JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dubern, J.-F.
Right arrow Articles by Bloemberg, G. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dubern, J.-F.
Right arrow Articles by Bloemberg, G. V.
Journal of Bacteriology, September 2005, p. 5967-5976, Vol. 187, No. 17
0021-9193/05/$08.00+0     doi:10.1128/JB.187.17.5967-5976.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The Heat Shock Genes dnaK, dnaJ, and grpE Are Involved in Regulation of Putisolvin Biosynthesis in Pseudomonas putida PCL1445

Jean-Frédéric Dubern, Ellen L. Lagendijk, Ben J. J. Lugtenberg, and Guido V. Bloemberg*

Leiden University, Institute of Biology, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands

Received 5 April 2005/ Accepted 18 June 2005


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pseudomonas putida PCL1445 produces two cyclic lipopeptides, putisolvins I and II, which possess surfactant activity and play an important role in biofilm formation and degradation. In order to identify genes and traits that are involved in the regulation of putisolvin production of PCL1445, a Tn5luxAB library was generated and mutants were selected for the lack of biosurfactant production using a drop-collapsing assay. Sequence analysis of the Tn5luxAB flanking region of one biosurfactant mutant, strain PCL1627, showed that the transposon had inserted in a dnaK homologue which is located downstream of grpE and upstream of dnaJ. Analysis of putisolvin production and expression studies indicate that dnaK, together with the dnaJ and grpE heat shock genes, takes part in the positive regulation (directly or indirectly) of putisolvin biosynthesis at the transcriptional level. Growth of PCL1445 at low temperature resulted in an increased level of putisolvins, and mutant analyses showed that this requires dnaK and dnaJ but not grpE. In addition, putisolvin biosynthesis of PCL1445 was found to be dependent on the GacA/GacS two-component signaling system. Expression analysis indicated that dnaK is positively regulated by GacA/GacS.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Lipopeptides are produced by members of the genera Bacillus, Serratia, Burkholderia, and Pseudomonas. Lipopeptides are nonribosomally synthesized via multifunctional proteins, which are encoded by large gene clusters (3, 43, 46). Lipopeptides produced by Pseudomonas have been reported as agents for biocontrol of phytopathogenic fungi (35) or as phytotoxins (18). Lipopeptides produced by gram-positive Bacillus play a role in bacterial attachment to surfaces (34). Lipopeptides produced by Serratia (29) and Burkholderia (16) were shown to be essential for the stimulation of swarming motility and thus could contribute to the regulation of biofilm formation (16).

Lipopeptides function as biosurfactants (7) by stimulating swarming motility (26, 29), facilitating bacterial growth on water-insoluble carbon sources (40), or by altering the cell surface hydrophobicity and therefore influencing the interaction between the individual cells (40). However, the significance of lipopeptides for growth and survival of rhizobacteria remains unkown. The regulation of lipopeptides in soil Pseudomonas is poorly understood. The GacA/GacS two-component regulatory system was shown to control regulation of lipopeptides syringomycin (15), and lipopeptides of Pseudomonas sp. strain DSS73 (22). Whether the gac system controls directly the lipopeptide biosynthesis remains to be investigated as, to our knowledge, no intermediate involved in this regulation has been identified.

Pseudomonas putida PCL1445 was isolated from soil heavily polluted with polyaromatic hydrocarbons (24) and produces two surface-active compounds, putisolvin I and putisolvin II, which have been identified as cyclic lipopeptides (26). They represent a new class of lipodepsipeptides consisting of 12 amino acids linked to a hexanoic lipid chain. Strain PCL1445 produces putisolvin I and II via a putisolvin synthetase (26), later designated as psoA.

Putisolvins I and II have important functions for PCL1445 as they were shown (i) to reduce the surface tension of the medium, (ii) to increase the formation of an emulsion with toluene, (iii) to stimulate swarming motility, and (iv) to inhibit biofilm formation and to degrade existing biofilms (26).

Putisolvins are not constitutively produced. Surfactant activity appeared in the culture medium at the end of the exponential growth phase (26). The aim of the present work was to identify and characterize genes that are involved in the regulation of lipopeptide production and to investigate their function. To this end we generated a Tn5luxAB library of PCL1445 and screened for mutants defective in biosurfactant production using a drop-collapsing assay. We analyzed one biosurfactant mutant in detail. Its transposon appeared to be integrated in a dnaK homolog, encoding a heat shock protein. DnaK, DnaJ, and GrpE chaperones have been described to form the central regulatory system of the heat shock response in Escherichia coli (9, 17, 37). In this paper, we describe the analysis of the function of dnaK, dnaJ, and grpE in putisolvin biosynthesis, as well as their roles at different temperatures.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Bacterial strains and growth conditions. All bacterial strains used are listed in Table 1. Pseudomonas strains were grown in King's medium B (KB) (21) at 28°C under vigorous shaking (190 rpm). E. coli strains were grown in Luria-Bertani medium (41) at 37°C under vigorous shaking. Media were solidified with 1.8% agar (Select Agar; Invitrogen, Life Technologies, Paisley, United Kingdom). The antibiotics kanamycin, tetracycline, gentamicin, and carbenicillin were added, when necessary, to final concentrations of 50, 40, 2, and 100 µg ml–1, respectively.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Bacterial strains and plasmids used in this study

 
Generation, selection, and characterization of mutants defective in biosurfactant production. Transposon mutants were generated by triparental mating using pRL1063a, which harbors a Tn5 transposon carrying the promoterless luxAB reporter genes (48), and the helper plasmid pRK2013 (42). Transposants were initially screened for the decreased ability to flatten a droplet of water on Parafilm using cells of a single colony as described below. Culture supernatants of the selected mutants, obtained after growth overnight in King's B (KB) medium, were analyzed for the presence of surfactant production using the drop-collapsing assay.

To isolate the DNA region flanking the Tn5, total genomic DNA was isolated and digested with EcoRI, which does not cut pRL1063a. Digested genomic DNA fragments were recirculated and selected for kanamycin resistance, resulting in plasmids containing genomic DNA regions flanking the Tn5luxAB. All DNA techniques were performed as described in reference 41. Sequencing of the plasmids was performed by BaseClear (Leiden, The Netherlands). DNA sequences were analyzed with the software packages provided by the National Center for Biotechnology Information BLAST network server. Biolog SF-N microplates (Biolog, Hayward, CA) were used according to the protocol provided by the manufacturer. The plates were read after 24 h of incubation at 28°C using a microplate reader model 3550 (Bio-Rad Laboratories, Hercules, CA) at an optical density at 595 nm (OD595).

