes in the Wolbachia wAu strain. ANK genes from the different Wolbachia strains were PCR amplified using specific primers (see Table S1 in the supplemental material) based on the recently sequenced Wolbachia strain wMel genome (60). The PCR parameters were basically those described above, except that Expand High Fidelity Taq polymerase (Roche) was used. Three or four independent PCRs were performed for each gene. Sequence manipulation and analysis were done as described above. The protein domains were identified by using SMART v3.5 (http://smart.embl-heidelberg.de/) (23, 42). The partial sequences which we obtained for the WD0191 and WD0285 genes in wAu using the primers indicated in Table S1 are identical to the sequences of the genes in wMel.

Nucleotide sequence accession numbers. Partial sequences of the wAu genes that differ from their homologues in wMel have been deposited in the GenBank database under the following accession numbers: WD0035, AY971752; WD0073, AY971753; WD0147, AY971754; WD0286, AY971755; WD0291, AY971756; WD0292, AY649749; WD0294, AY649750; WD0385, AY664873; WD0438, AY971757; WD0441, AY971758; WD0498, AY836559; WD0550, AY649751; WD0566, AY971759; WD0596, AY971760; WD0633, AY672910; WD0636, AY649752; WD0637, AY971761; WD0754, AY836560; WD0766, AY649753; and WD1213, AY971762.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Distribution of ANK genes in different Wolbachia strains. We determined the distribution of the 23 ANK genes found in the wMel Wolbachia genome in a variety of Wolbachia strains that have different effects in their hosts (Table 1). We placed special emphasis on the comparison between the sequenced wMel strain, which causes CI in Drosophila, and the closely related wAu strain. The latter strain was initially found in Australia and America (17, 56) and is unable to cause CI in Drosophila. Probes for the 23 ANK genes (see Fig. S1 in the supplemental material) were PCR amplified, radioactively labeled, and hybridized to membranes containing DNA from a wide range of Wolbachia strains. We found that the distribution of the 23 wMel genes coding for ANK proteins varied significantly in the strains (Fig. 1). A dot blot and PCR analysis was especially useful for revealing putatively absent genes. As expected, all the probes hybridized to wMel DNA and to DNA of the virulent wMelPop ("popcorn") strain, whose genome sequence is very similar to that of wMel (49). Only 2 of the 23 ANK genes (WD0441 and WD0498) weakly hybridized (data not shown) to DNA extracted from the tetracycline-treated flies (wMel-T and wRi-T), which were used as negative controls. This was most likely the result of nonspecific hybridization, as DNA from these flies was negative (as determined both by PCR and by hybridization) for the characteristic Wolbachia wsp gene (Fig. 2A, bottom panel). In this work we used four wAu strains (mod/resc) obtained from different fly stocks (Table 1) in order to compare the reproducibility of the results and the genetic consistency of the infection. The four strains gave identical results in all experiments. Most ANK genes were found in all group A Wolbachia, with a few exceptions. WD0514 was present only in strains that have the wMel CI crossing type (wMel, wMelCS, and wMelPop), and it was absent in all strains that have different CI crossing types, as well as wAu (mod/resc) and the wMau strain (mod/resc+). In addition, a group of phage-associated ANK-containing genes (WD0285, WD0291, WD0292, and WD0294) were absent from wRi (Fig. 1), most likely reflecting differences in prophage insertions between strains. The wHa Wolbachia strain, a more distant relative of the wMel strain, as shown in the cladogram in Fig. 1, was negative for 7 of the 23 ANK genes. Most ANK genes were not detected in group B Wolbachia, probably due to high levels of sequence divergence between strains since BLAST analysis of the unfinished Wolbachia genome of Culex (www.sanger.ac.uk) and the recently completed Wolbachia genome of Brugia (14) revealed a number of genes with similarity to the wMel ANK genes. Comparison of the mod/resc+ strain wMau with the very closely related mod+/resc+ strain wNo revealed the absence of WD0286 and WD0596 in wMau (Fig. 1).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1. Distribution of ANK genes in several Wolbachia strains. The plus and minus signs indicate the presence and absence, respectively, of an above-background signal in dot blot hybridization experiments. An asterisk indicates that data for samples were confirmed by PCR. The dot blot results for the four wAu strains used in this study (Table 1) were identical, and they are grouped for clarity. The most interesting results are enclosed in boxes. The phylogenetic tree on the left is a cladogram based on the Wolbachia surface protein gene (wsp) sequences of strains wMel (GenBank accession number AF020072), wMelPop (AF338346), wMelCS (AF020065), wCer2 (AF418557), wAu (AF020067), wRi (AF20070), wHa (AF020068), wNo (AF020074), and wMau (AF020069); this cladogram was constructed by the unweighted-pair group method using average linkages. The four wAu strains used in this study have identical wsp sequences. Sequences were aligned using Clustal X (52), and the phylogenetic tree was constructed using PAUP (50).

