JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cuñé, J.
Right arrow Articles by Barbe, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cuñé, J.
Right arrow Articles by Barbe, J.
Journal of Bacteriology, August 2005, p. 5841-5845, Vol. 187, No. 16
0021-9193/05/$08.00+0     doi:10.1128/JB.187.16.5841-5845.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The Leptospira interrogans lexA Gene Is Not Autoregulated

Jordi Cuñé,1 Paul Cullen,2 Gerard Mazon,3 Susana Campoy,3 Ben Adler,2 and Jordi Barbe1,3*

Department of Genetics and Microbiology, Universitat Autònoma de Barcelona, Bellaterra, 08193 Barcelona, Spain,1 Australian Bacterial Pathogenesis Program, Department of Microbiology, Monash University, Victoria 3800, Australia,2 Centre de Recerca en Sanitat Animal, Bellaterra, 08193 Barcelona, Spain3

Received 17 March 2005/ Accepted 30 May 2005


    ABSTRACT
 Top
 Abstract
 Text
 References
 
Footprinting and mutagenesis experiments demonstrated that Leptospira interrogans LexA binds the palindrome TTTGN5CAAA found in the recA promoter but not in the lexA promoter. In silico analysis revealed that none of the other canonical SOS genes is under direct control of LexA, making the leptospiral lexA gene the first described which is not autoregulated.


    TEXT
 Top
 Abstract
 Text
 References
 
Genome integrity in bacterial cells depends on their DNA repair ability. In free-living bacterial species, many environmental factors, such as UV radiation, chemical compounds, and some antibiotics, can produce chromosomal lesions. DNA from pathogenic bacteria may be also affected by several host factors (e.g., oxygen and iron concentration). Likewise, metabolic endogenous compounds can also cause damage to bacterial DNA. For these reasons, bacterial cells possess several pathways involved in DNA repair. Despite the fact that most of them target specific kinds of DNA lesions (e.g., oxidative damage or presence of alkyl radicals in DNA), a global DNA damage response, known as the SOS system, is present in many bacterial species. This system facilitates cell survival when massive DNA damage occurs and the normal DNA replication of the bacterial cell is disturbed (20). Genes belonging to the SOS system are directly repressed by the LexA protein, which has two clearly differentiated domains: the N-terminal domain, which specifically recognizes the operator (known as the SOS box) at which it binds, and the C-terminal one containing the amino acids Ser and Lys involved in the autocatalytic cleavage which takes place between Ala-Gly residues (12). In the absence of DNA damage, LexA binds the SOS box present in the promoter region of the SOS genes, thereby blocking their transcription. Different sequences for the SOS box, which seems to be conserved for each bacterial evolutionary division, have been described (4, 5, 21). Conversely, in the event of DNA damage, the product of the bacterial recA gene acquires an active conformation after binding to single-stranded DNA fragments generated either by DNA damage-mediated replication inhibition or by enzymatic processing of broken DNA ends (18). Upon activation, the RecA protein promotes autocatalytic cleavage of the LexA repressor through a mechanism similar to that observed for serine proteases (11), thus initiating a global induction of the SOS response. After DNA lesions have been repaired, activated RecA protein concentration declines and noncleaved LexA returns to its usual levels, inhibiting again the expression of SOS genes. In all bacterial species studied so far, the product of the lexA gene also regulates its own transcription. On the other hand, the recA gene is not always under the negative control of the LexA protein (8).

Spirochetes are helically coiled, gram-negative bacteria present in many microhabitats and may be free living, commensal, or parasitic. This bacterial order is important because of its many pathogenic species but also because of the role that the serial endosymbiotic theory has assigned to these organisms in the origin of the eukaryotic cell (13). The genome sequences of several spirochetes have been reported: Borrelia burgdorferi, Treponema pallidum, Treponema denticola, and Leptospira interrogans (6, 7, 15, 17, 19). Among them, only L. interrogans has a gene whose deduced product shows both DNA-binding and serine-protease domains compatible with those of a LexA-like protein structure. Importantly, other regulatory proteins, such as prophage and integrating-conjugative-element repressors, may also display a serine protease-like domain (1, 16). Then, when bacterial genome sequences are analyzed in silico, some of these other regulatory genes may be inappropriately annotated as lexA. In the present work, the putative L. interrogans lexA gene was cloned and its protein product purified to determine if it is actually a LexA repressor, as well as to further understand the evolution of the LexA regulon in spirochetes.