Construction of dnaJ and grpE mutants. A Pseudomonas putida PCL1445 dnaJ mutant was constructed by homologous recombination. A 0.6-kb internal fragment of the dnaJ-homologous gene of strain PCL1445 was obtained by PCR using primers oMP862 (5' CAGTTCAAGGAGGCCAACGAG 3') and oMP863 (5' CGGGCCACCATGGGTACC 3'), cloned into pGEM-T Easy Vector System I (Promega Corporation, Madison, WI), and ligated as an EcoRI-EcoRI insert with the pMP5285 (25) suicide plasmid derived from pME3049 (8), resulting in pMP5524. pMP5524 was transferred to P. putida PCL1445 by triparental mating using pRK2013 as a helper plasmid (42) and using selection on KB agar medium supplemented with kanamycin (50 µg ml–1). Strain PCL1628 was obtained as a resistant colony resulting from single homologous recombination. The insertion of the suicide construct was confirmed by Southern hybridization. A P. putida PCL1445 grpE mutant was constructed using a similar mutagenesis strategy. The grpE fragment for the construction of the suicide plasmid pMP5532 resulted from a PCR using primers oMP874 (5' GAAGAGACTGGTGCAGCAGAT 3') and oMP875 (5' CATTGATCGAAGGCTGAGCGG 3') and chromosomal DNA of strain PCL1445 as a template. Single homologous recombination in grpE resulted in strain PCL1629.

Complementation of dnaK, dnaJ, and grpE mutants of PCL1445. To complement dnaK, dnaJ, and grpE mutants, several plasmids were constructed. pMP5518 containing dnaK and dnaJ, pMP5519 containing dnaK, pMP5530 containing dnaJ, and pMP5532 containing grpE. Complementation of strain PCL1627 (dnaK mutant) and mutant PCL1628 (dnaJ mutant) was carried out using pMP5518, a shuttle vector derived from pME6010 (12) in which a 3.5-kb fragment containing dnaK and dnaJ of strain PCL1445 was inserted. This insert was obtained by PCR using primers oMP918 (5' TGCTCAAGGTGTTCCAGAAGG 3') and oMP919 (5' GCGCCCATTACCGCAATA 3'). pMP5518 was transferred to strains PCL1627 and PCL1628 by triparental mating as described above, and transformants were selected on KB agar medium supplemented with tetracycline (40 µg ml–1). To complement the dnaK insertion in PCL1627 with only dnaK, pMP5518 was digested with SphI to create a deletion removing the second part of the dnaJ gene, resulting in pMP5519. In order to be able to complement the mutation in the dnaJ gene of PCL1628 with only dnaJ, digestion of pMP5518 with ScaI was carried out to delete the first part of the dnaK gene, resulting in pMP5530. To complement the mutation in grpE of PCL1629, a 1.1-kb PCR fragment containing the grpE gene of strain PCL1445 was obtained using primers oMP876 (5' GAGGGCGTCAAGCATGATCGA 3') and oMP877 (5' TGGTCCCCAAGTCGATACCGA 3') and cloned into pME6010, resulting in pMP5534.

5' RACE. A 5' rapid amplification of cDNA ends (5' RACE) system, second generation (Roche Diagnostics GmbH, Penzberg, Germany), was used to determine the length of the dnaJ mRNA. Briefly, total RNA (1 µg) isolated from log-phase PCL1445 cells by RNeasy silica gel membrane column (QIAGEN GmbH, Hilden, Germany) purification was reverse transcribed into cDNA with the 3' dnaJ primer oMP899 (5' GGATCTTCAGCTTCACCCGGCCAT 3'). The purified cDNA was subjected to PCR using the dnaJ gene-specific nested primer oMP900 (5' TGTAGCTGATCGGCACTTCGCAGTA 3') and the 5' RACE anchor primer containing 3'sequence complementary to the homopolymeric poly(dC) tail. The resulting PCR product was reamplified using primer oMP901 (5' AGATCTCGTGCTCACGCACGTTGAT 3') and the 5' RACE primer complementary to the homopolymeric poly(dC) tail. The length of the product was estimated by gel electrophoresis.

Biosurfactant production. The production of biosurfactant activity was detected using the drop-collapsing assay as described previously (19), in which the reduction of the water surface tension can be observed as the collapse of a round droplet placed on a hydrophobic surface (19).

To quantify the biosurfactant production in culture medium, the decrease of surface tension between culture medium and air was determined using a Du Nouy ring (K6 Krüss, GmbH, Hamburg, Germany) (26).

Extraction and HPLC analysis of putisolvins. To quantify the production of putisolvins in KB culture medium, 5 ml of a KB culture supernatant was extracted with 1 volume of ethyl acetate (Fluka Chemie, Zwijndrecht, The Netherlands) as described previously (26). Ethyl acetate extracts were evaporated under vacuum to dryness and dissolved in 55% acetonitrile (Labscan Ltd., Dublin, Ireland). Dry material obtained from 5 ml of culture was resuspended in 500 µl of 50/50 (vol/vol) acetonitrile-water and purified on a spinX centrifuge tube filter of 0.45-µm pore size (Corning Costar Corporation, Cambridge, MA). A volume of 500 µl of the samples was separated by high-performance liquid chromatography (HPLC) (Jasco International CO. Ltd., Japan), using a reverse-phase C8 5-µm Econosphere column (Alltech, Deerfield, IL), a PU-980 pump system (Jasco, B&L systems, Boechout, Belgium), an LG-980-02 gradient unit (Jasco), and an MD 910 detector (Jasco). Separation was performed using a linear gradient, starting at 35/65 (vol/vol) acetonitrile-water and ending at 20/80 after 50 min at a flow rate of 1 ml min–1. Chromatograms were analyzed in the wavelength range between 195 nm and 420 nm. Fractions that corresponded to the retention time of 34 min for putisolvin I and 36 min for putisolvin II were collected and tested for activity in the drop-collapsing assay. The amount of putisolvins produced was determined as the area of the peak detected in microabsorbance units (µAU) at the wavelength of 206 nm.

