This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Woolley, R. C.
Right arrow Articles by Fralick, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woolley, R. C.
Right arrow Articles by Fralick, J. A.

 Previous Article  |  Next Article 

Journal of Bacteriology, August 2005, p. 5500-5503, Vol. 187, No. 15
0021-9193/05/$08.00+0     doi:10.1128/JB.187.15.5500-5503.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Characterization of the Vibrio cholerae vceCAB Multiple-Drug Resistance Efflux Operon in Escherichia coli

Robin C. Woolley,1 Govindsamy Vediyappan,2 Matthew Anderson,2 Melinda Lackey,2 Bhagavathi Ramasubramanian,2 Bai Jiangping,2 Tatyana Borisova,2 Jane A. Colmer,2 Abdul N. Hamood,2 Catherine S. McVay,3 and Joe A. Fralick2*

Department of Biological Sciences, Texas Tech University, Lubbock, Texas 79409,1 Department of Microbiology and Immunology, School of Medicine, Texas Tech University Health Sciences Center, Lubbock, Texas 79430,2 Department of Biological Sciences, Auburn University, Auburn, Alabama 368493

Received 30 March 2005/ Accepted 13 May 2005


arrow
ABSTRACT
 
Herein, we identify vceC as a component of a vceCAB operon, which codes for the Vibrio cholerae VceAB multiple-drug resistance (MDR) efflux pump, and vceR, which codes for a transcriptional autoregulatory protein that negatively regulates the expression of the vceCAB operon and is modulated by some of the substrates of this MDR efflux pump.


arrow
TEXT
 
MDR efflux pumps contribute to the intrinsic and acquired antibiotic resistance in bacteria and significantly impact the emergence of drug-resistant pathogens (9, 10, 16, 18, 24, 25). These efflux systems can be amplified in resistant cells (9, 11, 17) and can alter their substrate profiles with mutation (6, 21), making them a major threat to the successful application of antibiotic therapy.

In an earlier study, we cloned a 6.6-kb DNA fragment from Vibrio cholerae (pVC2) that encoded an MDR efflux pump that functioned in an Escherichia coli tolC mutant (3). In that study, we identified two genes, vceA and vceB, that code for a membrane fusion protein (MFP) and a cytoplasmic membrane translocase (CMT), respectively. VceB belongs to the major facilitator superfamily of proton antiporters, and the VceAB pump components share homology with the E. coli EmrAB efflux MDR pump. The substrates of this pump included hydrophobic agents, such as deoxycholate (DOC), antibiotics, such as chloramphenicol and nalidixic acid, and the proton motive force uncoupler, cyanide carbonyl m-chlorophenylhydrazone (CCCP). However, we did not identify the outer membrane efflux (channel) protein (OEP) of this MDR system. In this report, we identify VceC (4) as the OEP of this pump and demonstrate that its gene resides in an operon with vceAB (i.e., vceCAB). We also identify VceR, a transcriptional autoregulatory protein that negatively regulates the expression of the vceCAB operon and whose function is modulated by some of the substrates of this MDR system.

Identification of the OEP component of vceAB MDR pump. Examination of the V. cholerae El Tor N16961 genome sequence (The Institute for Genomic Research) revealed an open reading frame (ORF) designated VC1409 (accession no. Q9KS51) which lies just upstream of vceA and codes for a putative OEP. To determine if VC1409 is essential for the functioning of the VceAB pump we examined the ability of this ORF (pVC91) to complement vceAB (pVC4) for the production of a functional VceAB pump in a tolC mutant. pVC4 has previously been described (3) and pVC91 contains the V. cholerae DNA fragment of pVC9 (3) cloned into a plasmid (pACYC184) which is compatible with pBR322 (i.e., pVC4). As expected, neither pVC4 nor pVC91 transformants could provide a tolC mutant with a functional VceAB pump. However, double transformants carrying both pVC4 and pVC91 conferred resistance to CCCP and DOC but not sodium dodecyl sulfate (SDS) or novobiocin. This substrate specificity is consistent with that of the VceAB MDR efflux pump (3) and indicates that pVC91 codes for a transacting factor(s) necessary for the functioning of VceAB. It also demonstrates that the OEP of this pump cannot replace TolC for AcrAB function (i.e., SDS and novobiocin sensitivity). To further determine that VC1409 was required for VceAB function, we conducted insertion mutagenesis analysis employing {lambda}TnphoA (13, 14, 23). Out of 55 insertions, we found 4 which did not complement pVC4 with respect to DOC and CCCP sensitivity in a tolC mutant. DNA sequence analysis indicated that they all mapped to ORF VC1409. After the completion of this study, the crystal structure of VC1409, VceC, was solved and shown to be very similar in structure to that of E. coli TolC (8) and Pseudomonas aeruginosa OprM (1).

Evidence that vceC, vceA, and vceB reside in an operon. To determine if vceC resides in an operon with vceAB, we conducted a reverse transcriptase PCR (RT-PCR) analysis of cDNA made from RNA isolated from an E. coli strain carrying pVC2. We selected a forward primer, which mapped to the 3' end of vceC, and a reverse primer, which mapped to the 5' end of vceB. The resulting RT-PCR product (Fig. 1) is consistent with that predicted from a polycistronic vceCAB transcript and indicates that vceC resides in a vceCAB MDR operon.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1. Agarose gel analysis of an RT-PCR product of vceC-vceAB polycistronic mRNA. RNA from tolC mutant carrying pVC2 was isolated and characterized by RT-PCR employing a forward primer mapping to vceC (5'-GGGGCAGTTGACTTCGGCAGAAGCTCGC) and a reverse primer which mapped to vceB (5'-CCCCTTATAAGCATAGTAGTTCCAAACAC). Lane A shows a 1-kb step ladder marker DNA; lane B shows the RT-PCR product from a reaction including the vceC-vceB primers and reverse transcriptase enzyme; lane C shows a control, the RT-PCR product from a reaction including the vceC-vceB primers without the RT enzyme.

Identification of VceR. Inspection of the V. cholerae DNA sequence in the vicinity of the vceCAB operon revealed an ORF (VC1408) which is present in pVC2 and pVC91 and lies 232 bp upstream of vceC. VC1408 codes for a hypothetical protein of 200 amino acids, which has a helix-turn-helix motif (SEQ-Web, HTH Scan) in its N-terminal region and shares significant similarities with the TetR/AcrR family of transcriptional regulators (20). To determine if VC1408 is involved in vceCAB regulation, we employed a vceA::phoA gene fusion we had previously constructed in pVC2, p1328 (3). We constructed a four-base-pair (GATC) insertion mutation in VC1408 by cutting with XbaI endonuclease, followed by a Klenow fragment (DNA polymerase) reaction and blunt-end ligation (12). This frameshift mutation resulted in a nonsense codon 51 bp from the translational start of this ORF, resulting in a putative truncated (17-amino-acid) VC1408 protein. Alkaline phosphatase activity (15) increased from 136 units, for the plasmid which coded for the wild-type VC1408 product, to 1,767 units for the VC1408 frameshift mutant. Furthermore, if we added VC1408 in trans, via pVC91, the alkaline phosphatase activity decreased to the level found with wild-type VC1408 (i.e., 189 units). These results indicate that VC1408 codes for a negatively acting transcription factor, which down-regulates the vceCAB operon. We have named this ORF vceR.

Identification of VceR binding region. Employing the NeuralNet promoter prediction website at http://www.fruitfly.org/seq_tools/promoter.html and the nucleotide sequence which lies between vceR and vceC, we identified putative promoters for vceR and the vceCAB operon. These converging promoter sequences include an imperfect 28-bp inverted repeat (IR) (TATAACTGTACGGTACGGTTTAGTTATA). To determine if VceR binds to this IR sequence, we cloned the SalI-HindIII DNA fragment from pVC91 into the pT7-6 vector (22) and specifically labeled VceR with [35S]methionine employing the T7 expression system (22) and analyzed the product by SDS-polyacrylamide gel electrophoresis and autoradiography as previously described (Fig. 2) (3). Using 35S-labeled VceR, we conducted DNA binding studies (Fig. 3). Under our assay conditions, VceR entered the gel only when the DNA contained the 28-bp IR sequence. It did not enter with a DNA molecule of comparable length that contains copies of the DNA sequences which flank the 28-bp IR sequence (flanking DNA) or a DNA molecule containing the flanking DNA sequences with an irrelevant 28-bp IR sequence.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 2. Expression of VceR from the T7 phage 10 promoter. vceR was cloned into a pT7-6 expression vector and its product labeled in the presence of T7 DNA-dependent RNA polymerase and rifampin with 35S-protein labeling mix. Labeled proteins were separated by SDS-polyacrylamide gel electrophoresis and visualized by autoradiography. Lane A shows the vector control (without the cloned VceR gene), and lane B shows the 35S-labeled VceR from a whole-cell extract. The relevant molecular size marker is indicated by an arrow.



View larger version (68K):
[in this window]
[in a new window]
  		FIG. 3. VceR binding assay. VceR was labeled by 35S-protein labeling mix (ICN, Boston, Mass.) as described in the legend to Fig. 2 and used in DNA binding studies (100,000 cpm/sample). In panel A, three different DNA molecules were employed as follows: lane 1, no DNA; lane 2, 5 pM of a double-stranded DNA (dsDNA) molecule containing the 28-bp IR and flanking sequences; lane 3, 5 pM of a dsDNA molecule containing copies of the DNA sequences flanking the 28-bp IR sequence used in lane 2; and lane 4, 5 pM of a dsDNA molecule containing an irrelevant 28-bp IR sequence. The samples were separated on a 5% Tris-borate-EDTA acrylamide gel and 35S-VceR visualized employing a PhosphorImager (Molecular Dynamics). The sequences of the dsDNA molecules employed in this study are given below. The IR sequences are italicized and the flanking sequences bracketed. Lane 2, [TCTGTCAAGAG]TATAACTGTACGGTACGGTTTAGTTATA[AGGTTTTCAAG]; lane 3, [CTGTCAAGAG][CTGTCAAGAG][CTGTCAAG][AGGTTTTCAAG][AGGTTTTCAAG][AGGTTT]; lane 4, [CTGTCAAGAG]CGGATGCTGAAACCGGTTTCAGCATCCG[AGGTTTTCAAG]. In panel B, a constant amount of 35S-VceR was used in each binding assay (100,000 cpm) and the dsDNA was that used in lane 2 of panel A. The concentrations of the DNA added to the binding mix were as follows: lane 1, 0 fM; lane 2, 2.5 fM; lane 3, 25 fM; lane 4, 250 fM; lane 5, 2,500 fM; lane 6, 5,000fM; and lane 7, 25,000 fM. The samples were separated on a 5% Tris-borate-EDTA acrylamide gel and 35S-VceR visualized employing a PhosphorImager. Locations of 35S-VceR are indicated by arrows.

We have also examined the influence of DNA concentration on this binding (Fig. 3B). The relative amount of VceR that entered the gel was dependent on DNA concentration. Further, as the ratio of VceR to DNA decreased (i.e., DNA concentration increased), we saw that the labeled VceR went from a higher-molecular-weight band to a lower-molecular-weight band in the gel. At an intermediate DNA concentration, we detected VceR at both molecular weights. A possible interpretation of these results is that this IR sequence contains two VceR binding sites. Hence, when the VceR-to-DNA ratio was high, both sites were occupied with VceR, resulting in the species with higher molecular weight, whereas when the VceR-to-DNA ratio was low, only one of the two sites was occupied by VceR, resulting in the species with lower molecular weight.

Evidence that VceR is an autoregulator. It has been shown that salicylate (SAL) is a substrate for the VceCAB MDR efflux pump and up-regulates the expression of vceA (unpublished results; 19). To determine if VceR is an autoregulator, we examined the expression levels of VceC, VceA, and VceR in the presence and absence of salicylate by Western blot analysis. We found that all three proteins were up-regulated in the presence of SAL (Fig. 4). We have also found that CCCP, another substrate of this MDR pump, up-regulates VceC, VceA, and VceR and that this up-regulation occurs in a marA mutant (AG100K) (5) (data not shown).



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 4. Effect of salicylate on the expression of VceC and VceA and VceR. Whole-cell proteins of tolC mutant cells carrying pVC2 and growing in the presence (lane 2) or absence (lane 1) of salicylate (5 mM) were separated on a 10% (A and B) or 15% (C) SDS-polyacrylamide gel and transferred to polyvinylidene difluoride membranes and detected with anti-VceC (A), anti-VceA (B), or anti-VceR (C) antibodies.

In summary, we have identified the OEP of the VceAB MDR efflux complex, VceC, and demonstrated that its gene resides in an operon with vceAB. We have found that this MDR operon is negatively regulated by an autoregulator, VceR, which binds to an IR sequence located between vceR and vceC. We have also presented evidence that a substrate of this efflux pump (SAL) is involved in the up-regulation of the expression of vceCAB as well as vceR. Such a regulatory scheme would allow for a rapid response to small alterations in the concentrations of effectors (substrates), which modulate the expression of this pump. A cartoon of the vce locus illustrating the location of vceR, the 28-bp IR sequence, and the vceCAB MDR operon is given in Fig. 5.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 5. The vce locus. The relative locations of vceC, vceA, vceB, and vceR and their directions of transcription (arrows), as well as a 28-bp IR DNA sequence to which VceR binds, are shown.

Genes which code for the CMT and MFP components of MDR pumps invariably reside in an operon, while those which code for the OEP component may or may not be included (7). There also appears to be a gene order to these MDR operons in which the gene coding for the MFP is first, followed by that for the CMT, and, if present, the gene encoding OEP is last (7). We have found that vceC resides in an operon with vceAB, but unlike other characterized MDR operons, it is the first rather than the last gene. The significance of this gene order is not known; however, theoretically it could play a role in a regulation hierarchy, allowing the cell to regulate the OEP partner of VceAB. We have found that VceAB can use OEPs other than VceC (e.g., E. coli TolC and the Yersinia pestis TolC homologue) (unpublished results), and it has been recently shown that the MexJK MDR efflux pump of P. aeruginosa uses two different OEPs depending upon its substrate (2). It should also be pointed out that vceA and vceB are expressed independently of vceC in cells carrying pVC4. It will be important to further characterize the regulation and function of this MDR efflux system in V. cholerae and determine its role in the pathogenicity of this very important microbe.


arrow
ACKNOWLEDGMENTS
 
We thank Joe Bass for his excellent technical assistance.

This research was supported in part by a Howard Hughes Medical Institute grant through the Undergraduate Biological Sciences Education Program to Texas Tech University and grant AI48696 from the National Institutes of Health.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, School of Medicine, Texas Tech University Health Sciences Center, Lubbock, TX 79430. Phone: (806) 743-2555. Fax: (806) 743-2334. E-mail: joe.fralick{at}ttuhsc.edu. Back


arrow
REFERENCES
 
    1
  1. Akama, H., M. Kanemaki, M. Yoshimura, T. Tsukihara, T. Kashiwagi, H. Yoneyama, S. Narita, A. Nakagawa, and T. Nakae. 2004. Crystal structure of the drug discharge outer membrane protein, OprM, of Pseudomonas aeruginosa: dual modes of membrane anchoring and occluded cavity end. J. Biol. Chem. 279:52816-52819.[Abstract/Free Full Text]
    2. 2
  2. Chuanchuen, R., T. Murata, N. Gotoh, and H. P. Schweizer. 2005. Substrate-dependent utilization of OprM or OpmH by the Pseudomonas aeruginosa MexJK efflux pump. Antimicrob. Agents Chemother. 49:2133-2136.[Abstract/Free Full Text]
    3. 3
  3. Colmer, J. A., J. A. Fralick, and A. N. Hamood. 1998. Isolation and characterization of a putative multidrug resistance pump from Vibrio cholerae. Mol. Microbiol. 27:63-72.[CrossRef][Medline]
    4. 4
  4. Federici, L., D. Du, F. Walas, H. Matsumura, J. Fernandez-Recio, K. S. McKeegan, M. I. Borges-Walmsley, B. F. Luisi, and A. R. Walmsley. 2005. The crystal structure of the outer membrane protein VCEC from the bacterial pathogen Vibrio cholerae at 1.8 A resolution. J. Biol. Chem. 280:15307-15314.
    5. 5
  5. Fralick, J. A. 1996. Evidence that TolC is required for functioning of the Mar/AcrAB efflux pump of Escherichia coli. J. Bacteriol. 178:5803-5805.[Abstract/Free Full Text]
    6. 6
  6. Gottesman, M. M., and I. Pastan. 1993. Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu. Rev. Biochem. 63:385-427.[CrossRef]
    7. 7
  7. Grkovic, S., M. H. Brown, and R. A. Skurray. 2002. Regulation of bacterial drug export systems. Microbiol. Mol. Biol. Rev. 66:671-701.[Abstract/Free Full Text]
    8. 8
  8. Koronakis, V., A. Sharff, E. Koronakis, B. Luisi, and C. Hughes. 2000. Crystal structure of the bacterial membrane protein TolC central to multidrug efflux and protein export. Nature 405:914-919.[CrossRef][Medline]
    9. 9
  9. Levy, S. D. 1992. Active efflux mechanisms for antimicrobial resistance. Antimicrob. Agents Chemother. 36:695-703.[Free Full Text]
    10. 10
  10. Lewis, K. 1994. Multidrug resistance pumps in bacteria: variations on a theme. Trends Biochem. Sci. 19:119-123.[CrossRef][Medline]
    11. 11
  11. Ma, D., M. Alberti, C. Lynch, H. Nikaido, and J. E. Hearst. 1996. The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia coli by global stress signals. Mol. Microbiol. 19:101-112.[CrossRef][Medline]
    12. 12
  12. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
    13. 13
  13. Manoil, C. 1991. Analysis of membrane protein topology using alkaline phosphatase and beta-galactosidase gene fusions. Methods Cell Biol. 34:61-75.[Medline]
    14. 14
  14. Manoil, C., and J. Beckwith. 1985. TnphoA: a transposon probe for protein export signals. Proc. Natl. Acad. Sci. USA 82:8129-8133.[Abstract/Free Full Text]
    15. 15
  15. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
    16. 16
  16. Nikaido, H. 1996. Multidrug efflux pumps of gram-negative bacteria. J. Bacteriol. 178:5853-5859.[Free Full Text]
    17. 17
  17. Ohshita, Y., K. Hiramatsu, and T. Yokota. 1990. A point mutation in the norA gene is responsible for quinolone resistance in Staphylococcus aureus. Biochem. Biophys. Res. Commun. 172:1028-1034.[CrossRef][Medline]
    18. 18
  18. Pool, K., D. E. Krebes, C. McNally, and S. Neshat. 1993. Multiple antibiotic resistance in Pseudomonas aeruginosa: evidence for involvement of an efflux operon. J. Bacteriol. 175:7363-7372.[Abstract/Free Full Text]
    19. 19
  19. Ramasubramanian, B. 2004. The regulation of Vibrio cholerae MDR efflux pump in a tolC mutant of Escherichia coli. M.S. thesis. Department of Microbiology and Immunology, Texas Tech University School of Biomedical Sciences, Lubbock, Tex.
    20. 20
  20. Saenger, W., P. Orth, C. Kisker, W. Hillen, and W. Hinrichs. 2000. The tetracycline repressor-A paradigm for a biological switch. Angew. Chem. Int. Ed. Engl. 39:2042-2052.[CrossRef][Medline]
    21. 21
  21. Shafer, W. M., J. T. Balthazar, K. E. Hagman, and S. A. Morse. 1995. Missense mutations that alter the DNA-binding domain of the MtrR protein occur frequently in rectal isolates of Neisseria gonorrhoeae that are resistant to fecal lipids. Microbiology 141:907-911.[Abstract/Free Full Text]
    22. 22
  22. Tabor, S., and C. Richardson. 1985. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Natl. Acad. Sci. USA 92:1074-1078.
    23. 23
  23. Wilmes-Riesenberg, M. R., and B. L. Wanner. 1992. TnphoA and TnphoA' elements for making and switching fusions for study of transcription, translation, and cell surface localization. J. Bacteriol. 174:4558-4575.[Abstract/Free Full Text]
    24. 24
  24. Zgurskaya, H. I., and H. Nikaido. 2000. Multidrug resistance mechanisms: drug efflux across two membranes. Mol. Microbiol. 37:219-225.[CrossRef][Medline]
    25. 25
  25. Zgurskaya, H. I. 2002. Molecular analysis of efflux pump-based antibiotic resistance. Int. J. Med. Microbiol. 292:95-105.[CrossRef][Medline]

Journal of Bacteriology, August 2005, p. 5500-5503, Vol. 187, No. 15
0021-9193/05/$08.00+0     doi:10.1128/JB.187.15.5500-5503.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Shintani, M., Urata, M., Inoue, K., Eto, K., Habe, H., Omori, T., Yamane, H., Nojiri, H. (2007). The Sphingomonas Plasmid pCAR3 Is Involved in Complete Mineralization of Carbazole. J. Bacteriol. 189: 2007-2020 [Abstract] [Full Text]  
  • Vediyappan, G., Borisova, T., Fralick, J. A. (2006). Isolation and Characterization of VceC Gain-of-Function Mutants That Can Function with the AcrAB Multiple-Drug-Resistant Efflux Pump of Escherichia coli. J. Bacteriol. 188: 3757-3762 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Woolley, R. C.
Right arrow Articles by Fralick, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woolley, R. C.
Right arrow Articles by Fralick, J. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»