Characterization of the transcriptional organization of the L. interrogans lexA gene. To determine the component genes of a bacterial regulon, the sequence to which any regulatory proteins bind must first be identified. All LexA proteins from bacterial species analyzed so far are able to regulate directly their own transcription, even in polycistronic transcriptional units. Analysis of the L. interrogans serovar Lai genome region containing the putative lexA gene revealed two open reading frames (LA1445 and LA1446) upstream of the lexA gene (Fig. 1A).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 1. (A) Genetic organization of the L. interrogans lexA gene region. The sizes of the fragments (F.1 to F.4) obtained with several primers used are indicated. (B) RT-PCR analysis of putative transcripts covering regions F.1 to F.4 in L. interrogans (RNA-RT-PCR). As controls, PCR experiments were carried out with the same primers, but without reverse transcriptase, with either RNA (RNA-PCR) or DNA (DNA-PCR) as a template. The positions of standard DNA size markers are shown on the left.

 
In order to establish the genomic region in which the L. interrogans LexA box might be located, it was necessary to test if these three genes were cotranscribed. To perform this, reverse transcriptase (RT) PCR analysis of total RNA from L. interrogans serovar Lai cells, grown in EMJH medium, was carried out as described previously (3) with a set of appropriate oligonucleotide primers based on the L. interrogans sequence (17) designed to amplify fragments of suitable size in the event that lexA-LA1446 or lexA-LA1446-LA1445 was transcriptionally linked (Fig. 1A). Data showed that transcription of the L. interrogans lexA gene is not linked with that of LA1445 or LA1446 (Fig. 1B). On the other hand, LA1445 and LA1446 open reading frames constitute a single transcriptional unit (Fig. 1B).

Identification of the L. interrogans LexA binding sequence. Results described above allowed us to conclude that a putative L. interrogans LexA box might be located between the end of LA1446 and the beginning of lexA. To confirm this, the L. interrogans lexA gene was amplified by PCR using a forward primer (NdeI-lexA) containing an NdeI restriction site which incorporated the lexA ATG start codon. The reverse primer (BamHI-lexA) started 30 bp downstream of the lexA stop codon. The 659-bp PCR fragment containing the L. interrogans lexA gene was cloned into pGEM-T and then into the pET15b expression vector. The pET15b derivative containing the lexA gene was transformed into the Escherichia coli BL21(DE3) CodonPlus strain for overexpression of the LexA protein, which was subsequently purified using the Talon metal affinity resin kit (Clontech) as described previously (14). The purity of the LexA protein was >95% as determined with Coomassie blue staining of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (15%) gels (data not shown) following standard methodology (10).

Likewise, and using LpLexAup (5'-CGAAACGGAAAACTAAAACCG-3') and LpLexAdwn (5'-CTCAATTGCTTTGAGATGATC-3') primers, a 490-bp fragment containing the region upstream of lexA and 202 nucleotides of the 3' end of LA1446 was obtained. When this fragment was used in electrophoretic mobility shift assay experiments with purified L. interrogans LexA protein, no specific shift in electrophoretic mobility was detected (Fig. 2A).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2. (A) Electrophoretic mobilities of the lexA and recA promoter regions in the absence (–) or presence (+) of 40 ng of purified L. interrogans LexA protein. The effect of a 300-fold molar excess of unlabeled recA (PrecA) or lexA (PlexA) promoter regions as well as of nonspecific DNA on the electrophoretic mobility of the recA promoter region is also shown. (B) Effect of a 300-fold molar excess of unlabeled LA1445 or LA1446 promoters on the electrophoretic mobility of the recA promoter in the presence (+) of 40 ng of purified L. interrogans LexA protein. As controls, the mobilities of the recA promoter in the absence (–) of LexA protein or in its presence with and without the unlabeled recA promoter are also shown.

 
Since transcription of many bacterial recA genes is negatively regulated by LexA, we analyzed whether the L. interrogans recA region binds leptospiral LexA. Figure 2B indicates that the L. interrogans LexA protein binds to a 225-bp fragment containing the upstream region of recA. This DNA-protein interaction is specific because it was abolished by an excess of unlabeled L. interrogans recA promoter but not when an excess of nonspecific DNA was added (Fig. 2A). Likewise, and in accordance with data presented above, the presence of unlabeled L. interrogans lexA promoter region did not eliminate this DNA-LexA complex (Fig. 2A).

A possible explanation for the negative results obtained in the RT-PCR analysis (Fig. 1A) concerning the transcriptional organization of the leptospiral lexA gene could be a consequence of a dramatically low basal expression of this gene. If this were the case, a leptospiral LexA box could still be present upstream of either LA1445 or LA1446. To test this possibility, two unlabeled DNA fragments, containing the region upstream of either LA1445 or LA1446, were used as competitors against the LexA-recA promoter region mixture. Results showed that neither region inhibited the binding of LexA to the recA promoter, consistent with the absence of a leptospiral LexA box upstream of these two open reading frames (Fig. 2B). All these data supported the conclusion that the L. interrogans lexA gene is not autoregulated but that it does encode a LexA repressor because, as described for many other LexA proteins, its product is able to bind the recA gene promoter region.