Construction of psoA::gfp transcriptional fusions. A 1.2-kb HindIII fragment containing the luxI promoter and the gene encoding green fluorescent protein (gfp) from pJBA89 (1) was cloned into the broad-host-range vector pBBR1MCS-5 (23), resulting in pMP4670. Subsequently the SphI fragment containing lac, luxR, and luxI promoters was removed, resulting in pMP4683. Removal of one HindIII site at the end of the gfp gene in pMP4683 resulted in pMP4689. The N-terminal ASV tag from pMP4689 was removed using StuI and SmaI digestion followed by religation, which resulted in pMP6516. To construct a psoA::gfp transcriptional fusion, a 0.75-kb PCR fragment containing the psoA promoter of strain PCL1445 was obtained using primers oMP907 (5' GCATGCAAGCGATGAAAGCAGATGACCCAG 3') and oMP908 (5' GCATGCGTCGGCAGGTCCTTCTGATTGATC 3') in which SphI sites were incorporated (see underlined nucleotides). The psoA promoter was cloned into pMP6516 as an SphI fragment, resulting in pMP5537, containing psoA::gfp in the transcriptionally active orientation, and into pMP5538, containing psoA::gfp in the transcriptionally inactive orientation, by cloning the fragment in the reverse orientation. The constructs pMP5537 and pMP5538 were fused as BamHI fragments to BglII-digested pMP4669 harboring Ptac DsRed, resulting in rhizosphere-stable plasmids pMP5539 and pMP5540, respectively. The constructs were transferred to PCL1445 and PCL1627 by triparental mating as described previously, and transformants were selected with gentamicin (2 µg ml–1) and tetracycline (40 µg ml–1). Expression of gfp was quantified using a HTS7000 Bio Assay reader (Perkin-Elmer Life Sciences, Oosterhout, The Netherlands). Bacterial strains were grown to an OD620 of 2.0 and diluted to an OD620 of 0.6. Fluorescence of the diluted cultures was quantified using a white 96-well microtiter plate containing 200-µl culture aliquots. Fluorescence of the cultures was determined at an excitation wavelength of 485 nm and an emission wavelength of 520 nm.

Construction of dnaK::lacZ transcriptional fusions. Plasmid pML103 (27), which contains a promoterless lacZ gene downstream of a multicloning site, was used to create a dnaK::lacZ transcriptional fusion. The region upstream of dnaK was amplified from PCL1445 by PCR using primer oMP870 (5' TCAAGCGCTACAACCTCGAGG 3') and primer oMP871 (5' GCATGCCATGTTAACTCTCCCGAAAC 3') in which SphI sites were incorporated (see underlined nucleotides). The 0.35-kb PCR product was cloned as an SphI fragment into pML103, resulting in pMP5535 containing dnaK::lacZ in the transcriptionally active orientation and pMP5536 containing dnaK::lacZ in the transcriptionally inactive orientation (reverse orientation of the fragment). Plasmids pMP5535 and pMP5536 were transformed into PCL1445 and its derivatives PCL1622 and PCL1623 by triparental mating. Transformants were selected on KB agar medium supplemented with gentamicin (2 µg ml–1) and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside; 40 µg ml–1) (Ophaero Q; Biosolve B.V., Valkenswaard, The Netherlands). The activity of dnaK transcriptional fusions was assayed by determining ß-galactosidase activity (expressed in Miller units). Aliquots (200 µl) were removed from cultures diluted to an OD620 of 0.6 and analyzed for ß-galactosidase activity by a standard method (30).

Nucleotide sequence accession number. The nucleotide sequences of the P. putida PCL1445 grpE-dnaK-dnaJ DNA region reported in this paper have been deposited in the GenBank database under accession number AY823737. The nucleotide sequences of the P. putida PCL1445 gacS and gacA DNA regions have been deposited in the GenBank database under accession numbers AY920315 and AY920316 respectively.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Isolation and characterization of the biosurfactant mutant PCL1627. In order to identify genes involved in putisolvin biosynthesis of P. putida PCL1445, 2,000 Tn5luxAB transposants were screened for loss of surfactant activity as judged by the drop-collapsing assay, using cells derived from a single colony. Strain PCL1627 was isolated together with two other mutants PCL1622 and PCL1623. After overnight growth in liquid KB, medium supernatant of strain PCL1627 was not able to decrease the surface tension between culture medium and air (54 mN m–1) when compared to PCL1445 (32 mN m–1).

Sequence analysis of the chromosomal regions flanking the Tn5luxAB showed that the transposon is inserted in an open reading frame (ORF) with 93% similarity at the amino acid level to the dnaK gene of P. putida KT2440 and 85% similarity to the dnaK gene of P. aeruginosa PAO1 (Fig. 1A). dnaK codes for a molecular chaperone belonging to the Hsp70 protein family, which is part of the heat shock response system (17, 20, 44). In P. putida PCL1445 a sequence similar to those of {sigma}32-dependent promoters was identified 78 bp upstream of the dnaK translational start (Fig. 1B). The dnaK promoter recognized by {sigma}32 is located 121 bp upstream of the dnaK translational start in E. coli (6) and 86 bp upstream of the dnaK translational start in Pseudomonas syringae pv. glycinea PG4180 (20). The E. coli {sigma}32 consensus sequences are TCTC-CCCTTGAA (–35) and CCCCAT-TA (–10). In E. coli, these two regions are separated by 13 to 17 bp. In P. syringae pv. glycinea and in P. putida PCL1445, the two putative –35 and –10 regions are separated by 14 bp (conserved nucleotides are underlined) (Table 2).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 1. (A) Schematic representation of the grpE-dnaK-dnaJ chromosomal region of Pseudomonas putida PCL1445 showing the location of the transposon insertion in dnaK of mutant strain PCL1627. (B) Sequence of the 5' upstream region of grpE and the adjacent dnaK gene. Features of the putative promoters P1 and P2 are indicated. (C) Sequence of the dnaK-dnaJ intergenic region. Features of the putative terminator stem loop are indicated ({Delta}G = –21 kcal mol–1). Nucleotides forming the stem are indicated in bold and underlined.

 

View this table:
[in this window]
[in a new window]
  		TABLE 2. Comparison of the putative P. putida PCL1445 grpE and dnaK heat-shock promoter sequences with promoters from E. coli, P. syringae pv. glycinea, and C. crescentus

 
Downstream of dnaK a DNA sequence is present that contains complementary nucleotides, which can form a hairpin structure with 13 bp in the stem and 3 bp in the loop, resulting in a hairpin with {Delta}G of –21 kcal mol–1 (Fig. 1C). No consensus terminator sequence was found. Further downstream of dnaK the presence of an ORF was found (Fig. 1A) with amino acid homologies of 95% with the dnaJ gene product of P. putida KT2440 and 85% with dnaJ of P. aeruginosa PAO1, which encodes another molecular chaperone (17). The region upstream of dnaK revealed an ORF that showed 85% homology with grpE of P. putida and 73% homology with grpE of Pseudomonas aeruginosa PAO1 at the amino acid level (17). Upstream of this grpE homologue, a similar conserved nucleotide sequence as in the promoter region of the dnaK homologue, corresponding to the binding site for the {sigma}32 subunit, was found. This suggests that grpE is also heat shock regulated in PCL1445 (Table 2). Comparison of the order of these genes in strain PCL1445 with those of P. aeruginosa (GenBank; www.pseudomonas.bit.uq.edu.au), P. syringae pv. tomato DC3000, and P. putida KT2440 showed the same gene arrangement. Two results suggest that dnaK and dnaJ are not cotranscribed in PCL1445. First, a putative terminator stem loop was identified in the region upstream of dnaJ (Fig. 1C). Second, the intergenic region between dnaK and dnaJ (213 bp) was found to be longer than in other Pseudomonas sp. (varying between 115 bp in P. aeruginosa PAO1 and 198 bp in P. putida KT2440). However, no typical heat shock promoter consensus was found in front of the dnaJ gene.

dnaJ-containing mRNA was amplified by PCR using a 3'-dnaJ-specific primer, which resulted in a 750-bp dnaJ-containing PCR product (data not shown). Thus, this indicates that dnaJ is transcribed as a single gene in PCL1445.

Temperature tolerance of PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant). To test the tolerance to a temperature shift from low to high incubation temperature of cells from strains PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), PCL1629 (grpE mutant), and its wild type, PCL1445, the cells were precultured overnight in KB medium at 18°C under vigorous aeration. These cells were subsequently diluted to an OD620 of 0.1 in fresh KB medium and incubated at 28°C (the optimal growth temperature for Pseudomonas) (Fig. 2A) or at 35°C to follow cell growth in time (Fig. 2B). A temperature shift from 18°C to 28°C did not affect the growth rate of PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant) as compared with the wild type (Fig. 2A). However, when the incubation temperature was shifted to 35°C, mutants PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant) had a higher generation time (110.3 ± 1.8 min) than PCL1445 (74.6 ± 1.4 min) and the optical density of PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant) never reached the same value as that of the wild type (Fig. 2B). The determination of the number of CFU during growth at 35°C for PCL1627 (dnaK mutant) (Fig. 2C) strongly correlated with the cell density at 35°C (Fig. 2B). The growth phenotype of PCL1627 (dnaK mutant) could be restored only by introduction of a plasmid carrying functional dnaK and dnaJ but not with dnaK alone (Fig. 2C). This result suggests that at high incubation temperatures, dnaK and dnaJ regulation depends on a single heat shock promoter.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2. Growth of P. putida PCL1445 and its mutants PCL1436 (psoA mutant), PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant). Cells were precultured overnight at 18°C in KB medium, adjusted to OD620 of 0.1, and then grown at 28°C (A) or 35°C (B) with vigorous aeration (190 rpm). Panel C represents the number of CFU ml–1 during growth at 35°C of PCL1627 (dnaK mutant), PCL1627 (dnaK mutant) harboring pMP5518 containing dnaK followed by dnaJ, and PCL1627 (dnaK mutant) harboring pMP5519 containing dnaK followed by part of dnaJ. Samples were taken at regular time points to determine the optical density or CFU ml–1. Standard deviations are based on the mean values of two parallel cultures.

 
Construction of a dnaJ mutant and a grpE mutant and complementation analyses of mutants for the production of lipopeptides. To investigate whether dnaJ and grpE (Fig. 3E and G) are also involved in putisolvin production, insertion mutants were constructed by single homologous recombination using suicide plasmids pMP5524 and pMP5532 (see Materials and Methods), resulting in PCL1628 and PCL1629, respectively. The integration of pMP5524 and pMP5532 was confirmed by Southern hybridization (data not shown).



View larger version (22K):
[in this window]
[in a new window]
  		FIG.3. C8 reverse-phase HPLC analysis of putisolvin production by P. putida PCL1445 and its mutants, PCL1436 (psoA mutant), PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant). The panels depict: PCL1445 (A), PCL1436 (B), PCL1627 (C), PCL1628 (E), PCL1629 (G), PCL1627 harboring pMP5519 containing dnaK of PCL1445 (D), PCL1628 harboring pMP5530 containing the last part of dnaK followed by dnaJ of PCL1445 (F), and PCL1629 harboring pMP5534 containing grpE of PCL1445 (H). Cells were grown to the stationary phase in 5 ml KB medium at 28°C under vigorous aeration. Compounds from the ethyl acetate-extracted culture supernatant were separated and analyzed at a wavelength of 206 nm. HPLC fractions of 1 ml were collected and tested for surfactant activity using the drop-collapsing assay.

 
Biosurfactant production of PCL1628 (dnaJ mutant) and PCL1629 (grpE mutant) grown in KB medium under standard conditions until the stationary phase was reached (28°C and vigorous aeration) was quantified by the Du Nouy ring method. Culture supernatant of PCL1628 (dnaJ mutant) was not able to decrease the surface tension between culture medium and air (54 mN m–1), indicating a lack of biosurfactant production. Culture supernatant of PCL1629 (grpE mutant) caused a slight decrease of the surface tension (48 mN m–1). In comparison the surface tension of PCL1445 was decreased to the value of 32 mN m–1.

Complementation analyses were conducted using the constructs pMP5519 (dnaK), pMP5530 (dnaJ), and pMP5534 (grpE). The production of putisolvins by PCL1445, PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant) was tested by HPLC analysis (Fig. 3). Putisolvins were extracted from overnight KB culture supernatant, and production was quantified by determination of the area of the peaks with surfactant activity as tested by the drop-collapsing assay. Putisolvins I and II were eluted at 34 and 36 min, respectively (Fig. 3). Mutant PCL1627 (dnaK mutant) showed a significant reduction (90%) in putisolvin production (Fig. 3). Introduction of pMP5519, harboring a functional dnaK gene, restored putisolvin production in PCL1627 (dnaK mutant) (Fig. 3D). This result shows that the insertion of the transposon in dnaK is responsible for the decrease of lipopeptide production and that this decrease is not due to a downstream effect on dnaJ (Fig. 3). Production of putisolvins by mutant PCL1628 (dnaJ mutant) was almost completely abolished (Fig. 3E), while mutant PCL1629 (grpE mutant) showed a 50% reduction in putisolvin production (Fig. 3G). Introduction of pMP5530 containing the 3' dnaK end and dnaJ into PCL1628 (dnaJ mutant) strain restored biosurfactant activity and putisolvin production (Fig. 3F). Finally, introduction of pMP5534 carrying grpE into PCL1629 (grpE mutant) complemented for the reduced putisolvin production (Fig. 3H). These results show that dnaK, dnaJ, and grpE take part in the regulation of putisolvin I and II biosynthesis at 28°C. Complementation analysis of dnaK and dnaJ mutations supports the result of the 5' RACE indicating that dnaK and dnaJ are independently transcribed at normal growth temperature (28°C).

Effect of temperature on production of putisolvins I and II. Low incubation temperature had hardly any effect on the growth of the three mutants (data not shown). The effect of temperature (32°C, 28°C, 21°C, 16°C, and 11°C) on the production of putisolvins was analyzed in stationary-phase liquid cultures of PCL1445, PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant) (Fig. 4). HPLC analysis showed that the level of putisolvin production decreases with increasing growth temperature. Moreover, a mutation in dnaK (PCL1627) decreased putisolvin production at 21°C and 16°C and practically abolished putisolvin production at higher and lower temperatures (Fig. 4A). Production of putisolvins by mutant PCL1627 (dnaK mutant) at low and high temperatures could be restored by introduction of pMP5519 carrying the functional dnaK gene. Analysis of the dnaJ mutant for the production of putisolvins at the same range of temperatures showed that DnaJ has a similar effect as DnaK (Fig. 4B). The mutation in dnaJ was complemented for the production of putisolvins using pMP5530 carrying 3' 520 bp of the dnaK and dnaJ genes. Although a mutation in grpE had a significant effect on putisolvin production at temperatures higher than 21°C, the level of putisolvins was comparable to that of PCL1445 at lower temperatures (Fig. 4C). Thus, these results show that (i) putisolvin production is up-regulated at low temperatures and (ii) DnaK and DnaJ are required for the production of putisolvins at low temperatures.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 4. Effect of growth temperature on the production of putisolvins I and II by Pseudomonas putida PCL1445 and its mutant derivatives. PCL1445, PCL1627 (dnaK mutant), PCL1627(dnaK mutant) with pMP5530 (dnaK), PCL1628 (dnaJ mutant), PCL1628 (dnaJ mutant) with pMP5530 (dnaJ), PCL1629, and PCL1629 (grpE mutant) with pMP5532 (grpE) were cultured at 11, 16, 21, 28, and 32°C to stationary phase. The production of putisolvins was quantified by C8 reverse-phase HPLC analysis. The values depicted represent the area of the peaks over cell density (µAU/OD620). (A) PCL1445 (column a), PCL1627 (dnaK mutant) (column b), and PCL1627 (dnaK mutant) complemented using pMP5519 (dnaK) (column c). (B) PCL1445 (column a), PCL1628 (dnaJ mutant) (column b), and PCL1628 (dnaJ mutant) complemented using pMP5530 (dnaJ) (column c). (C) PCL1445 (column a), PCL1629 (grpE mutant) (column b), and PCL1629 (grpE mutant) complemented using pMP5532 (grpE) (column c).

 
Effect of a dnaK, dnaJ, or grpE mutation on psoA expression. To analyze a possible effect of DnaK on the expression of psoA, a psoA::gfp transcriptional fusion was constructed. Transcriptional activity of the putisolvin promoter was analyzed in strains PCL1445, PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant) in liquid culture at different temperatures (28°C, 21°C, 16°C, and 11°C) (Fig. 5). Our data showed a strong correlation between psoA::gfp transcriptional activity and the production of putisolvins in culture medium. The absence of transcriptional activity in PCL1627 (dnaK mutant) and PCL1628 (dnaJ mutant) at 28°C and 11°C and its reduction at 16°C indicate that DnaK and DnaJ regulate (directly or indirectly) putisolvin synthesis at the transcriptional level. Furthermore, a mutation in grpE had hardly any effect on the expression of psoA::gfp at 11°C (Fig. 5). This result, which supports HPLC analysis (Fig. 4), shows that grpE does not take part in the regulation of putisolvins at low temperature.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 5. Expression of psoA in Pseudomonas putida PCL1445, PCL1627 (dnaK mutant), PCL1628 (dnaJ mutant), and PCL1629 (grpE mutant). Expression was determined by measuring fluorescence from cells containing the putisolvin synthetase promoter fused to egfp (pMP5539). pMP5540 in which the psoA promoter was cloned in the reverse orientation was used as a control vector. Strains were grown at 11, 16, 21, and 28°C in KB medium. Mean values of duplicate cultures are given.

 
Effect of a gacA or gacS mutation on dnaK expression. Transposon mutants PCL1622 and PCL1623 were isolated together with PCL1627 after an initial screening for surface tension-decreasing ability using the drop-collapsing assay. Strains PCL1622 and PCL1623 did not produce detectable amounts of putisolvin (data not shown). Sequence analysis of the DNA region flanking Tn5luxAB showed that the transposons of PCL1622 and PCL1623 were inserted in a gacA homolog encoding a global response regulator and a gacS homolog encoding a sensor kinase, respectively (13). Mutations in gacA and gacS genes could be complemented for the production of putisolvins using plasmids pMP5512 (gacA) and pMP6562 (gacS), respectively (data not shown). Since putisolvin production is induced during the late exponential phase and since DnaK appears to regulate transcriptional activity of putisolvin synthetase gene promoter (Fig. 5), we tested whether dnaK is regulated by the GacA/GacS two-component system. To test this hypothesis, a dnaK::lacZ transcriptional fusion was constructed and its expression was analyzed in both PCL1622 (gacA mutant) and PCL1623 (gacS mutant) (Table 3). Strains PCL1445, PCL1622 (gacA mutant), and PCL1623 (gacS mutant) harboring dnaK::lacZ were cultured at 28°C in liquid KB medium to the stationary phase. The expression of ß-galactosidase activity was reduced in the gac mutants PCL1622 (gacA mutant) and PCL1623 (gacS mutant) and was restored to wild-type levels in the complemented derivatives (Table 3). This result shows that the GacA/GacS two-component regulatory system has a positive effect on DnaK in PCL1445.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Expression of the dnaK promoter fused to lacZ in P. putida PCL1445, PCL1622 (gacA mutant) and PCL1623 (gacS mutant)

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The aim of this work was to identify and characterize genes involved in regulating the production of the cyclic lipopeptides putisolvin I and II by Pseudomonas putida PCL1445. Putisolvins are biosurfactants that are required for swarming motility and are able to inhibit biofilm formation and degrade existing biofilms (26). We have screened a Tn5 library for mutants defective in lipopeptide production. One of the mutants, PCL1627, carried the transposon in a dnaK homolog. DnaK is a member of the Hsp70 heat shock protein family. In E. coli, the rpoH gene product, {sigma}32, positively regulates heat shock genes by directing the core RNA polymerase to the dnaK promoter (6, 17). A sequence similar to the E. coli consensus {sigma}32-dependent promoters was identified in the dnaK promoter region of P. putida PCL1445 indicating that dnaK is also regulated by {sigma}32 in PCL1445.

Sequencing of the region downstream of dnaK revealed dnaJ, an organization that is conserved in Staphylococcus aureus (36), Xanthomonas campestris (47), Neisseria gonorrhoeae (28), or Clostridium acetobutylicum (32). In many organisms, dnaK and dnaJ are organized as an operon and the gene products are part of an equimolar protein complex which is formed with the cochaperone GrpE. Sequencing of the region upstream of dnaK localized a grpE homolog (Fig. 1A).

Deletion of grpE in E. coli (2) and dnaK or grpE in P. syringae pv. glycinea (20) results in a loss of viability due to a severely compromised physiological function. In contrast, our results show that mutation in any of these three genes does not affect growth of PCL1445 at 28°C (Fig. 2A). Southern blot analysis of the PCL1445 wild type and its dnaK mutant, using a dnaK probe, did not indicate the presence of a second dnaK homolog in the genome (data not shown). This suggests that under the growth conditions used, at 28°C, dnaK is not important or the loss of dnaK can be compensated for by the production of other heat shock proteins such as GroEL-GroES (31). Growth of dnaK, dnaJ, and grpE mutants is reduced at 35°C (Fig. 2B), indicating that functioning of dnaK, dnaJ, and grpE becomes important for PCL1445 at high temperature and is (at least) not completely compensated for by the production of other chaperones. Furthermore, the growth deficiency of a dnaK mutant can be restored only by introduction of both dnaK and dnaJ and not with dnaK alone, indicating that dnaK and dnaJ are coregulated at high temperature (Fig. 2C). The results on the growth of dnaK, dnaJ, and grpE mutants demonstrate that DnaK, DnaJ, and GrpE are not essential for growth of PCL1445.

dnaK, dnaJ, or grpE mutants were analyzed for putisolvin production to assess the significance of the three heat shock genes for putisolvin production. Putisolvin production was almost eliminated in dnaK and dnaJ mutant strains, while production was decreased in a grpE mutant (Fig. 3). This implicates that DnaK, DnaJ, and GrpE act as a complex in the regulation of putisolvin production. In addition, expression analysis of the putisolvin synthetase gene psoA, tested by a psoA::gfp transcriptional fusion in the wild type and in dnaK, dnaJ, and grpE mutants, showed that transcriptional activity (Fig. 4) correlated with putisolvin production, as determined by HPLC (Fig. 5). Finally, we also showed that the GacA/GacS two-component regulatory system is important for putisolvin production and interestingly that expression of dnaK was also regulated by the gac system (Table 3). This provides genetic evidence that DnaK could play a role in temperature sensing via the GacA/GacS two-component regulatory system in PCL1445.

We do not know yet how the DnaK, DnaJ, and GrpE complex is involved in transcription of psoA and if GacA/GacS directly or indirectly regulates dnaK. However, the heat shock response does not seem to take part in this regulation. Although complementation of phenotypic growth at high temperature (35°C) shows that dnaK-dnaJ may function as an operon (Fig. 2C), two results, (i) complementation of dnaK and dnaJ mutations for the production of putisolvins at 28°C (Fig. 3) (ii) and transcriptional analysis using 5' RACE (data not shown), strongly suggest that dnaK and dnaJ are transcribed separately at lower temperatures. This is in accordance with two previous studies, which showed that in Pseudomonas syringae pv. glycinea dnaK and dnaJ are not organized as an operon (20) and in Neisseria gonorrhoeae a promoter is present in front of dnaJ (28).

A number of possible mechanisms involving the DnaK complex in the regulation of putisolvins can be predicted. DnaK, DnaJ, and GrpE may be required for the proper folding or activity of an unknown positive regulator of psoA. One particularly appealing possibility is that the GacA/GacS two-component system positively regulates psoA. In that case, DnaK, DnaJ, and or GrpE may regulate proper folding of some known small RNA (sRNA) mediators regulated by a gac system, such as RsmZ and RsmY, and which have been shown to control biosynthesis of antibiotics of P. fluorescens (10). Another possible target for the DnaK complex is {sigma}S, which is encoded by rpoS and which plays a crucial role in gene regulation during entry into stationary phase and was suggested to be regulated by DnaK in previous study (14, 31, 39). Alternatively, DnaK-DnaJ-GrpE may be required for the proper assembly of the large lipopeptide synthase complex. Finally, the effect on lipopeptide synthesis may be an indirect consequence of other cellular changes in dnaK, dnaJ, and grpE mutant strains.

In this report, we have demonstrated that the synthesis of the surfactants putisolvins at low temperatures requires the DnaK chaperone complex in P. putida (Fig. 4) and that consequently the putisolvin synthetase gene psoA is up-regulated (Fig. 5).

It is still unknown how the DnaK chaperone complex controls transcription of the psoA gene at low temperatures. However, GrpE does not take part in the regulation, indicating that the functioning of the DnaK complex differs at 11°C and at 28°C. Performance of dnaK::lacZ expression analysis in PCL1445 indicated in accordance with a study in E. coli (49) that dnaK expression decreases gradually at lower temperatures, with respective values of 67.38 ± 1.4 Miller units at 28°C, 28.89 ± 0.48 Miller units at 21°C, 7.421 ± 0.50 Miller units at 16°C, and 2.88 ± 0.08 Miller units at 11°C. Although the expression of dnaK decreases at lower temperatures, the presence of a functional DnaK is required since mutation results in loss of putisolvin production. This hypothesis is supported by the results in E. coli indicating that DnaK is not only involved in the regulation of heat shock response but could also take part in the regulation of environmental stress response, such as temperature and stationary phase (14, 38, 39).

Temperature and heat shock proteins have been reported to play an important role in the modulation of virulence in phytopathogenic bacteria—for example, for tumor induction by Agrobacterium tumefaciens (5, 33) and for phytotoxin production by P. syringae pv. glycinea (20). Low temperature restricts growth of P. putida PCL1445 and positively regulates putisolvin production during late exponential phase via the DnaK stress response system. Low temperature could constitute a challenge for the dissemination of Pseudomonas putida due to, for instance, a reduction of metabolic functions or a reduction of nutrient availability such as root exudates or intermediates of the polyaromatic hydrocarbon degradation process (24). Production of biosurfactants could confer an ecological advantage for bacteria at low temperature. Their specific activity could be involved in important functions such as (i) creating a protective microenvironment by reducing surface tension, (ii) taking part in the solubilization of nutrient (hydrophobic carbon sources), (iii) forming an emulsion as a result of reduction of the interfacial tension between water and oil at low temperatures, which in turn could increase the available surface for growth; or (iv) taking part in swarming motility in order to colonize a more favorable environment.


   ACKNOWLEDGMENTS
 
This research was supported by the Council for Chemical Sciences of The Netherlands Foundation for Scientific Research (NWO/CW).

We thank I. Kuiper for valuable discussions and P. Hock for assistance in processing the graphs.


   FOOTNOTES
 
* Corresponding author. Mailing address: Leiden University, Institute of Biology, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands. Phone: 31 71 527 5076. Fax: 31 71 527 5088. E-mail: bloemberg{at}rulbim.leidenuniv.nl. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Andersen, J. B., A. Heydorn, M. Hentzer, L. Eberl, O. Geisenberger, B. B. Christensen, S. Molin, and M. Givskov. 2001. gfp-based N-acyl homoserine-lactone sensor system for detection of bacterial communication. Appl. Environ. Microbiol. 67:575-585.[Abstract/Free Full Text]
  2. Ang, D., and C. Georgopoulos. 1989. The heat-shock-regulated grpE gene of Escherichia coli is required for bacterial growth at all temperatures but is dispensable in certain mutant backgrounds. J. Bacteriol. 171:2748-2755.[Abstract/Free Full Text]
  3. Bender, C. L., F. Elarcón-Chaidez, and D. C. Gross. 1999. Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol. Mol. Biol. Rev. 63:266-292.[Abstract/Free Full Text]
  4. Bloemberg, G. V., A. H. Wijfjes, G. E. M. Lamers, N. Stuurman, and B. J. Lugtenberg. 2000. Simultaneous imaging of Pseudomonas fluorescens WCS365 population expressing three different autofluorescent proteins in the rhizosphere: new perspectives for studying microbial communities. Mol. Plant-Microbe Interact. 13:1170-1176.[Medline]
  5. Braun, A. C. 1947. Thermal studies on the factors responsible for tumor initiation in crown gall. Am. J. Bot. 34:234-240.[CrossRef]
  6. Cowing, D. W., J. C. Bardwell. E. A. Craig, C. Woolford, R. W. Hendrix, and C. A. Gross. 1985. Consensus sequence for Escherichia coli heat shock promoters. Proc. Natl. Acad. Sci. USA 82:2679-2683.[Abstract/Free Full Text]
  7. Desai, J. D., and I. M. Banat. 1997. Microbial production of surfactants and their commercial potential. Microbiol. Mol. Biol. Rev. 61:47-64.[Abstract]
  8. Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351.[Abstract/Free Full Text]
  9. Ellis, R. J., and S. M. Hemmingsen. 1989. Molecular chaperones: proteins essential for the biogenesis of some macromolecular structures. Trends Biochem. Sci. 14:339-342.[CrossRef][Medline]
  10. Haas, D., and C. Keel. 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. and relevance for biological control of plant disease. Annu. Rev. Phytopathol. 41:117-153.[CrossRef][Medline]
  11. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580.[Medline]
  12. Heeb, S., Y. Itoh, T. Nishijyo, U. Schnider, C. Keel, J. Wade, U. Walsh, F. O'Gara, and D. Haas. 2000. Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. Mol. Plant-Microbe Interact. 13:232-237.[Medline]
  13. Heeb, S., and D. Haas. 2001. Regulatory roles of the GacS/GacA two-component system in plant-associated and other gram-negative bacteria. Mol. Plant-Microbe Interact. 14:1351-1363.[Medline]
  14. Hengge-Aronis, R. 2002. Signal transduction and regulatory mechanisms involved in control of the {sigma}S (RpoS) subunit of RNA polymerase. Microbiol. Mol. Biol. Rev. 66:373-395.[Abstract/Free Full Text]
  15. Hrabak, E. M., and D. K. Willis. 1992. The lemA gene required for pathogenicity of Pseudomonas syringae pv. syringae on bean is a member of a family of two-component regulators. J. Bacteriol. 174:3011-3020.[Abstract/Free Full Text]
  16. Huber, B., K. Riedel, M. Kothe, M. Givskov, S. Molin, and L. Eberl. 2002. Genetic analysis of function involved in the late stages of biofilm development in Burkholderia cepacia HIII. Mol. Microbiol. 46:411-426.[CrossRef][Medline]
  17. Hughes, K. T., and K. Mathee. 1998. The anti-sigma factors. Annu. Rev. Microbiol. 52:231-286.[CrossRef][Medline]
  18. Hutchinson, M. L., M. A. Tester, and D. C. Gross. 1995. Role of biosurfactants and ion-channel-forming activities of syringomycin in transmembrane ion flux—a model for the mechanism of action in the plant-pathogen interaction. Mol. Plant-Microbe Interact. 8:610-620.[Medline]
  19. Jain, D. K., D. K. Thomsom, H. Lee, and J. T. Trevors. 1991. A drop-collapsing test for screening surfactant producing microorganisms. J. Microbiol. Methods 13:271-279.
  20. Keith, L. M. W., J. E. Partridge, and C. L. Bender. 1999. dnaK and the heat stress response of Pseudomonas syringae pv. glycinea. Mol. Plant-Microbe Interact. 12:563-574.[Medline]
  21. King, E. O., M. K. Ward, and D. E. Raney. 1954. Two simple media for the demonstration of pyocyanin and fluorescein. J. Lab. Clin. Med. 44:301-307.[Medline]
  22. Koch, B., T. H. Nielsen, D. Sørensen, J. B. Andersen, C. Christophersen, S. Molin, M. Givskov, J. Sørensen, and O. Nybroe. 2002. Lipopeptide production in Pseudomonas sp. strain DSS73 is regulated by components of sugar beet exudate via the Gac two-component regulatory system. Appl. Environ. Microbiol. 68:4509-4516.[Abstract/Free Full Text]
  23. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176.[CrossRef][Medline]
  24. Kuiper, I., G. V. Bloemberg, and B. J. Lugtenberg. 2001. Selection of a plant-bacterium pair as a novel tool for rhizostimulation of polycyclic aromatic hydrocarbon-degrading bacteria. Mol. Plant-Microbe Interact. 14:1197-1205.[Medline]
  25. Kuiper, I., G. V. Bloemberg, S. Noreen, J. E. Thomas-Oates, and B. J. Lugtenberg. 2001. Increased uptake of putrescine in the rhizosphere inhibits competitive root colonization by Pseudomonas fluorescens strain WCS365. Mol. Plant-Microbe Interact. 14:1096-1104.[Medline]