 
ANK gene WD0514 is part of an operon that is present in all mod+ members of the wMel clade and absent in all mod wAu strains. Since the WD0514 gene was present only in strains belonging to the wMel clade, which were capable of generating the wMel CI crossing type, we examined the possibility that this was the result of recent introduction into this clade. Both dot blot analysis (Fig. 2A) and PCR analysis (data not shown) of the chromosomal region around this gene showed that the upstream ORFs WD0512 and WD0513 were absent in all strains that lacked WD0514, including wAu, and were present only in wMel, wMelCS, and wMelPop. RT-PCR using primers spanning the junction between these three ORFs demonstrated that these three genes, which have little or no intergenic space between them, are transcribed as a single transcriptional unit in Wolbachia strains wMel and wMelPop (Fig. 2B), whereas there is no expression of the operon or WD0514 in wAu (Fig. 2C).

To determine the extent of the presumed insertion around the WD0512-WD0513-WD0514 operon in wMel strains, wAu genomic DNA was digested with either EcoRI or SpeI endonuclease, ligated into pBluescript, and used for chromosome walking by PCR performed with primers in the vector and in various single-copy genes contiguous to these ORFs. After sequencing and assembling the resulting PCR products, we identified a difference of 21.86 kb between the wMel genome and the wAu strain genome (Fig. 3A). This result was confirmed by PCR amplification of the sequence between the single-copy WD0505 and WD0523 genes that flank this region. The distance between the PCR primers (P5 and P6) (Fig. 3A) in wMel is 28.25 kb, but the PCR product obtained with wAu DNA was 6.39 kb long (Fig. 3B), indicating that there was a 21.86-kb difference compared to wMel strains. Sequencing and restriction analysis of this band confirmed the gap between wMel chromosomal positions 486988 and 508845 that includes the ORFs WD0506 to WD0518. In wCer2, the PCR band obtained was 4.48 kb (Fig. 3B), indicating a larger, 23.77-kb difference (positions 486531 to 510304) compared to the wMel genome. The additional chromosomal section in wMel contains a series of genes (Fig. 3C) related to mobile element function, such as genes encoding two reverse transcriptases that are partially deleted in wAu (WD0506 and WD0518) or one reverse transcriptase in wCer2, as well as genes encoding two IS5 transposases (WD0516 and WD0517) (60). The fragment also contains genes encoding a degenerate RNase, a conserved hypothetical protein, and a transcriptional regulator, as well as two DNA repair genes (radC and mutL-2). The absence of these genes in wAu and wCer2 might have no phenotypic effect if they are multicopy genes, as they are in wMel (there is an extra copy of radC plus two truncated copies, and there is a paralogue of mutL-2, designated mutL-1, as well as a related gene, mutS). Of the 13 genes in wMel, only radC, mutL-2, and the RNase gene have orthologues in both Ehrlichia and Anaplasma, whereas the rest of the genes, including the WD0512-WD0513-WD0514 operon, have no orthologues in the genomes of these relatives.

ANK proteins are highly variable in mod+/resc+ and mod/resc Wolbachia strains. In order to determine possible differences between ANK genes of mod+/resc+ and mod/resc Wolbachia strains, we partially sequenced all 22 ANK genes from the wAu strain and compared them to the genes of wMel. Thirteen of the 22 genes had minor sequence variations (98 to 100% identity; see Materials and Methods for accession numbers). Among the rest, WD0292 encodes a protein containing a 4-amino-acid insertion in wAu (accession no. AY649749) compared to the wMel protein, whereas the protein encoded by WD0633 (accession no. AY672910) in wAu has small insertions and deletions of amino acids (two insertions and three deletions). Notably, seven ANK genes in wAu encode proteins with important differences (Fig. 4) compared with their wMel homologues, including variations in the number of ANK repeats, ORF disruption by transposable element insertions, premature stops, and fusion to an adjacent ORF, that were initially annotated as separated genes in the wMel genome. As a result of a 66-amino-acid deletion affecting repeats 4 and 5, the phage-associated WD0294 protein (accession no. AY649750) has seven ANK repeats in wAu compared with nine ANK repeats in wMel. WD0550 (accession no. AY649751) contains two extra ANK repeats (coding 66 extra amino acids) in wAu, whereas WD0766 (accession no. AY649753) contains three extra ANK repeats as a result of two insertions coding for 66 and 58 amino acids. In this case the precise ANK motifs that are deleted are unclear, although it appears that domains 2, 3, and 6 from wAu are absent in wMel (Fig. 4). Most importantly, in the wAu strain this gene contains a premature stop that eliminates the two transmembrane domains at the C terminus (Fig. 4) of the protein.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 4. ANK proteins whose sequence and/or domain architecture is significantly different in wMel and wAu. The location of ANK motifs was determined using SMART v3.5 (http://smart.embl-heidelberg.de/) (23, 42). Similar results were obtained by analysis of the Pfam Conserved Domain at Washington University (http://pfam.wustl.edu). Transmembrane domains are represented by black boxes, as predicted by the TMHMM2 server. Coiled coil regions (striped boxes) were determined by the Coils2 program. The open squares represent segments with low compositional complexity, as determined by the SEG program. The arrows indicate point mutations in the stop codon between WD0498 and WD0499 and between WD0754 and WD0753. Inserted or deleted ANK domains are indicated by asterisks.

 
We also found that some ANK genes are larger in wAu than in wMel, as a result of mutations in the sequences that eliminate the stop codons that separate them from the next gene. On the one hand, WD0498 and WD0499 were initially annotated as separated ORFs in the wMel genome (60), but we found no stop codon between them in the wAu strains. The ANK protein encoded by WD0498 is therefore larger in wAu (accession no. AY836559) and contains an extra ANK repeat, previously unidentified in the annotation of the wMel genome, as a result of its fusion with WD0499 (Fig. 4). WD0499 is, however, shorter in wAu as a result of a premature stop codon. It seems clear that the mutation of a CAA codon into a TAA stop codon that results in the removal of one ANK repeat in the protein occurred in the wMel lineage, since this stop codon also appears in wMelCS and wMelPop (sequences identical to wMel) but not in wAu (accession no. AY836559), wCer2, or wRi (accession no. AY971763; wCer2 sequence similar to the wRi sequence). Similarly, we also found that the stop codon that separates the ANK gene WD0754 from the hypothetical gene WD0753 is present only in wMel, wMelCS, and wMelPop (similar sequences). In wAu (accession no. AY836560) and wCer2 (same sequence) a change from TAA to TCA results in fusion of the two genes as a single coding sequence. In this case, the addition of WD0753 to WD0754 does not modify the number of ANK repeats in the encoded wAu protein, but it does add an extra two transmembrane domains, as determined by TMHMM (Fig. 4). Gene junctions between other ANK genes that appear to be immediately adjacent to their flanking genes were also sequenced in various strains, but no other mutations in stop codons were found.

In addition to variation in the number of ANK domains, some ANK genes in the wAu Wolbachia strain contain major disruptions. The WO phage-associated ANK gene WD0636 (accession no. AY649752) carries a point mutation that introduces a premature stop codon into this gene in all the mod/resc wAu strains examined. This mutation is predicted to result in the production of a truncated WD0636 protein that lacks one ANK motif at the carboxy terminus and could affect its function. This premature stop was not found in other Wolbachia strains, such as wMelPop and wMelCS (data not shown). The phage-associated ANK gene WD0385 from wAu (accession no. AY664873) was found to contain a full-length 919-bp IS5 insertion element disrupting the ORF at nucleotide position 769, in the middle of the seventh ANK motif (Fig. 4). IS5 elements are very common in wMel, and there are 13 identical copies in the chromosome (60). They contain two ORFs for transposases and are flanked by terminal inverted repeats (TIRs). Interestingly, whereas all 13 IS5 elements in the wMel genome have asymmetrical TIRs containing one mismatch, the IS5 element inserted into WD0385 in wAu is flanked by identical TIRs (5'-AGAGGTTGTCCGGAAACAAGTAAA-3'). The orfA gene in this wAu IS5 element encodes a transposase with four amino acid differences compared with the wMel OrfA.

ANK gene expression. The expression of the 23 ANK genes from wMel was determined by RT-PCR by using RNA isolated from the wMel, wMelPop, and wAu Wolbachia strains. Two RT-PCR examples are shown in Fig. 5A. RT-PCRs showed that most ANK genes are actively expressed in these strains; the only exceptions are WD0514 (Fig. 2C), which is missing in the wAu chromosome (Fig. 1), and WD0385, which is only partially transcribed in wAu (Fig. 5B). When we used RT-PCR primers spanning the junction across the insertion element, we found expression of the WD0385 cDNA upstream of the IS5 insertion element (primers P7 [5'-GCAGAAGATGAAGAGGGAAAC-3'] and P8 [GAGTTCGTATGTCTTGAGTAG]) but not across the insertion point (primers P7 and P9 [5'-AAGGGAATGGTCAAGAATAG-3']). Early termination of the transcript is probably caused by the TIRs that flank IS5 and that could act as a transcriptional terminator element by forming a 24-bp hairpin, as determined using secondary RNA prediction programs (http://www.genebee.msu.su). The formation of this hairpin is facilitated by the fact that the TIRs that flank this IS5 element in the WD0385 gene are identical in their 24-bp sequences, unlike the TIRs in all 13 IS5 elements in the wMel genome, which contain a T/A mismatch at position 18.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 5. (A) RT-PCR showing expression of WD0633 and WD0754 in Wolbachia strains wMel, wAu, and wMelPop. –RT, negative controls with no reverse transcriptase. (B) RT-PCR demonstrating partial expression of WD0385 in Wolbachia strain wAu. This gene contains an IS5 insertion element, and only primers P7 and P8, upstream the insertion, were able to amplify the cDNA, whereas primers P7 and P9 could amplify only genomic DNA (gDNA) from wAu.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The sequencing of the Wolbachia genome has revealed a surprisingly high number of genes coding for ANK repeats. The fact that these motifs are typically involved in protein-protein interactions makes the proteins very attractive candidates for molecules that are involved in the molecular communication that takes place between Wolbachia and the host cell, a process that has not been characterized yet. Analysis of the 23 wMel ANK genes in other group A and B Wolbachia strains revealed significant variation between strains. Obviously, the possibility that novel ANK genes not present in the wMel sequence are present in other strains cannot be excluded. In fact, Salzberg et al. (41) recently assembled a nearly complete Wolbachia genome from D. simulans that contains seven new ANK genes not found in the wMel genome.

Strains that are capable of both inducing the CI modification in Drosophila sperm and rescuing this modification in Drosophila eggs during fertilization are known as mod+/resc+ strains and include wMel, wMelCS, and wMelPop (58). In contrast, wAu strains, while very closely related, have been shown to be incapable of either modifying host sperm or rescuing the modification of related strains and are designated mod/resc strains. The wMel, wMelCS, and wMelPop strains and various wAu Wolbachia strains were compared to examine differences in either the distribution, expression, or sequence of ANK genes that might correlate with the phenotypic differences known to occur in these strains. The first obvious difference observed between strains is the absence of the ankyrin domain gene WD0514 in all wAu strains (Fig. 1). When the region surrounding WD0514 was examined in more detail, we found that this gene is part of an operon together with the WD0512 and WD0513 genes. Moreover, the operon was found to be part of a 21.86-kb insertion in the wMel clade that contains 13 ORFs (Fig. 3). Considering that the WD0512-WD0513-WD0514 operon is found only in the wMel clade strains examined in this study, the most parsimonious explanation for the presence of this cluster of genes is an initial insertion of a reverse transcriptase in wAu (Fig. 3A), followed by insertion of the 21.86-kb element in the wMel-wMelCS-wMelPop lineage. This event would have been combined with duplication of the reverse transcriptase in wMel (Fig. 3A) to give the reverse transcriptase genes WD0506 and WD0518. Due to sequence divergence, we could not characterize by PCR this region in other Wolbachia strains that also lack the operon, although we found that the region is slightly different in wAu and wCer2. It is noteworthy that the G+C content of these 13 genes (35.7%) is similar to the average G+C content (35.2%) of the Wolbachia wMel genome (60), suggesting that the genes either were laterally transferred into the wMel lineage from a donor with a similar G+C content or, more probably, were present in the Wolbachia lineage for a considerable amount of time. In fact, the codon usage index in WD0506 to WD0518 is similar to the overall codon usage in the Wolbachia wMel genome (http://www.evolvingcode.net/codon) (44), and this supports the finding that most of the variation in codon bias in the Wolbachia genome can be traced to variation in G and C (60). When genes in this region, other than those associated with mobile genetic elements, are compared to the genomes of the related bacteria Ehrlichia, Anaplasma, and Rickettsia, only the operon containing WD0512-WD0513-WD0514 is unique to the Wolbachia lineage and exhibits no significant similarity to any genes in the GenBank database beyond the presence of the conserved ANK domains in WD0514 and a coiled coil section between amino acids 1 and 150. Considering that only Wolbachia is capable of inducing reproductive incompatibilities in its arthropod hosts and the other related genera are not, it could be expected that Wolbachia genes associated with these phenomena would be found only in the Wolbachia lineage.

The sequencing of ANK genes in Wolbachia strains wMel and wAu that infect Drosophila and cause different phenotypes has revealed considerable variation between the strains in 10 of the 23 ANK genes. This variation was unexpected given how closely related the wMel and wAu strains are (see the cladogram in Fig. 1) and the inability to readily discriminate between them with other molecular markers at the time that this work was initiated. When the genes are examined in the context of CI expression, five genes are potential candidates for mediating, or at least modulating, CI expression in Drosophila. These include WD0514 and its associated operon that is found only in strains that are capable of generating the CI phenotype characteristic of wMel strains. Also, WD0636 and WD0385 are interesting as both of them are disrupted in wAu strains, which are incapable of generating CI in Drosophila. The disruption of WD0385 in wAu by an IS5 element terminates transcription of this gene in wAu, an interesting exception given that all ANK genes are actively expressed in Wolbachia, as shown by RT-PCR. Finally, the protein encoded by WD0766 has a different number of repeats in wMel and wAu, and in wAu it contains a premature stop that eliminates the two transmembrane domains at the C terminus (Fig. 4) of the protein in wMel. Consequently, this sequence variation could modify the affinity and function of the protein not only by affecting the number and location of ANK domains but also by changing the anchoring of the protein in the membrane and therefore its cellular localization in wAu compared with wMel. The opposite takes place with the protein resulting from the fusion between WD0754 and WD0753, which adds transmembrane domains to the encoded protein in the non-CI-inducing strain wAu. The separation of WD0754 and WD0753 is probably the result of a point mutation in the wMel clade that resulted in the removal of the transmembrane domains from the original ANK protein, with possible subsequent changes affecting its cellular location and folding. Apart from these genes, a number of other genes, including WD0292, WD0294, WD0498, WD0550, and WD0633, display sequence variability between the wAu and wMel strains that in some cases results in insertions and deletions of entire ANK motifs in the encoded proteins. Variability of the structure of these proteins and the number of interacting domains might also be associated with phenotypic differences between these strains.

The genetic differences between phage-related ANK genes, such as WD0294, WD0633, and WD0636, seem to have occurred after the phage was inserted into the Wolbachia chromosome, and it is improbable that they represent insertion of phages containing different ANK proteins. At least for the P2-like prophage element designated wMelWO-B that contains the WD0633 and WD0636 genes, major rearrangements and translocations have taken place, suggesting that this element is inactive (60). WD0294 is in the wMelWO-A region that represents a separate insertion in the Wolbachia lineage.

Changes in the modular architecture of multiple domain proteins have been shown to affect the folding, function, and specificity of these proteins (30). The reproductive distortions caused by different Wolbachia strains in their hosts could be finely tuned by variations in ANK protein architecture that could affect the stability, specificity, and binding properties of Wolbachia's ANK proteins. The variability of phenotypes induced by different Wolbachia strains in their hosts is unlikely to be caused by the presence or absence of a "CI gene(s)," a "parthenogenetic gene(s)," or a "male-killing gene(s)," but it is likely to be caused by variation in the binding and affinity properties of the protein(s) responsible. It has recently been shown that deletion of terminal repeats (from the N or C terminus) in ANK proteins can be tolerated to various extents (55). For example, deletion of terminal repeats in the human ANK protein p16INK4a (a CDK inhibitor and tumor suppressor) decreases its unfolding energy, but the internal repeats maintain their structure (61), whereas in the Drosophila Notch protein the effects vary depending on the repeats deleted (63). Therefore, changes in stability produced by modification of internal ANK repeats suggest that there is an evolutionary mechanism by which internal deletions minimize the loss of stability and additions or losses at the protein termini are selected.

Because of their modular structure, ANK proteins seem to be highly tolerant to insertions and deletions that affect entire repeats (55), in contrast to changes in the sequences of globular proteins, which are likely to damage the tertiary structure of entire domains (40). Protein repeat variability generally arises from recombination events, intragenic duplication, and deletions (3). It is clear that recombination mechanisms play an important role in shaping Wolbachia's genome (60), and changes in the ANK repeat protein structure through recombination of ANK genes could be a powerful driving force in the evolutionary history of Wolbachia by generating novel proteins with possible diverse functions through relatively simple mechanisms (55).

The stability of the variable ANK proteins found in different Wolbachia strains, their secretion and interaction in Drosophila, and the role that these proteins might have in (i) mediating the establishment of symbiotic associations, (ii) addressing the molecular communication between symbionts and the host cells in which they reside, and (iii) inducing or modulating the reproductive distortions induced by Wolbachia remain to be addressed. Unfortunately, functional assignment of Wolbachia's ANK genes cannot be done at present, as no genetic transformation technologies are currently available for this fastidious endosymbiont.

In summary, analysis of the unusually abundant ANK genes in the genome of Wolbachia across a number of phenotypically divergent strains has revealed considerable sequence variation in closely related bacterial strains. Correlations with phenotypes in the Drosophila host revealed a number of genes that are potential candidates for genes that are associated with the reproductive distortions generated by Wolbachia. The variation which we found in the distribution, expression, sequence, ANK domain architecture, and location, as well as the gain or loss of transmembrane domains in almost one-half of the ANK proteins in comparisons of strains that cause CI and strains that are unable to cause CI, are all factors that may affect the specificity, stability, affinity, and, consequently, function of these proteins.


    ACKNOWLEDGMENTS
 
We are very grateful to Manpreet Sidhu and Jenny Gough for technical support. We also thank Jeremy Brownlie, Wolfgang Miller, Steven Sinkins, Kevin Floate, and Elizabeth McGraw for providing constructive comments on the manuscript.

This work was supported by grants from the Australian Research Council.


    FOOTNOTES
 
* Corresponding author. Mailing address: School of Integrative Biology, The University of Queensland, St. Lucia, QLD 4072, Brisbane, Australia. Phone: 61 7 33652471. Fax: 61 7 33469213. E-mail: scott.oneill{at}uq.edu.au. Back

{dagger} Supplemental material for this article may be found at http://jb.asm.org/. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. Andersson, S. G. E., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten, U. C. M. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-140.[CrossRef][Medline]
  3. Andrade, M. A., C. Iratxeta-Perez, and C. P. Ponting. 2001. Protein repeats: structures, functions, and evolution. J Struct. Biol. 134:117-131.[CrossRef][Medline]
  4. Beard, C. B., S. L. O'Neill, R. B. Tesh, F. F. Richards, and S. Aksoy. 1993. Modification of arthropod vector competence via symbiotic bacteria. Parasitol. Today 9:179-183.[CrossRef][Medline]
  5. Bordenstein, S. R., F. P. O'Hara, and J. H. Werren. 2001. Wolbachia-induced incompatibility precedes other hybrid incompatibilities in Nasonia. Nature 409:707-710.[CrossRef][Medline]
  6. Bork, P. 1993. Hundreds of ankyrin-like repeats in functionally diverse proteins: mobile modules that cross phyla horizontally? Proteins 17:363-374.[CrossRef][Medline]
  7. Bouchon, D., T. Rigaud, and P. Juchault. 1998. Evidence for widespread Wolbachia infection in isopod crustaceans: molecular identification and host feminization. Proc. R. Soc. Lond. B Biol. Sci. 265:1081-1090.[Medline]
  8. Bourtzis, K., S. L. Dobson, H. R. Braig, and S. L. O'Neill. 1998. Rescuing Wolbachia have been overlooked. Nature 391:852-853.[CrossRef][Medline]
  9. Braig, H. R., W. Zhou, S. L. Dobson, and S. L. O'Neill. 1998. Cloning and characterization of a gene encoding the major surface protein of the bacterial endosymbiont Wolbachia pipientis. J. Bacteriol. 180:2373-2378.[Abstract/Free Full Text]
  10. Breeuwer, J. A., and J. H. Werren. 1990. Microorganisms associated with chromosome destruction and reproductive isolation between two insect species. Nature 346:558-560.[CrossRef][Medline]
  11. Breeuwer, J. A. J., and G. Jacobs. 1996. Wolbachia: intracellular manipulators of mite reproduction. Exp. Appl. Acarol. 20:421-434.[CrossRef][Medline]
  12. Caturegli, P., K. M. Asanovich, J. J. Walls, J. S. Bakken, J. E. Madigan, V. L. Popov, and J. S. Dumler. 2000. ankA: an Ehrlichia phagocytophila group gene encoding a cytoplasmic protein antigen with ankyrin repeats. Infect. Immun. 68:5277-5283.[Abstract/Free Full Text]
  13. Charlat, S., L. Le Chat, and H. Mercot. 2003. Characterization of non-cytoplasmic incompatibility inducing Wolbachia in two continental African populations of Drosophila simulans. Heredity 90:49-55.[CrossRef][Medline]
  14. Foster, J., M. Ganatra, I. Kamal, J. Ware, K. Makarova, N. Ivanova, A. Bhattacharyya, V. Kapatral, S. Kumar, J. Posfai, T. Vincze, J. Ingram, L. Moran, A. Lapidus, M. Omelchenko, N. Kyrpides, E. Ghedin, S. Wang, E. Goltsman, V. Joukov, O. Ostrovskaya, K. Tsukerman, M. Mazur, D. Comb, E. Koonin, and B. Slatko. 2005. The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode. PLoS Biol. 3:e121.[CrossRef][Medline]
  15. Giordano, R., S. L. O'Neill, and H. M. Robertson. 1995. Wolbachia infections and the expression of cytoplasmic incompatibility in Drosophila sechellia and D. mauritiana. Genetics 140:1307-1317.[Abstract]
  16. Hoffmann, A. A. 1988. Partial cytoplasmic incompatibility between two Australian populations of Drosophila melanogaster. Entomol. Exp. Appl. 48:61-67.
  17. Hoffmann, A. A., D. Clancy, and J. Duncan. 1996. A naturally-occurring Wolbachia infection in Drosophila simulans that does not cause cytoplasmic incompatibility. Heredity 76:1-8.
  18. Hoffmann, A. A., and M. Turelli. 1988. Unidirectional incompatibility in Drosophila simulans: inheritance, geographic variation and fitness effects. Genetics 119:435-444.[Abstract/Free Full Text]
  19. Hoffmann, A. A., M. Turelli, and G. M. Simmons. 1986. Unidirectional incompatibility between populations of Drosophila simulans. Evolution 40:692-701.[CrossRef]
  20. Holmes, D. S., and J. Bonner. 1973. Preparation, molecular weight, base composition, and secondary structure of giant nuclear ribonucleic acid. Biochemistry 12:2330-2338.[CrossRef][Medline]
  21. Jeyaprakash, A., and M. A. Hoy. 2000. Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol. Biol 9:393-405.[CrossRef][Medline]
  22. Laven, H. 1967. Eradication of Culex pipiens fatigans through cytoplasmic incompatibility. Nature 216:383-384.[CrossRef][Medline]
  23. Letunic, I., R. R. Copley, S. Schmidt, F. D. Ciccarelli, T. Doerks, J. Schultz, C. P. Ponting, and P. Bork. 2004. SMART 4.0: towards genomic data integration. Nucleic Acids Res. 32(Database issue):D142—D144.
  24. McGraw, E. A., D. J. Merritt, J. N. Droller, and S. L. O'Neill. 2002. Wolbachia density and virulence attenuation after transfer into a novel host. Proc. Natl. Acad. Sci. USA 99:2918-2923.[Abstract/Free Full Text]
  25. Merçot, H., B. Llorente, M. Jacques, A. Atlan, and C. Montchamp-Moreau. 1995. Variability within the Seychelles cytoplasmic incompatibility system in Drosophila simulans. Genetics 141:1015-1023.[Abstract]
  26. Merçot, H., and D. Poinsot. 1998. ...and discovered on Mount Kilimanjaro. Nature 391:853.[CrossRef][Medline]
  27. Michaely, P., and V. Bennett. 1992. The ANK repeat: a ubiquitous motif involved in macromolecular recognition. Trends Cell Biol. 2:127-129.[CrossRef][Medline]
  28. Min, K., and S. Benzer. 1997. Wolbachia, normally a symbiont of Drosophila, can be virulent, causing degeneration and early death. Proc. Natl. Acad. Sci. USA 94:10792-10796.[Abstract/Free Full Text]
  29. Mosavi, L. K., T. J. Cammett, D. C. Desrosiers, and Z. Y. Peng. 2004. The ankyrin repeat as molecular architecture for protein recognition. Protein Sci. 13:1435-1448.[Abstract/Free Full Text]
  30. Mosavi, L. K., D. L. Minor, Jr., and Z. Y. Peng. 2002. Consensus-derived structural determinants of the ankyrin repeat motif. Proc. Natl. Acad. Sci. USA 99:16029-16034.[Abstract/Free Full Text]
  31. Oh, H. W., M. G. Kim, S. W. Shin, K. S. Bae, Y. J. Ahn, and H. Y. Park. 2000. Ultrastructural and molecular identification of a Wolbachia endosymbiont in a spider, Nephila clavata. Insect Mol. Biol. 9:539-543.[CrossRef][Medline]
  32. O'Neill, S. L., R. Giordano, A. M. Colbert, T. L. Karr, and H. M. Robertson. 1992. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc. Natl. Acad. Sci. USA 89:2699-2702.[Abstract/Free Full Text]
  33. O'Neill, S. L., A. A. Hoffmann, and J. H. Werren. 1997. Influential passengers: inherited microorganisms and arthropod reproduction. Oxford University Press, Oxford, United Kingdom.
  34. O'Neill, S. L., and T. L. Karr. 1990. Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348:178-180.[CrossRef][Medline]
  35. Poinsot, D., K. Bourtzis, G. Markakis, C. Savakis, and H. Mercot. 1998. Wolbachia transfer from Drosophila melanogaster into D. simulans: host effect and cytoplasmic incompatibility relationships. Genetics 150:227-237.[Abstract/Free Full Text]
  36. Riegler, M., S. Charlat, C. Stauffer, and H. Mercot. 2004. Wolbachia transfer from Rhagoletis cerasi to Drosophila simulans: investigating the outcomes of host-symbiont coevolution. Appl. Environ. Microbiol. 70:273-279.[Abstract/Free Full Text]
  37. Rousset, F., and M. Solignac. 1995. Evolution of single and double Wolbachia symbioses during speciation in the Drosophila simulans complex. Proc. Natl. Acad. Sci. USA 92:6389-6393.[Abstract/Free Full Text]
  38. Rousset, F., D. Vautrin, and M. Solignac. 1992. Molecular identification of Wolbachia, the agent of cytoplasmic incompatibility in Drosophila simulans, and variability in relation with host mitochondrial types. Proc. R. Soc. Lond. B Biol. Sci. 247:163-168.[Medline]
  39. Rowley, S. M., R. J. Raven, and E. A. McGraw. 2004. Wolbachia pipientis in Australian spiders. Curr. Microbiol. 49:208-214.[CrossRef][Medline]
  40. Sagermann, M., W. A. Baase, and B. W. Matthews. 1999. Structural characterization of an engineered tandem repeat contrasts the importance of context and sequence in protein folding. Proc. Natl. Acad. Sci. USA 96:6078-6083.[Abstract/Free Full Text]
  41. Salzberg, S. L., J. C. Hotopp, A. L. Delcher, M. Pop, D. R. Smith, M. B. Eisen, and W. C. Nelson. 2005. Serendipitous discovery of Wolbachia genomes in multiple Drosophila species. Genome Biol. 6:R23.[CrossRef][Medline]
  42. Schultz, J., F. Milpetz, P. Bork, and C. P. Ponting. 1998. SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95:5857-5864.[Abstract/Free Full Text]
  43. Sedgwick, S. G., and S. J. Smerdon. 1999. The ankyrin repeat: a diversity of interactions on a common structural framework. Trends Biochem. Sci. 24:311-316.[CrossRef][Medline]
  44. Sharp, P. M., and W. H. Li. 1987. The codon adaptation index—a measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 15:1281-1295.[Abstract/Free Full Text]
  45. Sinkins, S. P., and S. L. O'Neill. 2000. Wolbachia as a vehicle to modify insect populations, p. 271-288. In A. M. Handler and A. A. James (ed.), Insect transgenesis: methods and applications. CRC Press, Boca Raton, Fla.
  46. Solignac, M., D. Vautrin, and F. Rousset. 1994. Widespread occurrence of the proteobacteria Wolbachia and partial cytoplasmic incompatibility in Drosophila melanogaster. C. R. Acad. Sci. Paris Sci. Ser. III Vie/Life Sci. 317:461-470.
  47. Stouthamer, R., J. A. Breeuwer, and G. D. Hurst. 1999. Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annu. Rev. Microbiol. 53:71-102.[CrossRef][Medline]
  48. Stouthamer, R., J. A. Breeuwer, R. F. Luck, and J. H. Werren. 1993. Molecular identification of microorganisms associated with parthenogenesis. Nature 361:66-68.[CrossRef][Medline]
  49. Sun, L. V., M. Riegler, and S. L. O'Neill. 2003. Development of a physical and genetic map of the virulent Wolbachia strain wMelPop. J. Bacteriol 185:7077-7084.[Abstract/Free Full Text]
  50. Swofford, D. L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4. S. Sinauer Associates, Sunderland, Mass.
  51. Taylor, M. J., and A. Hoerauf. 1999. Wolbachia bacteria of filarial nematodes. Parasitol. Today 15:437-442.[CrossRef][Medline]
  52. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.[Abstract/Free Full Text]
  53. Tram, U., P. M. Ferree, and W. Sullivan. 2003. Identification of Wolbachia-host interacting factors through cytological analysis. Microbes Infect. 5:999-1011.[CrossRef][Medline]
  54. Tram, U., and W. Sullivan. 2002. Role of delayed nuclear envelope breakdown and mitosis in Wolbachia-induced cytoplasmic incompatibility. Science 296:1124-1126.[Abstract/Free Full Text]
  55. Tripp, K. W., and D. Barrick. 2004. The tolerance of a modular protein to duplication and deletion of internal repeats. J. Mol. Biol. 344:169-178.[CrossRef][Medline]
  56. Turelli, M., and A. A. Hoffmann. 1995. Cytoplasmic incompatibility in Drosophila simulans: dynamics and parameter estimates from natural populations. Genetics 140:1319-1338.[Abstract]
  57. Turelli, M., and A. A. Hoffmann. 1999. Microbe-induced cytoplasmic incompatibility as a mechanism for introducing transgenes into arthropod populations. Insect Mol. Biol 8:243-255.[CrossRef][Medline]
  58. Werren, J. H. 1997. Biology of Wolbachia. Annu. Rev. Entomol. 42:587-609.[CrossRef][Medline]
  59. Werren, J. H., and D. M. Windsor. 2000. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proc. R. Soc. Lond. B Biol. Sci. 267:1277-1285.[Medline]
  60. Wu, M., L. V. Sun, J. Vamathevan, M. Riegler, R. Deboy, J. C. Brownlie, E. A. McGraw, W. Martin, C. Esser, N. Ahmadinejad, C. Wiegand, R. Madupu, M. J. Beanan, L. M. Brinkac, S. C. Daugherty, A. S. Durkin, J. F. Kolonay, W. C. Nelson, Y. Mohamoud, P. Lee, K. Berry, M. B. Young, T. Utterback, J. Weidman, W. C. Nierman, I. T. Paulsen, K. E. Nelson, H. Tettelin, S. L. O'Neill, and J. A. Eisen. 2004. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PloS Biol. 2:327-341.
  61. Zhang, B., and Z. Peng. 2000. A minimum folding unit in the ankyrin repeat protein p16INK4. J. Mol. Biol. 299:1121-1132.[CrossRef][Medline]
  62. Zhou, W., F. Rousset, and S. L. O'Neill. 1998. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc. R. Soc. Lond. B Biol. Sci. 265:509-515.[Medline]
  63. Zweifel, M. E., and D. Barrick. 2001. Studies of the ankyrin repeats of the Drosophila melanogaster Notch receptor. 1. Solution conformational and hydrodynamic properties. Biochemistry 40:14344-14356.[CrossRef][Medline]


Journal of Bacteriology, August 2005, p. 5136-5145, Vol. 187, No. 15
0021-9193/05/$08.00+0     doi:10.1128/JB.187.15.5136-5145.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iturbe-Ormaetxe, I.
Right arrow Articles by O'Neill, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iturbe-Ormaetxe, I.
Right arrow Articles by O'Neill, S. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]