The sequence to which the L. interrogans LexA protein binds was localized precisely through footprinting experiments with the recA promoter region using the ALF sequencer (Pharmacia Biotech) as described previously (2). The results showed that a core region of 20 nucleotides (AATTTTTGCTATACAAATAC), centered at the –206 position with respect to the hypothetical translational start point of recA, was protected when both coding and noncoding strands of this gene were analyzed (Fig. 3). Inspection of this sequence revealed the presence of a perfect palindrome whose left and right halves are TTTG and CAAA, respectively.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. DNase I footprinting assay with coding and noncoding Cy5-labeled strands of the DNA fragment containing the L. interrogans recA promoter in the absence (–LexA) or in the presence (+LexA) of purified LexA. The translational start codon is shown in italics and underlined. The palindrome contained in the protected sequence is indicated in bold and underlined.

 
To confirm the footprinting results and to determine if this palindrome is the sequence recognized by the leptospiral LexA, point mutations were introduced into each of the nucleotides, as well as in immediate flanking regions. Directed mutagenesis of the L. interrogans recA promoter was carried out by PCR as described previously (2), and the presence of DNA changes was confirmed by sequencing on an ALF sequencer (Pharmacia Biotech). The results showed that leptospiral LexA binding requires both halves of the palindrome, since mutagenesis of nucleotides in either half diminished the formation of the DNA-LexA complex (Fig. 4). As expected, no copy of this palindrome was found upstream of the L. interrogans lexA gene when a search using the RCGScanner informatics program (4) was carried out. Furthermore, none of the other L. interrogans canonical genes belonging to the bacterial SOS system (uvrAB, ruvAB, ssb, and recN) (4, 5) have a copy of the TTTGN5CAAA palindrome in their promoter regions, indicating that the only gene directly regulated by the LexA repressor in this organism is recA. Moreover, analysis of the recently sequenced genome of L. interrogans Copenhageni Fiocruz L1-130 (15), a strain different from that studied in this work, also shows the presence of the TTTGN5CAAA palindrome upstream of recA but not upstream of lexA.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 4. Single-nucleotide substitutions in the TTTGCTATACAAA palindrome and their effect on the electrophoretic mobility of the L. interrogans recA promoter region in the presence of purified LexA. The mobility of the wild-type L. interrogans recA promoter region in the absence (–) or presence (+) of LexA is also shown.

 
The fact that only the recA gene is under the direct control of LexA in L. interrogans could indicate an intermediary stage in the process of genomic reduction which seems to occur in spirochetes. Thus, the presence of a lexA gene in L. interrogans appears to be an evolutionary step prior to the loss of this gene in pathogenic spirochetes such as T. pallidum, T. denticola, and B. burgdorferi, whose genomes are significantly smaller than that of L. interrogans. Furthermore, it must be noted that the absence of a lexA gene in these three spirochetes may increase their fitness against the continuous DNA damaging host defense factors because they exhibit constitutive expression of genes belonging to the recombinational DNA repair pathway (recA, ruvAB, and recN), which is the principal mechanism for DNA damage repair in chromosomes of pathogenic bacteria (9).


    ACKNOWLEDGMENTS
 
This work was funded by grants BFU2004-02768/BMC from the Ministerio de Educación y Ciencia de España and 2001SGR-206 from the Departament d'Universitats, Recerca i Societat de la Informació de la Generalitat de Catalunya and by a program grant from the National Health and Medical Research Council, Canberra, Australia. J. Cuñé was recipient of a predoctoral fellowship from the Ministerio de Educación y Cultura, and S. Campoy is recipient of a postdoctoral contract from INIA-IRTA.

We are deeply indebted to Joan Ruiz and Pilar Cortés for their excellent technical assistance.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Genetics and Microbiology, Universitat Autònoma de Barcelona, Bellaterra, 08193 Barcelona, Spain. Phone: 34-93-581 1837. Fax: 34-93-581 2387. E-mail: jordi.barbe{at}uab.es. Back