  26. Kuiper, I., E. L. Lagendijk, R. Pickford, J. P. Derrick, G. E. M. Lamers, J. E. Thomas-Oates, B. J. J. Lugtenberg, and G. V. Bloemberg. 2003. Characterization of two Pseudomonas putida lipopeptide biosurfactants, putisolvin I and II, which inhibit biofilm formation and break down existing biofilms. Mol. Microbiol. 51:97-113.
  27. Labes, M., A. Puhler, and R. Simon. 1990. New family of RSF1010-derived expression and lac-fusion broad-host-range vectors for gram-negative bacteria. Gene 89:37-46.[CrossRef][Medline]
  28. Laskos, L., C. S. Ryan, J. A. M. Fyfe, and J. K. Davies. 2004. The RpoH-mediated stress response in Neisseria gonorrhoeae is regulated at the level of activity. J. Bacteriol. 186:8443-8452.[Abstract/Free Full Text]
  29. Lindum, P. W., U. Anthoni, C. Christophersen, L. Eberl, S. Molin, and M. Givskov. 1998. N-Acyl-L-homoserine lactone autoinducer control production of an extracellular lipopeptide biosurfactant required for swarming motility of Serratia liquefaciens MG1. J. Bacteriol. 180:6384-6388.[Abstract/Free Full Text]
  30. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  31. Muffler, A., M. Barth, C. Marschall, and R. Hengge-Aronis. 1997. Heat shock regulation of {sigma}S turnover: a role for DnaK and relationship between stress responses mediated by {sigma}S and {sigma}32 in Escherichia coli. J. Bacteriol. 179:445-452.[Abstract/Free Full Text]
  32. Naberhaus, F., K. Giebeler, and H. Bohl. 1992. Molecular characterization of the dnaK gene region of Clostridium acetobutylicum, including grpE, dnaJ, and a new heat shock gene, J. Bacteriol. 174:3290-3299.[Abstract/Free Full Text]
  33. Nakahigashi, K., H. Yanagi, and T. Yura. 2001. DnaK chaperone-mediated control of activity of a {sigma}32 homolog (RpoH) plays a major role in the heat shock response of Agrobacterium tumefaciens. J. Bacteriol. 183:5302-5310.[Abstract/Free Full Text]
  34. Neu, T. R. 1996. Significance of bacterial surface-active compounds in interaction of bacteria with interfaces. Microbiol. Rev. 60:151-166.[Free Full Text]
  35. Nielsen, T. H., C. Christophersen, V. Anthoni, and J. Sørensen. 1999. Viscosinamide, a new cyclic depsipeptide with surfactant and antifungal properties produced by Pseudomonas fluorescens DR54. J. Appl. Microbiol. 87:80-90.[CrossRef][Medline]
  36. Ohta, T., K. Saito, M. Kuroda, K. Honda, H. Hirata, and H. Hayashi. 1994. Molecular cloning of two new heat shock genes related to the hsp70 genes in Staphylococcus aureus. J. Bacteriol. 176:4779-4782.[Abstract/Free Full Text]
  37. Paek, K.-H., and G. C. Walker. 1987. Escherichia coli dnaK null mutants are inviable at high temperature. J. Bacteriol. 169:283-290.[Abstract/Free Full Text]
  38. Rockabrand, D., T. Arthur, G. Korinek, K. Livers, and P. Blum. 1995. An essential role for the Escherichia coli DnaK protein in starvation-induced thermotolerance, H2O2 resistance, and reductive division. J. Bacteriol. 177:3695-3703.[Abstract/Free Full Text]
  39. Rockabrand, D., K. Livers, T. Austin, R. Kaiser, D. Jensen, R. Burgess, and P. Blum. 1998. Roles of DnaK and RpoS in starvation-induced thermotolerance of Escherichia coli. J. Bacteriol. 180:846-854.[Abstract/Free Full Text]
  40. Ron, E. Z., and E. Rozenberg. 2001. Natural roles of biosurfactants. Environ. Microbiol. 3:229-236.[CrossRef][Medline]
  41. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
  42. Schnider, U., C. Keel, C. Voisard, G. Défago, and D. Haas. 1995. Tn5-directed cloning of pqq genes from Pseudomonas fluorescens CHAO: mutational inactivation of the genes results in overproduction of the antibiotic pyoluteorin. Appl. Environ. Microbiol. 61:3856-3864.[Abstract]
  43. Stachelhaus, T., H. D. Mootz, and M. A. Marahiel. 1999. The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chem. Biol. 6:493-505.[CrossRef][Medline]
  44. Strauss, D., A. Walter, and C. A. Gross. 1990. DnaK, DnaJ and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of sigma 32. Genes Dev. 4:2202-2209.[Abstract/Free Full Text]
  45. Van den Broek, D., T. F. Chin-A-Woeng, K. Eijkemans, I. H. Mulders, G. V. Bloemberg, and B. J. Lugtenberg. 2003. Biocontrol traits of Pseudomonas spp. are regulated by phase variation. Mol. Plant-Microbe Interact. 16:1003-1012.[Medline]
  46. Von Döhren, H., U. Keller, J. Vater, and R. Zocher. 1997. Multifunctional peptide synthetases. Chem. Rev. 97:2675-2705.[CrossRef][Medline]
  47. Weng, S. F., P. M. Tai, C. H. Yang, C. D. Wu, W. J. Tsai, J. W. Lin, and Y. H. Tseng. 2001. Characterization of stress responsive genes, hrcA-grpE-dnaK-dnaJ, from phytopathogenic Xanthomonas campestris. Arch. Microbiol. 176:121-128.[CrossRef][Medline]
  48. Wolk, C. P., Y. Cai, and J. M. Panoff. 1991. Use of a transposon with luciferase as a reporter to identify environmentally responsive genes in a cyanobacterium. Proc. Natl. Acad. Sci. USA 88:5355-5359.[Abstract/Free Full Text]
  49. Zhou, Y.-N., N. Kusukawa, J. W. Erickson, C. A. Gross, and T. Yura. 1988. Isolation and characterization of Escherichia coli mutants that lack the heat shock sigma factor {sigma}32. J. Bacteriol. 170:3640-3649.[Abstract/Free Full Text]

Journal of Bacteriology, September 2005, p. 5967-5976, Vol. 187, No. 17
0021-9193/05/$08.00+0     doi:10.1128/JB.187.17.5967-5976.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dubern, J.-F.
Right arrow Articles by Bloemberg, G. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dubern, J.-F.
Right arrow Articles by Bloemberg, G. V.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS