This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braun, M.
Right arrow Articles by Thöny-Meyer, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braun, M.
Right arrow Articles by Thöny-Meyer, L.

 Previous Article  |  Next Article 

Journal of Bacteriology, September 2005, p. 5996-6004, Vol. 187, No. 17
0021-9193/05/$08.00+0     doi:10.1128/JB.187.17.5996-6004.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Cytochrome c Maturation and the Physiological Role of c-Type Cytochromes in Vibrio cholerae

Martin Braun* and Linda Thöny-Meyer

Institut für Mikrobiologie, ETH Hönggerberg, Wolfgang-Pauli-Str. 10, CH-8093 Zürich, Switzerland

Received 18 March 2005/ Accepted 9 June 2005


arrow
ABSTRACT
 
Vibrio cholerae lives in different habitats, varying from aquatic ecosystems to the human intestinal tract. The organism has acquired a set of electron transport pathways for aerobic and anaerobic respiration that enable adaptation to the various environmental conditions. We have inactivated the V. cholerae ccmE gene, which is required for cytochrome c biogenesis. The resulting strain is deficient of all c-type cytochromes and allows us to characterize the physiological role of these proteins. Under aerobic conditions in rich medium, V. cholerae produces at least six c-type cytochromes, none of which is required for growth. Wild-type V. cholerae produces active fumarate reductase, trimethylamine N-oxide reductase, cbb3 oxidase, and nitrate reductase, of which only the fumarate reductase does not require maturation of c-type cytochromes. The reduction of nitrate in the medium resulted in the accumulation of nitrite, which is toxic for the cells. This suggests that V. cholerae is able to scavenge nitrate from the environment only in the presence of other nitrite-reducing organisms. The phenotypes of cytochrome c-deficient V. cholerae were used in a transposon mutagenesis screening to search for additional genes required for cytochrome c maturation. Over 55,000 mutants were analyzed for nitrate reductase and cbb3 oxidase activity. No transposon insertions other than those within the ccm genes for cytochrome c maturation and the dsbD gene, which encodes a disulphide bond reductase, were found. In addition, the role of a novel CcdA-like protein in cbb3 oxidase assembly is discussed.


arrow
INTRODUCTION
 
The gram-negative bacterium Vibrio cholerae naturally inhabits aquatic ecosystems and is part of the normal flora of brackish water. While the vast majority of environmental isolates are nonpathogenic, some strains are able to cause cholera in humans. The disease is endemic in much of South Asia, Africa, and Latin America (49). Within the natural aquatic habitats, V. cholerae has been proposed to live in five distinctive stages, as follows: an independent, free-swimming form; a symbiont of phytoplankton; a commensal of zooplankton; a viable but not culturable state; and a biofilm attached to abiotic or chitinous surfaces (37). These changes in habitat require the bacterium to adapt to a broad range of growth conditions. Major factors that influence growth are the sources of nitrogen and carbon and the presence or absence of oxygen. The genome of V. cholerae has been sequenced and published (17), and various metabolic pathways can be predicted using this information. For example, the cbb3-type heme copper oxidase has previously been shown to have a high affinity for dioxygen in Bradyrhizobium japonicum (32) and to retain the ability to conserve the energy liberated from the oxygen reduction reaction. These properties have been suggested to allow organisms harboring the corresponding genes to colonize microaerobic environments (9, 31), e.g., the small intestine, and thus these genes may be required for virulence.

Aerobic and anaerobic respiration require membrane-associated electron transport systems that acquire electrons from an electron donor and transfer them to an electron acceptor (e.g., oxygen), thereby conserving energy for ATP synthesis. Several types of oxidation-reduction enzymes are involved in such electron transport. All respiratory electron transport chains comprise heme-containing proteins called cytochromes. Cytochromes are classified according to the nature of heme binding. Cytochromes of the c type bind heme covalently via two thioether bonds to the two cysteines in the sequence motif Cys-Xaa-Xaa-Cys-His located in the periplasmic domain of the cytochrome. Whether the cell produces a certain c-type cytochrome depends on the transcriptional and translational regulation of the corresponding gene, on posttranslational targeting of the protein to the periplasm, and on subsequent heme attachment. In this work, a single mutation inactivating the cytochrome c maturation pathway that enables the biochemical characterization of a subset of the predicted electron transport chains is described (Fig. 1).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1. Predicted respiratory electron transport chains of V. cholerea. Electrons are transported from the quinol pool (QH2) to the terminal electron acceptors indicated. Arrows with dashed lines show electron transport chains with c-type cytochrome subunits. BSO, biotin sulfoxide.


arrow
MATERIALS AND METHODS
 
Strains and growth conditions. Bacterial strains used in this work are listed in Table 1. Escherichia coli strain DH5{alpha} (16) was used for cloning S17{lambda}pir (43) for conjugation with V. cholerae. Media were prepared as described by Silhavy et al. (42). E. coli strains were grown aerobically in Luria-Bertani broth (LB). V. cholerae 2740-80 is a nontoxigenic El Tor isolate from the Gulf Coast of the United States (1). Derivatives of this strain were used throughout the study. If not stated otherwise, V. cholerae samples were grown aerobically in LB. For anaerobic growth under argon of V. cholerae, M63 minimal medium was supplemented with trace elements (10 mg liter–1 H3BO3, 1 mg liter–1 ZnSO4 · 7 H2O, 0.5 mg liter–1 CuSO4 · 5 H2O, 0.1 mg liter–1 Na2MoO4 · 2 H2O, 0.1 mg liter–1 MnCl2 · 4 H2O, and 0.2 mg liter–1 FeCl3) and electron acceptors to final concentrations of 40 mM for sodium fumarate, 10 mM for trimethylamine N-oxide (TMAO), 14 mM for dimethyl sulfoxide (DMSO), and 5 mM for KNO3. Antibiotics were used at the following concentrations in both LB and M63 media: for ampicillin, 200 µg ml–1; for kanamycin, 50 µg ml–1; for chloramphenicol, 20 µg ml–1; and for rifampin, 40 µg ml–1. If not otherwise stated, 0.1% arabinose was added for gene expression from the arabinose promoter Para. Cultures were grown at 37°C.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Strains and plasmids used in this studya

Sequence analyses and databases used. V. cholerae sequences were retrieved from the published genome (17) on the website of the Institute for Genomic Research (http://www.tigr.org/; Rockville, MD). Other sequences were retrieved from the GenBank (National Center for Biotechnology Information, National Library of Medicine, Bethesda, MD) and EMBL (European Bioinformatics Institute, Cambridge, United Kingdom) databases. Protein sequences were analyzed using programs available at the ExPASy Molecular Biology website (http://www.expasy.ch/; Swiss Institute of Bioinformatics, Epalinges and Geneva, Switzerland).

Cloning of V. cholerae ccm genes. Plasmids used and constructed in this work are shown in Table 1. The gene encoding CcmE of V. cholerae was amplified by PCR with primer pair VCEN (5' GGAGAATTCATATGAACCCAAGACG 3') and VCEC (5' CGGGATCCTCATTGGTCGCTTCCTTG 3') using genomic DNA of V. cholerae 2740-80 as template. The PCR product was digested with BamHI, blunt ended with T4 DNA polymerase, restricted with NdeI, and cloned into NdeI- and SmaI-digested pISC-2 vector. The resulting plasmid, pVC11, has ccmE under the tight control of the Para promoter (19).

A DNA fragment encoding CcmC, CcmD, and CcmE of V. cholerae was amplified by PCR using Taq polymerase, primer pair VCCN (5' GGAGAATTCATATGTGGAAATGGCTTCATCCC 3') and VCEC, and genomic DNA of V. cholerae 2740-80 as template. The PCR product was blunt ended with T4 DNA polymerase and cloned into the EcoRV site of pACYC184, resulting in plasmid pVC5.

To obtain expression of ccmA-E of V. cholerae, genomic DNA of the ccmE-mutant VC595 and the vector pISC-2 (19) were digested with PstI and BamHI. The DNA fragments were ligated, and clones containing a fragment harboring ccmA-E with ccmE::kan were obtained by selection on kanamycin, followed by screening for ampicillin sensitivity. The resulting plasmid (pVC31) was digested with AccIII and religated, thereby deleting one of the SacI sites, to obtain pVC50. Next, the 1,902-bp PstI-Mph1103I fragment of pACYC177 (Table 1) was cloned into the PstI site of pVC50, and selection on ampicillin plates resulted in pVC60, harboring ccmA to ccmF' with ccmE::kan. pVC60 was digested further with SacI and religated, thereby deleting the DNA fragment encoding the kanamycin resistance (Kmr) and reconstituting the gene ccmE. The resulting plasmid, pVC70, is a pBR322 derivative and harbors the 4,242-bp PstI-BamHI fragment encoding wild-type CcmA-E.

Construction of V. cholerae ccmE kan mutants. A DNA fragment harboring the kan gene encoding aminoglycoside 3'-phosphotransferase conferring kanamycin resistance (Kmr) was amplified by PCR using Taq polymerase, the primer pair Kan5'SacI (5' TAAGAGCTCGATCCTTCAACTCAGCAAAAG 3') and Kan3'SacI (5' TAAGAGCTCAATTCTGATTAGAAAAACTC 3'), and pACYC177 as template. The PCR product was digested with SacI and cloned into the SacI site of pVC5, thereby disrupting the ccmE gene. Kanamycin-resistant clones were analyzed for the orientation of kan with respect to the ccm genes. In pVC20, kan is oriented in the same direction as the ccm genes, and in pVC21, it is oriented in the opposite direction (Table 1). In both cases, the BamHI-XbaI fragment harboring ccmC, ccmD, and ccmE::kan was isolated and cloned into the BglII-NheI site of the suicide vector pGS284 (Table 1). The E. coli strain CC118{lambda}pir was transformed with the ligation products. Kanamycin-resistant strains harboring kan in the same or opposite orientation as the ccm genes were designated pVC12 or pVC13, respectively. E. coli S17{lambda}pir was transformed with these plasmids, and the resulting strains MB570 and MB571 were used as donor strains in biparental matings with V. cholerae. To obtain a marker of the recipient, the V. cholerae strain 2780-40 was plated on LB plates containing 40 µg ml–1 rifampin. Rifampin-resistant (Rifr) colonies occurred at a frequency of 8 x 10–8 cells. A Rifr colony was isolated, analyzed for wild-type ccmC-E by PCR with the primer pair VCCN-VCEC, and designated VC593. Strain VC593 was cross-streaked with strains MB570 and MB571 for conjugation on LB plates and incubated at 37°C overnight. Selection for conjugal transfer of pVC12 and pVC13 was done by plating dilutions of the cross-streaks on LB plates supplemented with kanamycin and rifampin. Over 500 colonies were obtained per mating experiment. Two colonies of each mating were purified and grown for 6 h in 5 ml of LB supplemented with kanamycin. Fifty µl per culture was plated on LB in the absence of NaCl but containing 5% (wt/vol) sucrose at 30°C, thereby selecting for loss of sacB (35). Sucrose-resistant colonies were further screened for kanamycin resistance and ampicillin sensitivity. Colony PCR with primer pair VCEN-VCEC was used to verify the presence of ccmE::kan and the absence of wild-type ccmE. Strains VC595 and VC596 have kan insertions in ccmE. For VC595, kan is oriented in the same direction as the ccm genes, whereas for VC596, kan is oriented in the opposite direction.

Transformation with plasmid DNA and transposon mutagenesis of V. cholerae. Transformation of V. cholerae with plasmid DNA was performed by electroporation as previously described by Marcus et al. (24).

Plasmid pNJ17 (20) was transformed into the E. coli donor strain S17{lambda}pir and used for transposon mutagenesis after conjugal transfer into either the pVC70-carrying strain VC593 or VC593. Colonies were screened for nitrate reductase deficiency as follows. They were overlaid with 5 ml of 50°C top agar (42) containing 10 mM KNO3. Plates were incubated for 15 min at room temperature. Equal volumes of Griess reagent (18) and melted 1.5% agarose in H2O were mixed, and 5 ml of the mixture was poured onto the plates. Nitrate reductase-positive colonies turned pink, while nitrate reductase-negative colonies remained white. Negative colonies were streaked to single colonies for purification and tested for cbb3 oxidase activity by overlaying them with a saturated solution of NNN'N'-tetramethyl-1,4-phenylene-diamine (TMPD) in 10% ethanol. Strains positive for cbb3 oxidase activity turned blue immediately, while negative strains remained white for about 1 min. DNA from mutants of interest was extracted by using a QIAamp DNA mini kit (QIAGEN) as described by the manufacturer. Arbitrary PCR was used to amplify the DNA flanking the transposon with primers pBADout2 (5'-CTGACGCTTTTTATCGCAAC-3') and ARB6 as described by O'Toole et al. (27) for the first round of PCR. A nested PCR was performed with primer pair pBADout3 (5'-CTCTCTACTGTTTCTCCATAC-3') and ARB2 (27), and PCR products were analyzed on and extracted from 1% agarose gels using NucleoSpin Extract (Macherey-Nagel, Oensingen, Switzerland). Subsequently, they were reamplified by PCR with primer pair pBADout3 and ARB2 and sequenced with primer pBADout3 by Microsynth (Balgach, Switzerland).

Cell fractionation. Periplasmic fractions were extracted with polymyxin B sulfate as described previously (12). Membrane fractions were purified from 10-ml cell cultures lysed by osmotic shock and subsequent centrifugation over a two-step sucrose gradient (200 µl of 65% sucrose over 600 µl of 25% sucrose) as previously described (5). Larger quantities of membranes were obtained from 200-ml cultures of V. cholerae lysed by three passages through a French pressure cell (12). DNase and RNase were added to 5 mg ml–1 in either case before centrifugation to get rid of some of the viscosity. Protein concentrations were determined with Coo Protein assay reagent (Interchim, Montluçon, France) using bovine serum albumin as the protein standard.

Determination of nitrate reductase activity and nitrite concentrations. Precultures were grown aerobically in LB at 37°C for 8 h. They were diluted 1:50 in 2 ml of fresh M63 medium supplemented with 0.2% glucose and 0.2% glycerol. Cultures were grown aerobically overnight in the absence or presence of 0.5 and 10 mM KNO3. Optical densities at 600 nm were determined, and supernatants were used for the determination of NO2– concentrations using fresh Griess reagent as described previously (18). Concentrations were calculated using a standard curve generated with solutions of known concentrations of NaNO2.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and heme stain. Protein samples were suspended in SDS loading dye and loaded without boiling onto SDS-15% polyacrylamide gels (22). Heme-binding proteins were detected in gels using their intrinsic peroxidase activity with o-dianisidine (Sigma Chemical Co., St. Louis, MO) and H2O2 as substrates as previously described (40).

Spectroscopic methods. Membrane fractions containing 5 mg protein were diluted in 1 ml Tris, pH 7.5, containing 1% Triton X-100. To eliminate insoluble precipitate, the solution was centrifuged for 1 min at full speed in a microcentrifuge. Spectra of samples containing 5 mg ml–1 protein and either oxidized by air or reduced with 1 mM sodium dithionite were recorded from 350 to 650 nm in 10-mm light path cuvettes with a Hitachi model U-3300 spectrophotometer in double-beam mode. Data were exported to Microsoft Excel, and difference spectra were calculated and saved as reduced-minus-oxidized spectra. Double difference spectra were calculated by subtracting the values of mutant difference spectra from those of the wild-type difference spectra.


arrow
RESULTS
 
Predicted c-type cytochromes of V. cholerae. The minimal sequence requirement for the conversion of apo- to holo-cytochrome c in vivo has been determined to be Cys-Xaa-Xaa-Cys-His (CXXCH) heme binding site following a signal sequence, which is required for targeting to the cell envelope (4, 6). The published sequences of both V. cholerae chromosomes and their derived proteomes (17) were analyzed for the existence of these motifs. A total of 48 CXXCH motifs were found in 31 proteins. Of these, 14 were predicted to have a cleavable or noncleavable N-terminal signal sequence and thus be targeted to the cell envelope (Table 2). Some of these are predicted to be components of respiratory chains using O2, NO3–, TMAO, and biotin sulfoxide as electron acceptors (Fig. 1). YhjA is predicted to be a peroxidase that may be required to overcome oxidative stress. The remaining six c-type cytochromes have significant homologues in other bacteria; however, their function is unknown.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Predicted heme c binding proteins of V. choleraea

Cytochrome c maturation in V. cholerae. The genes ccmA to ccmI (VC2057 to VC2049) are clustered on the large chromosome of V. cholerae and were expected to be required for cytochrome c maturation. The ccm genes of V. cholerae are arranged on the chromosome like those of E. coli, whereby the genes ccmI and ccmH of V. cholerae encode separate domains of the E. coli protein CcmH, which is probably encoded by a fused gene (46).

The heme chaperone CcmE is a key player in cytochrome c maturation and is required for heme delivery to cytochrome c (39). Like c-type cytochromes, it binds heme covalently, but at a single histidine residue rather than at a CXXCH motif and only transiently (39). We reasoned that by constructing a mutant deficient in cytochrome c maturation, it would be possible to block all of the cytochrome c-dependent respiratory chains of V. cholerae (Fig. 1) in one single step. Two mutants were constructed in the V. cholerae ccmE gene. A kanamycin-resistance cassette (kan) was ligated into the SacI restriction site of the ccmE gene that had been cloned from genomic DNA of V. cholerae 2740-80 into a suicide vector. Two constructs with kan oriented in either direction with respect to the ccmE gene were obtained. These constructs were then used for the disruption of the genomic ccmE gene by homologous recombination. As a result, two mutant strains that differed with regard to the orientation of the kanamycin-resistance gene were obtained. The strain with the kan gene insertion in the same orientation as ccmE was named VC595, while the one with the kan cassette in the opposite orientation was named VC596. These strains showed no growth defects in nutrient-rich LB medium, although the cell pellets were white, unlike those of the wild type, which were reddish. For further characterization, membrane fractions of the aerobically grown wild-type strain and the two ccmE mutants were analyzed for the presence of cytochromes c. Proteins were separated on a 15% denaturing SDS-polyacrylamide gel, and covalently bound heme was subsequently stained. In the wild-type strain VC593, a typical profile of at least six distinguishable heme-staining bands between 16 to 35 kDa was obtained in the membrane faction, and one was obtained in the soluble protein fraction (Fig. 2A, lanes 1 and 4). By contrast, in the ccmE-mutant strains VC595 and VC596, no heme-staining bands were visible when the same amount of protein was loaded, indicating the lack of c-type cytochromes in the strain. Additionally, reduced-minus-oxidized difference spectra of the membrane fractions were analyzed (Fig. 2B). In the wild type, peaks typical for cytochromes were found at 428.5 nm ({gamma} peak), 523.5 nm (ß peak), and 553.5 nm ({alpha} peak), with a shoulder at 560 nm. This is characteristic for membranes containing both b- and c-type cytochromes, because the former have maxima in the range of 560 nm, whereas the latter have maxima at ~550 nm. The maxima found for the {gamma} (431.5 nm), ß (534 nm), and {alpha} (562.5 nm) absorption peaks of the mutant strain were typical for b-type cytochromes. To assess the difference between the wild type and the ccmE mutant, the difference spectrum of the mutant strain was subtracted from that of the wild type, resulting in a "double difference spectrum" with {gamma} (422 nm), ß (522.5 nm), and {alpha} (552.5 nm) peaks typical of c-type cytochromes (Fig. 2B, inset). In conclusion, ccmE mutants are able to synthesize b-type but not c-type cytochromes.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 2. CcmE is required for cytochrome c maturation in V. cholerae. (A) Heme stain of membrane (lanes 1 to 3) and soluble (lanes 4 to 6) proteins (100 µg per lane) of wild-type strain VC593 (lanes 1 and 4) and ccmE-mutant strains VC595 (lanes 2 and 5) and VC596 (lanes 3 and 6) separated by SDS-15% PAGE. Molecular mass marker bands (in kilodaltons) are indicated on the left. (B) Optical difference spectra of membrane proteins (5 mg ml–1) in 50 mM Tris, pH 7.5. Dithionite-reduced minus air-oxidized spectra of the wild-type strain VC593 and the ccmE-mutant VC595 are shown. The difference spectrum of VC595 was subtracted from that of VC593, resulting in the double difference spectrum (dd). Inset, the {alpha}/ß region at a higher magnification.

Complementation of the ccmE mutant and heme-binding properties of CcmE. The ccmE mutants VC595 and VC596 were complemented with a plasmid from which either V. cholerae or E. coli ccmE was expressed. Complementation was fully successful for VC595 with the V. cholerae ccmE, and at low levels even with the E. coli ccmE, whereas it was not possible for VC596. This indicated that the cassette insertion in VC596 had a polar effect on the downstream genes ccmFGH and ccmI (data not shown).

We also tested whether CcmE binds heme, as has been previously described for CcmE of B. japonicum (41) and Arabidopsis thaliana (45) expressed in E. coli. For this purpose, plasmids pVC60 and pVC70 harboring ccmA-D with ccmE::kan and wild-type ccmA-E were constructed. E. coli strain EC06, which has a deletion of the entire ccm operon, was transformed with pVC11 (ccmE), pVC5 (ccmCDE), pVC60 (ccmA-D), pVC70 (ccmA-E), and, as a control, pEC406 (E. coli ccmCDE), and membranes were analyzed for proteins containing covalently bound heme. As with E. coli CcmE (38) (Fig. 3, lane 5), heme binding to V. cholerae CcmE was possible only when CcmABCD were coexpressed (Fig. 3, lane 3) and, more specifically, when CcmCD were present (lane 4). The characteristics of V. cholerae CcmE thus are very similar to the ones known for E. coli CcmE.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 3. CcmE of V. cholerae binds heme in the presence of CcmA-D. E. coli EC06 ({Delta}ccmA-H) was transformed with plasmids encoding the V. cholerae (Vc) proteins CcmE (pVC11, lane 1), CcmA-D (pVC60, lane 2), CcmA-E (pVC70, lane 3), and CcmC-E (pVC5, lane 4) or the E. coli (Ec) proteins CcmC-E (pEC406, lane 5) as the control.

Physiological characteristics of cytochrome c-deficient V. cholerae. The V. cholerae genome comprises a whole set of genes encoding proteins involved in respiratory electron transfer. Some of these proteins are c-type cytochromes (Fig. 1 and Table 2) whose biosynthesis depends on a functional cytochrome c maturation system.

To determine which respiratory chains are active, V. cholerae VC593 (wild type) and VC596 (ccmE::kan) were grown under anaerobic conditions in minimal medium containing glycerol as a nonfermentable carbon source in the presence of a single electron acceptor. Cultures were grown in triplicate in 10-ml sealed glass tubes, and growth was monitored by measuring the optical density at 600 nm. Growth of the wild-type strain VC593 in the presence of fumarate as electron acceptor, which does not require electron transport via c-type cytochromes, was set at 100% (Fig. 4A). As a negative control, strains were incubated in the absence of electron acceptors, and, as expected, no growth was detected for these cultures. In the presence of DMSO, TMAO, or fumarate, the growth phenotypes of wild-type and ccmE-mutant V. cholerae corresponded well with the predicted phenotypes (Fig. 1 and 4A; Table 2).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 4. Respiratory chains present in V. cholerae. (A) Anaerobic growth of the wild-type strain VC593 (open bars) and ccmE-mutant strain VC596 (black bars) in M63 containing 0.2% glycerol and the indicated final electron acceptors (blank, no electron acceptor; Fum, fumarate). Growth of the wild-type strain in the presence of fumarate was taken as 100%. The average growth of three independent cultures is shown, and standard deviations are indicated. (B) Nitrite accumulation. Wild-type VC593 (open bars) and ccmE-mutant VC596 (black bars) strains were grown aerobically in M63 medium containing 0.2% glucose and 0.2% glycerol in the presence of the KNO3 concentrations indicated. Nitrite accumulation was determined after overnight growth at 37°C.

Despite the presence of the napABCDE genes (Table 2), which encode a periplasmic nitrate reductase, none of the strains was able to grow on nitrate (NO3–) (Fig. 4A). A closer look at the genome revealed the lack of genes for a classic nitrite (NO2–) reductase. This suggested that nitrite, which is toxic, may accumulate as the product of the Nap-catalyzed reduction of nitrate and prevent further growth. To test whether nitrite is toxic, the wild-type strain was grown aerobically for 8 h in liquid M63 medium (42) in the presence of 0.2% glucose and 0.2% glycerol containing from 0.078 to 5 mM concentrations of nitrite. A toxic effect was visible at nitrite concentrations above 0.3 mM, and growth diminished completely at a nitrite concentration of 2.5 mM (data not shown). Nitrite accumulation was determined for VC593 and VC596 grown aerobically overnight in M63 medium supplemented with 0.2% glucose and 0.2% glycerol in the presence and absence of KNO3 (0.5 and 10 mM). Nitrite concentrations were determined with the Griess reaction (18). While no nitrite accumulated in the ccmE-mutant VC596 (or VC595; data not shown), nitrite concentrations of up to 6 mM accumulated during growth of the wild type (Fig. 4B). Hence, in the presence of nitrate, a cytochrome c-deficient mutant survives because it does not accumulate nitrite.

V. cholerae is predicted to have at least three oxidases (one cbb3- and two bd-type oxidases) that are able to use O2 as the terminal electron acceptor (Fig. 1). Of these oxidases, only the high-affinity cbb3-type heme copper oxidase contains c-type cytochrome subunits. The cbb3-type oxidase consists of the proteins CcoNOQP, with the c-type cytochromes CcoO and CcoP. This oxidase transports electrons from the bc1 complex, which also contains the c-type cytochrome c1, to O2 (21). However, it is unknown whether another c-type cytochrome shuttles electrons from cytochrome c1 to the CcoP and CcoO subunits of the heme copper oxidase. Apparently, NNN'N'-tetramethyl-1,4-phenylene-diamine (TMPD) is able to substitute the bc1 complex in this reaction and acts as an electron donor to the cbb3-type oxidase (21). Oxidation of TMPD results in a deep blue color due to the resulting indophenol that can be seen in colonies treated with TMPD. While the wild-type strain VC593 turned blue when exposed to a saturated solution of TMPD in 10% EtOH (TMPD-positive phenotype), the ccmE-mutant strains VC595 and VC596 remained white (TMPD-negative phenotype).

Screening for cytochrome c-deficient V. cholerae. After having shown that the c-type cytochrome subunits of the cbb3 oxidase and the periplasmic nitrate reductase depend on the cytochrome c maturation proteins, we next attempted to find new factors involved in cytochrome c maturation by using a random mutagenesis approach. V. cholerae wild-type strain VC593 was randomly mutagenized with the transposon TnAraOut. TnAraOut has previously been used to identify essential genes of V. cholerae by transcriptionally fusing them to an outward-facing, arabinose-inducible promoter, PBAD, located at one end of the transposon (20). Over 55,000 transposon mutants were screened for deficiency in nitrate reductase and TMPD oxidase. In summary, a total of 25 strains that were negative for both nitrate reductase and TMPD oxidase activity were isolated. One representative mutant per identified gene is shown in Table 3. The majority of these mutants had transposon insertions within genes previously known to be required for cytochrome c biogenesis, i.e., the ccm genes and dsbD (10, 47). Interestingly, the transposon insertion found 5 bp upstream of ccmA resulted in an arabinose-dependent phenotype. In the presence of 0.01% arabinose, nitrate reductase activity was restored.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Representatives of nitrate reductase and TMPD oxidase negative strains generated by TnAraOut insertions

In addition to mutants with both nitrate reductase and TMPD oxidase deficiencies, some mutants which had either nitrate reductase (TNV103) or TMPD oxidase (TNV92, TNV93, and TNV97) deficiencies also were isolated. Table 3 shows that they mapped to VC1024 (moaA) or VC1435, VC1437 (ccoI), and VC1441 (ccoO), respectively. VC1435 is an unknown membrane protein.

We also took advantage of some of the obtained mutants to identify some of the c-type cytochromes visible in the membranes after separation by SDS-PAGE and heme staining. The profiles of c-type cytochromes detected in membranes from the strains were compared with those of the wild-type strain VC593 (Fig. 5). For the wild type, at least six distinguishable bands were visible. Two of these bands were missing in the ccoO-mutant TNV97. The bands correspond to the expected size of the c-type cytochromes CcoP (35.8 kDa) and CcoO (23.6 kDa). The ccoO insertion in TNV97 is expected to be polar on the downstream gene VC1439 (ccoP). Therefore, the c-type cytochrome encoded by ccoP is also missing in this mutant. In contrast, the transposon insertions of strains TNV93 and TNV92 are in genes located further downstream; their cytochrome c profiles are identical to that of the wild type. This indicates that the proteins encoded by VC1437 and VC1435 are required for cbb3 oxidase activity but not for maturation of the c-type cytochromes CcoP and CcoO.



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 5. Type c cytochromes of mutant V. cholerae strains. Membrane extracts containing 200 µg protein of the indicated strains were separated by SDS-PAGE in a 15% polyacrylamide gel. The gel was treated with o-dianisidine and H2O2 to identify polypeptides possessing covalently bound heme groups. The electrophoretic mobility of marker proteins is indicated on the left. The positions of CcoP and CcoO are indicated on the right.

In the ccmF mutant, no heme staining band was visible, i.e., all c-type cytochromes were absent. The CcmE heme chaperone was not detectable, indicating that chromosomal ccmE expression was too low for the gene product to be detectable. No bands were visible in the ccmE-mutant VC595 or in the dsbD-mutant TNV74. These genes thus are essential for the maturation of all c-type cytochromes detected.

The moaA-mutant TNV103 was missing the largest c-type cytochrome visible on the gel (Fig. 5). This band may correspond to YecK (40.8 kDa) which together with BisZ forms the biotin sulfoxide reductase. BisZ shares homology with the DMSO reductase family of the molybdoenzymes, has a twin arginine (Tat) signal sequence, and is expected to be translocated through the cytoplasmic membrane via the Tat translocon (15). The defect in molybdopterin biogenesis in TNV103 is expected to disable BisZ maturation and secretion to the cell envelope (29). In the absence of BisZ, YecK may be degraded, or expression of YecK may be repressed. Besides the lack of this c-type cytochrome in strain TNV103, two other c-type cytochromes, running at about 20 to 23 kDa, were induced. The identities of these are unknown. Predicted c-type cytochromes of the expected sizes are CcoO (23.6 kDa), NapC (21.4 kDa), and CycA (19.8 kDa) (Table 3).


arrow
DISCUSSION
 
CcmE is a heme chaperone required for biogenesis of c-type cytochromes. CcmE of E. coli binds heme covalently at the ß-carbon of a heme vinyl group via a strictly conserved histidine (23, 39). From CcmE, heme is then delivered to the c-type cytochromes. Here, we show that V. cholerae CcmE is similar to E. coli CcmE in that it also binds heme covalently and is required for cytochrome c maturation. Also, the CcmCD proteins are essential for the unusual binding of heme by CcmE. Furthermore, CcmE of E. coli is able to complement a ccmE-mutant V. cholerae for cytochrome c maturation, albeit not at 100%. This indicates that CcmE of E. coli can interact with CcmC and CcmF of V. cholerae to transfer heme to the c-type cytochromes, as was proposed for the E. coli cytochrome c maturation system (33, 34).

The regulation of cytochrome c biogenesis in V. cholerae is different from that of E. coli. E. coli produces c-type cytochromes only under anaerobic growth conditions, while wild-type V. cholerae produces at least six c-type cytochromes when grown aerobically in nutrient-rich medium. The V. cholerae ccmE mutants lack all c-type cytochromes. The physiological role of the V. cholerae c-type cytochromes was assessed by a comparison of the wild-type strain with the ccmE mutant. When both the wild type and the mutant were grown in LB, no difference in growth was observed. In accordance with the protein sequences predicted from the translated genome, the wild-type was able to use fumarate and TMAO as electron acceptors during respiration in the absence of O2. By contrast, the mutant strain VC596 was unable to grow on TMAO, probably because neither the TorC nor the YecK (TorY) c-type cytochrome was matured. Unlike E. coli, which is known to produce a c-type cytochrome-independent TMAO reductase (3), V. cholerae does not harbor the genes for this type of c-type cytochrome-independent TMAO reductase. Thus, in V. cholerae, c-type cytochromes are essential for respiration on TMAO.

V. cholerae harbors the genes encoding the periplasmic nitrate reductase NapABCFGH, but it lacks genes for a NarGHI-like nitrate reductase (7). We found that V. cholerae was not able to grow on NO3– as the sole electron acceptor and interpreted this to be the result of accumulation of NO2–. NO2– is toxic to V. cholerae, because the organism also lacks the genes for nitrite reductase, which are present in E. coli (7). Of the bacterial genomes sequenced to date and published on the TIGR homepage (http://www.tigr.org), the pathogens Bordetella bronchiseptica and Bordetella parapertussis are the only ones like V. cholerae, which harbors genes encoding a periplasmic nitrate reductase but lack genes for nitrite reductases. This implies that these bacteria are not able to use nitrate as a source of nitrogen. Additionally, some Rhodobacter sphaeroides strains have been reported to produce a Nap-type nitrate reductase but to lack a nitrite reductase (13). For these strains, the Nap system was shown to be involved in redox balancing during metabolic conditions, such as phototrophic growth on reduced carbon substrates, thereby generating an excess of reductant (13). The function of the periplasmic nitrate reductase of V. cholerae is unclear, but perhaps it allows scavenging nitrate from nitrogen-limiting environments in the presence of other (micro-) organisms which are able to detoxify nitrite by reduction to ammonia.

The cytochrome c maturation pathway is not yet understood completely. While apo-cytochrome c has been shown to cross the cytoplasmic membrane via the Sec translocon (48), it is still unknown how heme reaches the periplasm. We have confirmed in this work that in V. cholerae, as in E. coli, the Ccm proteins are required for cytochrome c maturation. Two of the Ccm proteins, CcmA and CcmB, are predicted to form an ABC transporter, the substrate of which still is unknown, but there is circumstantial evidence that the transported substrate is not heme (8, 14). As it is not certain that all genes required directly or indirectly for cytochrome c biogenesis are already known, we combined two screening procedures, using nitrate reductase and cbb3 oxidase activity that can be detected by colony staining of V. cholerae. These activities have a common requirement for c-type cytochromes. The wild-type strain VC593 was mutagenized with the transposon TnAraOut (20), and ~55,000 colonies were screened initially for nitrate reductase activity and then for cbb3 oxidase activity or vice versa. Mutations inactivating genes that are required only for one of these activities, e.g., the structural genes of nitrate reductase, are excluded in the combined test. This increases the chance of finding genes required for cytochrome c maturation. DNA flanking the transposon insertion of candidates was sequenced. The mutagenesis seemed to be slightly biased; ccmE was hit four times while ccmH was never hit. Besides finding transposon insertions upstream of ccmA, within ccmB, ccmC, ccmE, ccmF, and ccmG, we also found mutants with transposon insertions within dsbD. DsbD and its homologues are capable of transporting disulfide bonds across the membrane and have previously been shown to be required for cytochrome c maturation in gram-negative bacteria (26, 28). No new genes specifically required for cytochrome c maturation were found in our screening. This may be due to the incomplete randomness of the transposon insertions, or the already identified cytochrome c maturation factors may represent the complete set of proteins specifically needed for this process. Alternatively, if an as-yet-unknown heme transporter exists for the transfer of heme from the cytoplasm to the periplasm (14), the same transporter may also be used to translocate heme to the outer leaflet of the cytoplasmic membrane before the cofactor is inserted into respiratory enzymes, such as the bc1 complex, the cbb3 oxidase subunit I, or the bd oxidases. Such a transporter would then be essential for aerobic growth, and mutants would be obtainable only as conditional ones. The selection of the transposon TnAraOut for mutagenesis would allow the isolation of conditional mutants when mutants are plated on medium containing arabinose.

Our screening revealed one novel gene, VC1435. It is located towards the 3' end of the gene cluster containing the structural and accessory genes for the cbb3 oxidase. The encoded protein shares low but apparently significant similarity with one domain of DsbD and CcdA (http://www.expasy.ch), the latter being a cytochrome c biogenesis factor that was first identified in Bacillus subtilis and later in Rhodobacter capsulatus and is not present in E. coli (11, 36). It is interesting that in V. cholerae, DsbD is essential for maturation of all c-type cytochromes, whereas VC1435 apparently is needed only for assembly of the cbb3 oxidase. However, in this mutant, heme is still incorporated into the c-type cytochrome subunits CcoO and CcoP. Hence, VC1435 must have another role in biogenesis or assembly of the cbb3-type heme copper oxidase, perhaps at the step of introducing the copper cofactor into the subunit I (CcoN).

In summary, electron transport chains that use O2, fumarate, TMAO, and nitrate as terminal electron acceptors are active in V. cholerae. CcoO and CcoP are two of the major c-type cytochromes expressed under aerobic conditions in nutrient-rich medium. While V. cholerae has both cytochrome c-dependent and -independent electron transport chains required for O2 respiration, respiration on fumarate does not, and respiration on TMAO does require c-type cytochromes. Respiration on nitrate requires c-type cytochromes; the resulting nitrite, however, cannot be further metabolized, and its toxic effect prevents further growth. Increasing knowledge of the physiology will result in a better understanding of how V. cholerae can adapt to the diverse environmental conditions it thrives in.


arrow
ACKNOWLEDGMENTS
 
We thank Su L. Chiang for providing us with pNJ17, Harvey Kimsey for providing us with V. cholerae 2740-80, and Daniela Bischof and Karin Fischer for help with cloning and transposon mutagenesis. We also thank Umesh Ahuja and Olaf Christensen for in-depth discussions.

This work was supported by the Swiss National Foundation for Scientific Research.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institut für Mikrobiologie, ETH Hönggerberg, Wolfgang-Pauli-Str. 10, 8093 Zürich, Switzerland. Phone: 41-1-6323551. Fax: 41-1-6321148. E-mail: mbraun{at}micro.biol.ethz.ch. Back


arrow
REFERENCES
 
    1
  1. Almeida, R. J., D. N. Cameron, W. L. Cook, and I. K. Wachsmuth. 1992. Vibriophage VcA-3 as an epidemic strain marker for the U.S. Gulf Coast Vibrio cholerae O1 clone. J. Clin. Microbiol. 30:300-304.[Abstract/Free Full Text]
    2. 2
  2. Arslan, E., H. Schulz, R. Zufferey, P. Künzler, and L. Thöny-Meyer. 1998. Overproduction of the Bradyrhizobium japonicum c-type cytochrome subunits of the cbb3 oxidase in Escherichia coli. Biochem. Biophys. Res. Commun. 251:744-747.[CrossRef][Medline]
    3. 3
  3. Bilous, P. T., and J. H. Weiner. 1988. Molecular cloning and expression of the Escherichia coli dimethyl sulfoxide reductase operon. J. Bacteriol. 170:1511-1518.[Abstract/Free Full Text]
    4. 4
  4. Braun, M., I. García Rubio, and L. Thöny-Meyer. 2005. A heam tag for in vivo synthesis of artificial cytochromes. Appl. Microbiol. Biotechnol. 67:234-239.[CrossRef][Medline]
    5. 5
  5. Braun, M., and T. J. Silhavy. 2002. Imp/OstA is required for cell envelope biogenesis in Escherichia coli. Mol. Microbiol. 45:1289-1302.[CrossRef][Medline]
    6. 6
  6. Braun, M., and L. Thöny-Meyer. 2004. Biosynthesis of artificial microperoxidases by exploiting the secretion and cytochrome c maturation apparatuses of Escherichia coli. Proc. Natl. Acad. Sci. USA 101:12830-12835.[Abstract/Free Full Text]
    7. 7
  7. Cole, J. 1996. Nitrate reduction to ammonia by enteric bacteria: redundancy, or a strategy for survival during oxygen starvation? FEMS Microbiol. Lett. 136:1-11.[CrossRef][Medline]
    8. 8
  8. Cook, G. M., and R. K. Poole. 2000. Oxidase and periplasmic cytochrome assembly in Escherichia coli K-12: CydDC and CcmAB are not required for haem-membrane association. Microbiology 146:527-536.[Abstract/Free Full Text]
    9. 9
  9. Cosseau, C., and J. Batut. 2004. Genomics of the ccoNOQP-encoded cbb3 oxidase complex in bacteria. Arch. Microbiol. 181:89-96.[CrossRef][Medline]
    10. 10
  10. Crooke, H., and J. Cole. 1995. The biogenesis of c-type cytochromes in Escherichia coli requires a membrane-bound protein, DipZ, with a protein disulphide isomerase-like domain. Mol. Microbiol. 15:1139-1150.[Medline]
    11. 11
  11. Deshmukh, M., G. Brasseur, and F. Daldal. 2000. Novel Rhodobacter capsulatus genes required for the biogenesis of various c-type cytochromes. Mol. Microbiol. 35:123-138.[CrossRef][Medline]
    12. 12
  12. Enggist, E., M. J. Schneider, H. Schulz, and L. Thöny-Meyer. 2003. Biochemical and mutational characterization of the heme chaperone CcmE reveals a heme binding site. J. Bacteriol. 185:175-183.[Abstract/Free Full Text]
    13. 13
  13. Gavira, M., M. D. Roldan, F. Castillo, and C. Moreno-Vivian. 2002. Regulation of nap gene expression and periplasmic nitrate reductase activity in the phototrophic bacterium Rhodobacter sphaeroides DSM158. J. Bacteriol. 184:1693-1702.[Abstract/Free Full Text]
    14. 14
  14. Goldman, B. S., and R. G. Kranz. 2001. ABC transporters associated with cytochrome c biogenesis. Res. Microbiol. 152:323-329.[Medline]
    15. 15
  15. Gon, S., J.-C. Patte, V. Mejean, and C. Iobbi-Nivol. 2000. The torYZ (yecK bisZ) operon encodes a third respiratory trimethylamine N-oxide reductase in Escherichia coli. J. Bacteriol. 182:5779-5786.[Abstract/Free Full Text]
    16. 16
  16. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580.[Medline]
    17. 17
  17. Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, L. Umayam, S. R. Gill, K. E. Nelson, T. D. Read, H. Tettelin, D. Richardson, M. D. Ermolaeva, J. Vamathevan, S. Bass, H. Qin, I. Dragoi, P. Sellers, L. McDonald, T. Utterback, R. D. Fleishmann, W. C. Nierman, and O. White. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477-483.[CrossRef][Medline]
    18. 18
  18. Hevel, J. M., and M. A. Marletta. 1994. Nitric-oxide synthase assays. Methods Enzymol. 233:250-258.[Medline]
    19. 19
  19. Hwang, D. S., B. Thöny, and A. Kornberg. 1992. IciA protein, a specific inhibitor of initiation of Escherichia coli chromosomal replication. J. Biol. Chem. 267:2209-2213.[Abstract/Free Full Text]
    20. 20
  20. Judson, N., and J. J. Mekalanos. 2000. TnAraOut, a transposon-based approach to identify and characterize essential bacterial genes. Nat. Biotechnol. 18:740-745.[CrossRef][Medline]
    21. 21
  21. Keefe, R. G., and R. J. Maier. 1993. Purification and characterization of an O2-utilizing cytochrome-c oxidase complex from Bradyrhizobium japonicum bacteroid membranes. Biochim. Biophys. Acta 1183:91-104.[Medline]
    22. 22
  22. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
    23. 23
  23. Lee, D., K. Pervushin, D. Bischof, M. Braun, and L. Thöny-Meyer. 2005. Unusual heme-histidine bond in the active site of a chaperone. J. Am. Chem. Soc. 127:3716-3717.[CrossRef][Medline]
    24. 24
  24. Marcus, H., J. M. Ketley, J. B. Kaper, and R. K. Holmes. 1990. Effects of DNase production, plasmid size, and restriction barriers on transformation of Vibrio cholerae by electroporation and osmotic shock. FEMS Microbiol. Lett. 56:149-154.[Medline]
    25. 25
  25. Meissner, P. S., W. P. Sisk, and M. L. Berman. 1987. Bacteriophage lambda cloning system for the construction of directional cDNA libraries. Proc. Natl. Acad. Sci. USA 84:4171-4175.[Abstract/Free Full Text]
    26. 26
  26. Metheringham, R., K. L. Tyson, H. Crooke, D. Missiakas, S. Raina, and J. A. Cole. 1996. Effects of mutations in genes for proteins involved in disulphide bond formation in the periplasm on the activities of anaerobically induced electron transfer chains in Escherichia coli K12. Mol. Gen. Genet. 253:95-102.[Medline]
    27. 27
  27. O'Toole, G. A., L. A. Pratt, P. I. Watnick, D. K. Newman, V. B. Weaver, and R. Kolter. 1999. Genetic approaches to study of biofilms. Methods Enzymol. 310:91-109.[CrossRef][Medline]
    28. 28
  28. Page, M. D., N. F. Saunders, and S. J. Ferguson. 1997. Disruption of the Pseudomonas aeruginosa dipZ gene, encoding a putative protein-disulfide reductase, leads to partial pleiotropic deficiency in c-type cytochrome biogenesis. Microbiology 143:3111-3122.[Abstract/Free Full Text]
    29. 29
  29. Palmer, T., and B. C. Berks. 2003. Moving folded proteins across the bacterial cell membrane. Microbiology 149:547-556.[Abstract/Free Full Text]
    30. 30
  30. Pearson, G. D., A. Woods, S. L. Chiang, and J. J. Mekalanos. 1993. CTX genetic element encodes a site-specific recombination system and an intestinal colonization factor. Proc. Natl. Acad. Sci. USA 90:3750-3754.[Abstract/Free Full Text]
    31. 31
  31. Pitcher, R. S., and N. J. Watmough. 2004. The bacterial cytochrome cbb3 oxidases. Biochim. Biophys. Acta 1655:388-399.[Medline]
    32. 32
  32. Preisig, O., R. Zufferey, L. Thöny-Meyer, C. A. Appleby, and H. Hennecke. 1996. A high-affinity cbb3-type cytochrome oxidase terminates the symbiosis-specific respiratory chain of Bradyrhizobium japonicum. J. Bacteriol. 178:1532-1538.[Abstract/Free Full Text]
    33. 33
  33. Ren, Q., U. Ahuja, and L. Thöny-Meyer. 2002. A bacterial cytochrome c heme lyase. CcmF forms a complex with the heme chaperone CcmE and CcmH but not with apocytochrome c. J. Biol. Chem. 277:7657-7663.[Abstract/Free Full Text]
    34. 34
  34. Ren, Q., and L. Thöny-Meyer. 2001. Physical interaction of CcmC with heme and the heme chaperone CcmE during cytochrome c maturation. J. Biol. Chem. 276:32591-32596.[Abstract/Free Full Text]
    35. 35
  35. Ried, J. L., and A. Collmer. 1987. An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in Gram-negative bacteria by marker exchange-eviction mutagenesis. Gene 57:239-246.[CrossRef][Medline]
    36. 36
  36. Schiött, T., C. von Wachenfeldt, and L. Hederstedt. 1997. Identification and characterization of the ccdA gene, required for cytochrome c synthesis in Bacillus subtilis. J. Bacteriol. 179:1962-1973.[Abstract/Free Full Text]
    37. 37
  37. Schoolnik, G. K., and F. H. Yildiz. 2000. The complete genome sequence of Vibrio cholerae: a tale of two chromosomes and of two lifestyles. Genome Biol. 1:1016.1-1016.3.
    38. 38
  38. Schulz, H., R. A. Fabianek, E. C. Pellicioli, H. Hennecke, and L. Thöny-Meyer. 1999. Heme transfer to the heme chaperone CcmE during cytochrome c maturation requires the CcmC protein, which may function independently of the ABC-transporter CcmAB. Proc. Natl. Acad. Sci. USA 96:6462-6467.[Abstract/Free Full Text]
    39. 39
  39. Schulz, H., H. Hennecke, and L. Thöny-Meyer. 1998. Prototype of a heme chaperone essential for cytochrome c maturation. Science 281:1197-1200.[Abstract/Free Full Text]
    40. 40
  40. Schulz, H., E. C. Pellicioli, and L. Thöny-Meyer. 2000. New insights into the role of CcmC, CcmD and CcmE in the haem delivery pathway during cytochrome c maturation by a complete mutational analysis of the conserved tryptophan-rich motif of CcmC. Mol. Microbiol. 37:1379-1388.[CrossRef][Medline]
    41. 41
  41. Schulz, H., and L. Thöny-Meyer. 2000. Interspecies complementation of Escherichia coli ccm mutants: CcmE (CycJ) from Bradyrhizobium japonicum acts as a heme chaperone during cytochrome c maturation. J. Bacteriol. 182:6831-6833.[Abstract/Free Full Text]
    42. 42
  42. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
    43. 43
  43. Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:787-796.
    44. 44
  44. Smith, G. A., and L. W. Enquist. 1999. Construction and transposon mutagenesis in Escherichia coli of a full-length infectious clone of pseudorabies virus, an alphaherpesvirus. J. Virol. 73:6405-6414.[Abstract/Free Full Text]
    45. 45
  45. Spielewoy, N., H. Schulz, J. M. Grienenberger, L. Thöny-Meyer, and G. Bonnard. 2001. CCME, a nuclear-encoded heme-binding protein involved in cytochrome c maturation in plant mitochondria. J. Biol. Chem. 276:5491-5497.[Abstract/Free Full Text]
    46. 46
  46. Thöny-Meyer, L. 1997. Biogenesis of respiratory cytochromes in bacteria. Microbiol. Mol. Biol. Rev. 61:337-376.[Abstract]
    47. 47
  47. Thöny-Meyer, L., F. Fischer, P. Künzler, D. Ritz, and H. Hennecke. 1995. Escherichia coli genes required for cytochrome c maturation. J. Bacteriol. 177:4321-4326.[Abstract/Free Full Text]
    48. 48
  48. Thöny-Meyer, L., and P. Künzler. 1997. Translocation to the periplasm and signal sequence cleavage of preapocytochrome c depend on sec and lep, but not on the ccm gene products. Eur. J. Biochem. 246:794-799.[Medline]
    49. 49
  49. World Health Organization. 2000. Cholera. Fact sheet no. 107. World Health Organization, Geneva, Switzerland. [Online.] http://www.who.int/mediacentre/factsheets/fs107/en/.

Journal of Bacteriology, September 2005, p. 5996-6004, Vol. 187, No. 17
0021-9193/05/$08.00+0     doi:10.1128/JB.187.17.5996-6004.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braun, M.
Right arrow Articles by Thöny-Meyer, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braun, M.
Right arrow Articles by Thöny-Meyer, L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»