    REFERENCES
 Top
 Abstract
 Text
 References
 

  1. Beaber, J. W., B. Hochhut, and M. K. Waldor. 2004. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature 427:72-74.[CrossRef][Medline]
  2. Campoy, S., M. Fontes, S. Padmanabhan, P. Cortes, M. Llagostera, and J. Barbe. 2003. LexA-independent DNA damage-mediated induction of gene expression in Myxococcus xanthus. Mol. Microbiol. 49:769-781.[CrossRef][Medline]
  3. Cullen, P. A., S. J. Cordwell, D. M. Bulach, D. A. Haake, and B. Adler. 2002. Global analysis of outer membrane proteins from Leptospira interrogans serovar Lai. Infect. Immun. 70:2311-2318.[Abstract/Free Full Text]
  4. Erill, I., M. Escribano, S. Campoy, and J. Barbé. 2003. In silico analysis reveals substantial variability in the gene contents of the gamma Proteobacteria LexA-regulon. Bioinformatics 19:2225-2236.[Abstract/Free Full Text]
  5. Erill, I., M. Jara, N. Salvador, M. Escribano, S. Campoy, and J. Barbé. 2004. Differences in LexA regulon structure among Proteobacteria through in vivo assisted comparative genomics. Nucleic Acids Res. 32:6617-6626.[Abstract/Free Full Text]
  6. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, et al. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586.[CrossRef][Medline]
  7. Fraser, C. M., S. J. Norris, G. M. Weinstock, O. White, G. G. Sutton, et al. 1998. Complete sequence of Treponema pallidum, the syphilis spirochete. Science 281:375-388.[Abstract/Free Full Text]
  8. Jara, M., C. Nuñez, S. Campoy, A. R. Fernández de Henestrosa, D. R. Lovley, and J. Barbé. 2003. Geobacter sulfurreducens has two autoregulated lexA genes whose products do not bind the recA promoter: differing responses of lexA and recA to DNA damage. J. Bacteriol. 185:2493-2502.[Abstract/Free Full Text]
  9. Kline, K. A., E. V. Sechman, E. P. Skaar, and H. S. Seifert. 2003. Recombination, repair and replication in the pathogenic Neisseria: the 3 R's of molecular genetics of two human-specific bacterial pathogens. Mol. Microbiol. 50:3-13.[CrossRef][Medline]
  10. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  11. Little, J. W. 1991. Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease. Biochimie 73:411-421.[Medline]
  12. Luo, Y., R. A. Pfuetzner, S. Mosimann, M. Paetzel, E. A. Frey, M. Cherney, B. Kim, J. W. Little, and N. C. Strynadka. 2001. Crystal structure of LexA: a conformational switch for regulation of self-cleavage. Cell 106:585-594.[CrossRef][Medline]
  13. Margulis, L. 1996. Archaeal-eubacterial mergers in the origin of Eukarya: phylogenetic classification of life. Proc. Natl. Acad. Sci. USA 93:1071-1076.[Abstract/Free Full Text]
  14. Mazon, G., J. M. Lucena, S. Campoy, A. R. Fernández de Henestrosa, P. Candau, and J. Barbé. 2003. LexA-binding sequences in gram-positive and cyanobacteria are closely related. Mol. Gen. Genomics 271:40-49.
  15. Nascimiento, A. L., A. I. Ko, E. A. Martins, C. B. Monteriro-Vitorello, et al. 2004. Comparative genomics of two Leptospira interrogans serovars reveals novel insights into physiology and pathogenesis. J. Bacteriol. 186:2164-2172.[Abstract/Free Full Text]
  16. Pabo, C. O., R. T. Sauer, J. M. Sturtevant, and M. Ptashne. 1979. The {lambda} repressor contains two domains. Proc. Natl. Acad. Sci. USA 76:1608-1612.[Abstract/Free Full Text]
  17. Ren, S. X., G. Fu, X. G. Jiang, R. Zeng, Y. G. Miao, H. Xu, Y. X. Zhang, et al. 2003. Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing. Nature 422:888-893.[CrossRef][Medline]
  18. Sassanfar, M., and J. W. Roberts. 1990. Nature of SOS-inducing signal in Escherichia coli. The involvement of DNA replication. J. Mol. Biol. 212:79-96.[CrossRef][Medline]
  19. Seshadri, R., G. S. Myers, H. Tettelin, J. A. Eisen, J. F. Heidelberg, et al. 2004. Comparison of the genome of the oral pathogen Treponema denticola with other spirochete genomes. Proc. Natl. Acad. Sci. USA 101:5646-5651.[Abstract/Free Full Text]
  20. Walker, G. C. 1984. Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli. Microbiol. Rev. 48:60-93.[Free Full Text]
  21. Winterling, K. W., D. Chafin, J. J. Hayes, J. Sun, A. S. Levine, R. E. Yasbin, and R. Woodgate. 1998. The Bacillus subtilis DinR binding site: redefinition of the consensus sequence. J. Bacteriol. 180:2201-2211.[Abstract/Free Full Text]


Journal of Bacteriology, August 2005, p. 5841-5845, Vol. 187, No. 16
0021-9193/05/$08.00+0     doi:10.1128/JB.187.16.5841-5845.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cuñé, J.
Right arrow Articles by Barbe, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cuñé, J.
Right arrow Articles by Barbe, J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS