This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huet, G.
Right arrow Articles by Saves, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huet, G.
Right arrow Articles by Saves, I.

 Previous Article  |  Next Article 

Journal of Bacteriology, September 2005, p. 6137-6146, Vol. 187, No. 17
0021-9193/05/$08.00+0     doi:10.1128/JB.187.17.6137-6146.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Identification of the Mycobacterium tuberculosis SUF Machinery as the Exclusive Mycobacterial System of [Fe-S] Cluster Assembly: Evidence for Its Implication in the Pathogen's Survival

Gaëlle Huet, Mamadou Daffé, and Isabelle Saves*

Department of Molecular Mechanisms of Mycobacterial Infections, Institut de Pharmacologie et Biologie Structurale (UMR5089), C.N.R.S./Université Paul Sabatier Toulouse III, 205 Route de Narbonne, F-31077 Toulouse Cedex, France

Received 7 March 2005/ Accepted 13 June 2005


arrow
ABSTRACT
 
The worldwide recrudescence of tuberculosis and widespread antibiotic resistance have strengthened the need for the rapid development of new antituberculous drugs targeting essential functions of its etiologic agent, Mycobacterium tuberculosis. In our search for new targets, we found that the M. tuberculosis pps1 gene, which contains an intein coding sequence, belongs to a conserved locus of seven open reading frames. In silico analyses indicated that the mature Pps1 protein is orthologous to the SufB protein of many organisms, a highly conserved component of the [Fe-S] cluster assembly and repair SUF (mobilization of sulfur) machinery. We showed that the mycobacterial pps1 locus constitutes an operon which encodes Suf-like proteins. Interactions between these proteins were demonstrated, supporting the functionality of the M. tuberculosis SUF system. The noticeable absence of any alternative [Fe-S] cluster assembly systems in mycobacteria is in agreement with the apparent essentiality of the suf operon in Mycobacterium smegmatis. Altogether, these results establish that Pps1, as a central element of the SUF system, could play an essential function for M. tuberculosis survival virtually through its implication in the bacterial resistance to iron limitation and oxidative stress. As such, Pps1 may represent an interesting molecular target for new antituberculous drugs.


arrow
INTRODUCTION
 
According to the World Health Organization (http://www.who.int/en/), tuberculosis remains a major public health threat as a first-line infectious disease responsible for 2 to 3 million deaths worldwide annually. Furthermore, the recent recrudescence of infections with Mycobacterium tuberculosis, the causative agent of tuberculosis, is associated with the emergence of multidrug-resistant strains, which has strengthened the need for the rapid development of new antituberculous drugs. The discovery of essential functions of mycobacteria in pathways other than those targeted by present antibiotics appears thus to be necessary to efficiently fight tuberculosis.

One singularity of the M. tuberculosis genome is the presence of intein insertion sequences in three genes, namely recA, dnaB, and pps1 (6, 9, 34). While the specificity of the recA and pps1 inteins of M. tuberculosis has been readily applied to the diagnosis of tuberculosis by PCR (46), the presence of an intein in a mycobacterial protein can present additional interest. Effectively, inteins are proteins embedded in-frame in a host protein; they are autocatalytically and posttranscriptionally excised from the peptide precursor to produce the functional host protein (26). Hence, the impediment of the protein splicing of a mycobacterial protein involved in a critical cellular process could represent an unusual way to kill M. tuberculosis (4, 8, 33).

Among the intein-containing proteins, the mycobacterial RecA recombinase, while directly implied in DNA repair and homologous recombination (15, 31, 43), is not essential for the survival of Mycobacterium bovis BCG in a mouse infection model (43). An essential role of the M. tuberculosis DnaB helicase is more likely, based on the fact that DnaB is an essential component of the chromosome replication process in the pathogen Helicobacter pylori, as in Escherichia coli (42, 47). The function of the protein Pps1, which is coded by the pps1 gene and numbered Rv1461 according to M. tuberculosis genome annotation (6), remained unknown. Accordingly, the aim of this study was thus to bring to light the function of this presumably important protein. Bioinformatic analysis, combined with biochemical and genetic studies, allowed us to demonstrate that the pps1 locus of genes is an operon which encodes the M. tuberculosis SUF (mobilization of sulfur) machinery, with the pps1 gene encoding the central SufB element. In agreement with the apparent essentiality of the mycobacterial suf operon, the SUF system appeared to be the unique machinery of [Fe-S] cluster assembly and/or repair in mycobacteria.


arrow
MATERIALS AND METHODS
 
Sequence homology research. The genome sequence of Mycobacterium tuberculosis H37Rv is available at the Pasteur Institute website (http://genolist.pasteur.fr/TubercuList/). Research of protein orthologs in different genomes was performed using the genomic BLAST program at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi). The clusters of orthologous groups of proteins (COG) are available at the NCBI website (http://www.ncbi.nlm.nih.gov/COG/).

Bacterial strains and culture conditions. Mycobacterium smegmatis mc2155 was grown at 37°C or 42°C in Tryptone-Soja medium (Difco) supplemented with 60 µg/ml kanamycin, 50 µg/ml hygromycin, 15 µg/ml gentamicin, 0.05 to 0.32 mM 2'-dipyridyl (DIP) and 2 to 5% sucrose, when required, or 0.05% Tween 80 to prevent aggregation in liquid culture. M. bovis BCG and M. tuberculosis H37Rv were cultured at 37°C in 7H9 Middlebrook medium complemented with ADC enrichment (BB BDL) and 0.05% Tween 80. Escherichia coli TOP10 F' bacteria (Invitrogen) were used for plasmid construction and purification. They were cultured at 37°C in Luria broth supplemented with 100 µg/ml ampicillin, 60 µg/ml kanamycin, or 150 µg/ml hygromycin when required.

AH109 strain of Saccharomyces cerevisiae (MATa, trp1-901, leu2-3,112, ura3-52, his3-200, gal4{Delta}, gal80{Delta}, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA-ADE2, URA3::MEL1UAS-MEL1TATA-lacZ) was grown at 30°C in complete yeast extract-peptone medium (BIO101) supplemented with 2% dextrose and 0.003% adenine (Ade) or in selective minimum DOBA media (BIO101) containing different amino acid complements (Complete Supplement Mixtures from BIO101) devoid of leucine (Leu) and/or tryptophane (Trp) and/or histidine (His) and/or adenine.

RT-PCR. Mycobacterial total RNA was extracted from 2-day culture of M. smegmatis or 15-day culture of M. bovis BCG or M. tuberculosis by five breaking cycles (1 min of breaking at maximal speed, 1 min on ice) on a Mini-BeadBeater in the presence of 0.1-mm glass beads. They were purified using an RNeasy Miniprep kit (QIAGEN) and treated with DNase I (DNA Free kit from Ambion). The quality and concentration of the RNA preparations were controlled using a Bioanalyzer Agilent 2100 (Agilent Technologies). Five hundred ng of RNA was retrotranscribed using M-MuLV reverse transcriptase (RT; RNase H–) from Finnzyme, according to the manufacturer's recommendations, and different specific RT primers (Table 1). One-fifth of the synthesized cDNA was used as template for PCR amplification of an internal fragment of the different open reading frames (ORF) (Table 1) using Taq DNA polymerase from New England BioLabs in standard PCR mixes. Control PCRs were performed using either mycobacterial genomic DNA, nonretrotranscribed RNA, or water, to ascertain the specificity of the amplification. The amplified DNA was separated in 1.5% agarose gel in Tris-acetate-EDTA buffer.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Sequences of the primers used in the RT-PCR analyses of the mycobacterial pps1 locus

pps1 gene interruption. A 2,009-bp fragment of the pps1 locus containing the 457 last bp of the Ms1460 ORF, the entire Ms1461 ORF, and the 116 first bp of the Ms1462 ORF was amplified from genomic DNA of M. smegmatis mc2155 (prepared as previously described [45]), using Taq DNA Polymerase (New England BioLabs) in standard PCR mixes. The primers used were Pps1-5'Bam (5'GGATCCGGCAACTGCGGGAG3') and Pps1-3'Bam (5'GCGGGATCCTCGAAGGCGTTGACGTCG3'), allowing the introduction of a BamHI site at each extremity of the amplified DNA. This fragment was purified on QIAquick column (QIAGEN), digested with BamHI (New England BioLabs), and subsequently cloned at the BamHI site of the pJQ200 vector (36). The resulting plasmid was then digested by StuI, treated 30 min at 37°C with the Klenow fragment of DNA polymerase I (New England BioLabs) in the presence of 35 µM dNTP, and ligated overnight at 16°C with T4 DNA ligase in the presence of a blunt DNA fragment containing an hygromycin resistance cassette (54). A Midiprep (QIAGEN) of this construct, named pJQ-pps1::hyg, was used to transform competent M. smegmatis by electroporation on a Bio-Rad electroporator (25 µF, 200 W, 2.5 kV). The transformant mycobacteria, in which the vector was integrated by a single homologous recombination event, were selected in the presence of hygromycin and gentamicin. The second recombination event was selected by plating mycobacteria in Tryptone-Soja medium containing 2 to 5% sucrose and hygromycin and, eventually, 0.005 to 0.05% ferric ammonium citrate.

Complementation vectors. Five different complementation plasmids, named pMV-Ms1461, pMV-Rv1461, pMV-Rv1462, pMV-Rv1463, and pMV-Op1461/3, allowing the expression in mycobacteria of Ms1461, Rv1461, Rv1462, Rv1463, and Rv1461 to Rv1463 genes (Fig. 1), respectively, were constructed. The corresponding ORF were amplified from M. smegmatis genomic DNA or from the BAC-Rv268 of M. tuberculosis H37Rv (http://www.pasteur.fr/recherche/unites/Lgmb/BAC-page.html), using Pfu polymerase (Promega) in standard PCR mixes and primers allowing the introduction of a NdeI site at the ATG start codon and a BamHI site at the 3' extremity of the amplified DNA (Ms1461-Nde, 5'GAGCGTCCATATGACGACCACCCCCGAGAC3'; Ms1461-Bam, 5'AAGGGATCCTCAGCCGACCGCACCTTCC3'; 1461-Nde, 5'GAGCGTCCATATGACACTCACCCCAGAGGCC3'; 1461-Bam, 5'CCGGGATCCTCATCCGACCGCGCCCTCC3'; 1462-Nde, 5'GCGCGGTCATATGACGGCTCCGGGACTGAC3'; 1462-Bam, 5'CCAGGATCCTCATGAGACTGTTGTCTTTTCCG3'; 1463-Nde, 5'CAACAGTCATATGACCATTTTGGAAATTAAGGAC3'; and 1463-Bam, 5'GCCGGATCCTCAGGCTCCGGTTGGCGCG3'). The DNA fragments were purified on a QIAquick column (QIAGEN), digested with NdeI and BamHI (New England BioLabs), and, subsequently, cloned at the same restriction sites of the pMV261 vector (48). The resulting constructs were used to transform M. smegmatis colonies resulting from the integration of the pJQ-pps1::hyg suicide vector, and the transformants were selected in the presence of hygromycin and kanamycin.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 1. Organization of the suf locus from different bacterial species. (A) Alignment of the suf loci from E. chrysanthemi and M. tuberculosis. Sizes of the genes and of intergenic regions are indicated in parentheses. (B) Organization of M. leprae (ORF numbered ML0592 to ML0598 according to the Leproma web site [http://genolist.pasteur.fr/Leproma/]) and M. smegmatis (ORF that we numbered Ms1460 to Ms1466 by homology with M. tuberculosis genome) loci. Arrows indicate the orientations of the genes. The intein sequence within M. tuberculosis and M. leprae pps1 gene appears as a gray box.

Yeast two-hybrid assays. Protein-protein interactions were researched using the MATCHMAKER GAL4 Two-Hybrid System 3 from Clontech as previously described (5, 51). The ORF Ms1461 and Rv1461 to Rv1466 were amplified either from M. smegmatis genomic DNA or from the BAC-Rv268 of M. tuberculosis, using Pfu polymerase in standard reaction mixes. Primers allowing the introduction of a NdeI site in 5' and a BamHI site in 3' of the coding sequence were used, except in the case of Rv1464, where EcoRI and SmaI sites were introduced in 5' and 3' of the coding sequence, respectively (Ms1461-Nde, Ms1461-Bam, 1461-Nde, 1461-Bam, 1462-Nde,1462-Bam, 1463-Nde, 1463-Bam, 1464-Eco, 5'CCTGAATTCATGACGGCCTCGGTGAACTC3'; 1464-Sma, 5'GACCCCGGGTCACGCTCTTCCAAAGAAATGCC3'; 1465-Nde, 5'TCTTTGGCATATGGTGACGTTGCGTCTGGAGC3'; 1465-Bam, 5'AGCGGATCCTCAGCCGGTGCGCTGGTTTC3'; 1466-Nde, 5'GTTACATATGAGCGAAACCAGCGCAC3'; and 1466-Bam, 5'GACGCGGATCCTCAGACGGTGAAGCCGAGCG3'). Amplified DNA fragments were purified and digested with the corresponding restriction endonucleases and cloned at the same sites in pGADT7 and pGBKT7 vectors.

The AH109 yeast strain was electrotransformed with each construct and with each couple of pGADT7 and pGBKT7 derivatives, including positive and negative controls available in the Clontech system (See Results). The single transformants were selected in minimal DOBA (dropout base) medium lacking either Leu or Trp, and double transformants were selected in minimal medium lacking both Leu and Trp. Protein-protein interactions were revealed by the expression of three different reporter genes. The HIS3 and ADE2 reporter gene expression allows for the growth of yeasts in media lacking His and Ade, respectively, whereas the MEL1 reporter encodes {alpha}-galactosidase. Hence, the interactions were selected by streaking 5 to 15 double transformant colonies and by plating dilutions of liquid cultures of 3 to 6 colonies on the different selective minimal media deficient in Leu and Trp and either His, Ade, or both His and Ade; in the last case, 5-bromo-4-chloro-3-indolyl-{alpha}-D-galactopyranoside (X-{alpha}-Gal; Clontech) was added to the medium at a final concentration of 20 µg/ml. The ability of streaked colonies to grow under the different selective conditions and the ratio of CFU obtained in selective versus nonselective conditions in addition to the ability to form dark blue colonies in the presence of X-{alpha}-Gal were determinant parameters for the existence of interactions between the different tested proteins. In each case, these parameters were compared with those of yeasts transformed with positive and negative control vectors. We concluded that interactions were strong (Table 2) when the yeasts were able to grow on all selective media as efficiently as in the nonselective medium, forming dark blue colonies in the presence of X-{alpha}-Gal. Likewise, interactions were weak when the growth of the yeasts on the selective media was reduced compared to the nonselective medium, as seen by the blue colonies formed in the presence of X-{alpha}-Gal. Similarly, no interaction was the conclusion when the yeasts were not able to grow on selective media.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Interactions observed between the different proteins encoded by the pps1 operon


arrow
RESULTS
 
The pps1 gene encodes a SufB ortholog and belongs to the highly conserved locus of suf genes. The M. tuberculosis pps1 gene, numbered Rv1461 according to M. tuberculosis genome annotation (6), encodes a conserved hypothetical protein of unknown function. In order to assign a putative function to this protein, we searched for orthologous ORF in the bacterial genomes, using the genomic BLAST program from the NCBI web site. The 318 complete or unfinished bacterial genomes available were screened using the Rv1461 translated peptide sequence, in which the intein sequence was deleted, as a probe. At least 70% of bacterial genomes exhibit an ORF encoding an ortholog of the Pps1 protein. The corresponding proteins harbor 35 to 100% identity with Pps1, along at least 90% of the peptide sequence. In addition, complementary BLAST searches detected orthologous proteins in archaea and eucarya.

Indeed, Pps1 belongs to a cluster of orthologous group of proteins (COG0719 at the NCBI) which gathers predicted membrane components of uncharacterized iron-regulated ABC transporters. Notably, the protein coded by the adjacent Rv1462 ORF in M. tuberculosis genome also belongs to this COG, and the Rv1463 gene encodes a probable conserved ATP-binding protein from an ABC transporter (COG0396). However, we did not identify any transmembrane segment from the primary sequence of the Rv1461- and Rv1462-encoded proteins; this suggests that the Rv1463-encoded protein, containing a single nucleotide binding domain, is part of an incomplete transporter, in agreement with a previous report of Braibant and collaborators (3).

Pps1 harbors 38 and 39% identity with the SufB protein from Erwinia chrysanthemi and E. coli, respectively. SufB is a key component of the SUF system, one of the three bacterial complex machinery of [Fe-S] cluster assembly (13, 49). In several proteobacteria, this process generally involves the machinery termed ISC (iron-sulfur clusters) composed of at least six proteins, IscSUA, HscBA and Fdx. In nitrogen fixing bacteria, another system termed NIF (nitrogen fixation) is specifically required for the [Fe-S] cluster assembly in nitrogenases; it is composed of at least the two proteins NifS and NifU. The third system identified, termed the SUF (mobilization of sulfur) machinery, is important for [Fe-S] biogenesis under stressful conditions (25). At least three Suf proteins (SufBCD) are widely conserved in nature, but the whole machinery is composed of the six proteins (SufABCDSE) coded by the suf operon in E. chrysanthemi and E. coli (24, 32). Accordingly, we checked for the presence of other members of this locus in the M. tuberculosis genome. We noticed that pps1 gene belongs to a locus of seven genes (ORF numbered Rv1460 to Rv1466) with the same orientation and with small intergenic regions, if any (Fig. 1A). Among the seven genes, the three genes located immediately downstream of pps1, i.e., ORF Rv1462 to Rv1464 (Fig. 1A), would encode SufD, SufC, and SufS ortholog proteins, which present 24%, 48%, and 47% identity with the E. chrysanthemi proteins, respectively. In contrast, no ORF coding for orthologs of SufA and SufE from E. chrysanthemi and E. coli was found in the mycobacterial locus. Instead, the Rv1465 ORF encodes a NifU-like protein homologous to IscU (COG0822), harboring all the strictly conserved residues of the IscU protein from a variety of organisms (14). The last gene of the locus in M. tuberculosis (Rv1466) presents no homology with any of the suf genes, but its product is nevertheless classified in the COG2151 containing predicted metal-sulfur cluster biosynthetic enzymes. The first Rv1460 ORF would encode a probable transcriptional regulatory protein (COG2345), which presents some homology with the SufR transcriptional regulator from Synechocystis sp. PCC6803 (52), the two proteins sharing 42% of homologous residues. In contrast to the Synechocystis sufR gene, the mycobacterial Rv1460 gene is oriented in the same direction as the other suf genes (Fig. 1). Nevertheless, the encoded protein would probably act as a repressor of the adjacent suf genes expression in mycobacteria, as previously mentioned by Wang et al. (52).

Except for the presence of an intein invading sequence at two different insertion sites in the M. tuberculosis and Mycobacterium leprae pps1 gene (46), the overall structure (Fig. 1B) and the sequence of the pps1 locus, renamed the suf locus, are exceptionally conserved in all mycobacterial genomes sequenced to date. The finding of genes putatively coding for the four most conserved Suf proteins and three proteins with probable related functions in mycobacterial genomes justly suggests that mycobacteria possess a functional SUF system for the [Fe-S] cluster assembly in proteins, the pps1 gene encoding the central SufB protein.

No isc and nif loci are present in the M. tuberculosis genome. While three homologous [Fe-S] clusters assembly systems exist in bacteria (13, 49), we failed to find an equivalent of isc and nif loci in the M. tuberculosis genome. A BLAST search identified the Rv1465-encoded protein as the only ortholog of E. coli IscU and NifU proteins and the Rv1464-encoded protein as the only NifS-like protein. Only iscS- and iscA-like genes could be found outside the suf locus, but they correspond to separate ORF in the genome of M. tuberculosis (Rv3025c and Rv2204c, respectively). Similar observations were made during the investigation of the other sequenced mycobacterial genomes. Hence, the suf locus of genes would obviously encode the exclusive system of [Fe-S] cluster assembly in mycobacteria.

The mycobacterial pps1 locus is organized as an operon. For E. chrysanthemi and E. coli genomes, it has been shown that the suf locus is organized as an operon (24, 32). In view of the structure of the seven-gene locus in mycobacterial genomes (Fig. 1), such an organization was fairly presumed and was demonstrated using a RT-PCR strategy.

A total mRNA preparation from M. smegmatis was retrotranscribed by using independently six different primers hybridizing to Ms1461 to Ms1466 genes (Fig. 2A, numbered 1 to 6; Table 1). Subsequently, each synthesized cDNA was used as a matrix for the PCR amplification of an internal fragment of Ms1460 to Ms1464 genes, with primer pairs hybridizing specifically to these genes (Fig. 2A; Table 1). In all cases, the genes located upstream of the RT primer were efficiently PCR amplified, demonstrating that the seven genes are cotranscribed into a lengthy mRNA molecule. For illustration, Fig. 2B and C show that it was possible to amplify a 481-bp fragment of Ms1461 from the RT reactions performed with the primers annealing to Ms1461 to Ms1466 genes of the M. smegmatis locus (Fig. 2B, lanes 1 to 6) and a 445-bp fragment of Ms1464 from the RT reactions performed with the primers annealing to Ms1464 to Ms1466 genes (Fig. 2C, lanes 4 to 6). As negative controls, genes located downstream of the RT primer were not amplified, as exemplified in Fig. 2C (lane 3). Curiously, much stronger PCR amplifications were observed with cDNA generated with the RT primer hybridizing to the Ms1466 gene (Fig. 2B and C). This may be due either to an artifactually much higher RT efficiency, or, alternatively, to a particular conformation of the polycistronic mRNA.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 2. RT-PCR analysis of the mycobacterial suf operon. (A) Schematic representation of the RT-PCR experiments. Open arrowheads represent the RT primers, and black arrowheads represent the PCR primers. (B) PCR amplification of a fragment of the Ms1461 gene using primers LF 1461 (L1) and RG 1461 (R1) and different DNA templates, as follows: H2O, nonretrotranscribed M. smegmatis RNA, M. smegmatis genomic DNA, and cDNA obtained by retrotranscription of RNA using the different RT primers RT 1461 (1), RT 1462 (2), RT 1463 (3), RT 1464 (4), RT 1465 (5), and RT 1466 (6). (C) PCR amplification of a fragment of the Ms1464 gene using primers LF 1464 (L4) and RG 1464 (R4) and different DNA templates, as follows: H2O, nonretrotranscribed M. smegmatis RNA, M. smegmatis genomic DNA, and cDNA obtained by retrotranscription of RNA using the different RT primers RT 1463 (3), RT 1464 (4), RT 1465 (5), and RT 1466 (6).

Identical RT-PCR results were obtained using M. bovis BCG and M. tuberculosis mRNA (data not shown). These data allowed us to conclude that the seven genes of the mycobacterial suf locus are organized as an operon.

Interactions between proteins encoded by the pps1 operon. The Suf proteins of E. chrysanthemi have been shown to interact, forming at least two complexes constituted of SufBCD and SufES proteins (22, 25). In order to make a parallel between the SUF machinery of E. chrysanthemi and that operating in M. tuberculosis, we searched for potential interactions between the mycobacterial proteins coded by the pps1 operon, except the putative transcriptional regulator, using yeast two-hybrid assays.

The genes of interest, i.e., Rv1461 to Rv1466 from M. tuberculosis and Ms1461 from M. smegmatis, were cloned in pGBKT7 and pGADT7 vectors (5). Each construct, when transformed in the AH109 strain of S. cerevisiae, allows the expression of one mycobacterial protein fused in the C terminal either to the DNA-binding domain (BD) or to the transcriptional activator domain (AD) of the GAL4 transcription factor. When coexpressed in the yeast, the interaction of an AD-fused target protein with a BD-fused bait protein can induce the expression of three different reporter genes which enables the yeast to grow in Ade- and His-lacking media and to degrade the X-{alpha}-Gal substrate into a blue product. Hence, a high stringency selection of the protein-protein interactions is obtained in minimal medium lacking Leu, Trp, His, and Ade and containing X-{alpha}-Gal. Since each protein can be expressed as an AD-fused target protein or as a BD-fused bait protein, each protein-protein interaction was controlled in two different ways, and the dimerization of each protein was examined.

Negative controls were performed using yeasts cotransformed with the pGBKT7 derivatives and the empty pGADT7 vector, with the pGADT7 derivatives and the empty pGBKT7 vector, or with the pGADT7 derivatives and the pGBKT7-Lam plasmid, which encodes a fusion protein with the noninteracting human lamin C and provides a control for fortuitous interactions between unrelated proteins (2). As positive controls, pGADT7-T vector, which encodes an AD-T antigen fusion, and pGBKT7-53 vector, which encodes a BD-p53 fusion, were cotransformed; in addition, the yeast was transformed with the pCL1 vector that encodes the full-length wild-type GAL4. All the single and double transformants were tested in selective media as indicated before.

First, we confirmed that the three reporter genes were correctly expressed in the presence of interacting p53 and T antigen and in the presence of the wild-type GAL4. Moreover, except for yeasts expressing the BD-fused Ms1461 and Rv1466, which acted intrinsically as transcription activators, the expression of the reporters was null in all of the single transformants, in the double transformants expressing the lamin C, and in the yeasts transformed with empty pGADT7 and pGBKT7 derivatives, attesting for the absence of any false-positive responses. The interactions made by Ms1461- and Rv1466-encoded proteins were then tested by using only the AD fusion. It was thus not possible to verify whether these two proteins are able to exhibit homotypic interactions.

The pattern of interactions between the tested proteins is compiled in Table 2. As expected, interactions exist between Rv1461-, Rv1462-, and Rv1463-encoded proteins, orthologous to SufB, SufD, and SufC, respectively. Although Rv1461-encoded protein exhibits homotypic interactions, this seems not to be the case for Rv1462- and Rv1463-encoded proteins. Moreover, the Rv1464-encoded protein (SufS ortholog) weakly interacts with itself and with the Rv1461-encoded protein. In contrast, the Rv1465- and Rv1466-encoded proteins did not appear to interact with any of the tested proteins. Notably, the results obtained with the Ms1461-encoded protein from M. smegmatis match with those obtained with the Rv1461-encoded protein from M. tuberculosis, except that the weak interactions with the Rv1464-encoded protein were not observed.

Evidence for the essentiality of the pps1 operon. The pps1 operon is presumed, but not shown, to be essential (44). To address this question, we used a suicide vector strategy in M. smegmatis. Effectively, for practical reasons, this nonpathogenic species is routinely used for mycobacterial gene interruption studies (17, 35), since it grows rapidly and presents an efficient homolog recombination. M. smegmatis has a genome approximately twice the size of the M. tuberculosis genome, suggesting an important gene redundancy. Hence, a gene shown essential for M. smegmatis growth is legitimately thought to be essential for M. tuberculosis. Moreover, since the SUF machinery appears as the unique system to assemble [Fe-S] clusters encoded by all of the mycobacterial genomes sequenced to date, the essentiality of one suf gene or of the suf operon, if shown in one mycobacterial species, can reasonably be generalized to all mycobacterial species.

A fragment of the pps1 locus spanning the pps1 gene (Ms1461 in M. smegmatis) was interrupted by a hygromycin resistance cassette and cloned in the pJQ200 suicide vector (36), which harbors a gentamicin resistance gene and the sacB gene (Fig. 3A). This construct, named pJQ-pps1::hyg, was transformed into M. smegmatis. We obtained around 150 recombinant colonies selected in both hygromycin and gentamicin, meaning that the vector was efficiently integrated in the genome of the bacteria. Different PCRs performed with genomic DNA preparations from 10 of these colonies and different primer pairs allowed us to show that the vector was legitimately integrated within the pps1 gene by a single homologous recombination event in the 10 colonies. In principle, the recombination could occur either in the 5' or in the 3' part of the hygromycin cassette insertion site in the pps1 gene (Fig. 3B and C, respectively), resulting in both cases in one native and one interrupted allele of the gene. However, we observed that, in the 10 tested colonies, the recombination happened in the 5' part of the gene, as attested to by the PCR profiles (data not shown) that confirmed the genetic organization depicted in Fig. 3B. This event allowed for the reconstitution of the operon missing only the 5' extremity of the Ms1460 ORF while a wild-type allele of Ms1460 is restored upstream of the Ms1461 interrupted allele (Fig. 3B). Otherwise, the recombination in the 3' part of the gene would have resulted in the operon being truncated in the 5' part and interrupted within the Ms1461 ORF (Fig. 3C). Although the eventuality of an inefficient recombination in the 3' part of the hygromycin insertion site should not be excluded, it is rather doubtful that such a bias in the recombination frequency could result in 100% of colonies with the same genotype after the single crossover. These results suggest, rather, that the suf operon, even if truncated in 5', is essential for mycobacterial life. In addition, it implies that the Ms1460 ORF, coding for the putative transcriptional regulator, could be transcribed independently of the suf genes. However, due to the low conservation of the mycobacterial promoter sequences, we failed to identify any putative promoter upstream of the Ms1460 gene for the transcription of the regulator or inside the operon for the transcription of the suf genes.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 3. The suicide vector strategy used in M. smegmatis. (A) pJQ200-pps1::hyg suicide vector. (B) Integration of the suicide vector by homologous recombination in the 5' part of the pps1 gene (Ms1461). (C) Integration of the suicide vector by homologous recombination in the 3' part of the pps1 gene. (D) Integration of the hygromycin resistance gene in the pps1 gene by double recombination. Ms1461' and Ms1462' represent 3'-truncated Ms1461 and Ms1462 genes, 'Ms1460, 'Ms1461, and 'Ms1462 represent the 5'-truncated genes. Arrows indicate the orientations of the genes. The original pJQ200 plasmid DNA is represented by a thick black line in panels B and C.

Subsequently, we tried to induce a second recombination event between the two alleles of the pps1 gene by growing the initial recombinant mycobacteria in the presence of sucrose or of sucrose and iron. The recombinant clone should possess a unique interrupted allele of the pps1 gene (Fig. 3D). All 33 colonies obtained at different sucrose and iron concentrations conserved their ability to grow in the presence of gentamicin and did not present the expected recombination in the pps1 locus, as depicted by unmodified PCR profiles. The mycobacterial colonies probably evolved a modified sacB gene in order to survive in the presence of sucrose. The inability to observe the second recombination event substantially indicates that the pps1 gene cannot be interrupted without impeding mycobacterial growth. Although an inefficient recombination in 3' of the hygromycin insertion site cannot be excluded, it is rather improbable that it would totally impede the second crossover reaction selected in the presence of sucrose.

Considering the fact that the first recombination event never happened in the 3' part of the pps1 gene and that the interruption of the pps1 gene has probably a strong polar effect on the expression of downstream genes, pps1 is not necessarily the essential element or the unique essential element of the operon. We tried to address this point in searching for the double recombination event in mycobacteria complemented with different expression vectors. Hence, bacteria issued from the first recombination event were transformed with plasmids allowing the expression of either Ms1461 of M. smegmatis, Rv1461, Rv1462 or Rv1463 of M. tuberculosis, or Rv1461 to Rv1463. The transformed colonies were then grown in the presence of different concentrations of sucrose at 37°C or 42°C. While colonies were able to grow on sucrose, genetic analysis of all the colonies showed that the second recombination did not happen, regardless of the complementation vector used. Unfortunately, for technical reasons, we were not able to complement mycobacteria with larger fragments of the operon. Nevertheless, these results indicate that the complementation of the mycobacteria by ORF Rv1461 to Rv1463, the three most conserved genes of the operon, is not sufficient to compensate for its interruption. We thus concluded that the whole pps1 operon is essential.

Evidence for the implication of the pps1 operon in iron metabolism. Since the mutant resulting from the first recombination event presents a modified pps1 operon truncated in its 5' extremity, which contains the sequence coding for the putative transcriptional regulator (Fig. 3B), it is presumable that the control of the expression of the suf genes would be modified. That could result in either better or reduced growth in the presence of low iron concentrations. We thus compared the ability of the mutant and wild-type M. smegmatis to grow in the presence of the iron chelator DIP. Toward this goal, we measured the generation time of wild-type and mutant strains of M. smegmatis in the presence of different concentrations of the chelator in the complete culture medium at 37°C. We observed a reduced sensitivity of the mutant to the chelator at concentrations greater than 0.16 mM, with a 1.5-times-longer generation time for the wild-type strain in the presence of 0.32 mM DIP (Fig. 4). These data indicate an effect of the mutation in iron metabolism, confirming the implication of the pps1 operon in the mycobacterial iron metabolism.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 4. Generation time of the wild-type (white bars) and mutant (black bars) M. smegmatis in the presence of different concentrations of DIP.


arrow
DISCUSSION
 
While tuberculosis remains one of the major infectious diseases worldwide, there is a great need for the discovery of new therapeutic drugs against M. tuberculosis. Moreover, a large portion of virulent strains become resistant to the commonly used antituberculous drugs. Accordingly, numerous studies are devoted to the search for new and specific mycobacterial processes that are essential and that could represent singular targets to inhibit. Since the intein containing Pps1 protein of M. tuberculosis, coded by the Rv1461 ORF of M. tuberculosis genome (6, 46), could represent such a new target, the goal of the present study was to identify its function.

In silico analyses showed that Pps1, once it is matured by protein splicing, is an ortholog of the highly conserved SufB protein. In E. chrysanthemi and E. coli, it represents a major component of the SUF system, which is, together with the NIF and ISC systems, one of the three complex biological processes for [Fe-S] cluster assembly (13, 49). Moreover, we showed that the pps1 gene (Rv1461) belongs to a locus of seven contiguous ORF, Rv1460 to Rv1466, which are extremely conserved in mycobacteria (Fig. 1) and are cotranscribed as an operon (Fig. 2). By comparison with the suf operon of E. coli and E. chrysanthemi encoding the SUF machinery (24, 32), we identified the pps1 locus as the mycobacterial suf operon (Fig. 1). Indeed, the mycobacterial operon encodes SufB-, SufD-, SufC-, and SufS-like proteins (the four conserved proteins of the SUF system), a NifU-like protein, an additional protein proposed to participate in metal cluster biosynthesis, and a SufR-like protein (a probable transcriptional regulatory protein known to be an iron-dependent repressor of the sufBCDS expression in Synechocystis spp. [52].). Hence, we ascertained that M. tuberculosis possesses a complete SUF machinery. Moreover, since we failed to find equivalents of the ISC and NIF housekeeping [Fe-S] assembly systems while exploring the mycobacterial genomes, it appeared that the SUF system is the unique way to assembly and repair the [Fe-S] clusters in M. tuberculosis. These metal clusters, incorporated in specific proteins via covalent bonds to cysteines, are specially known to mediate cellular responses to external stimuli, such as iron or specific reactive oxygen and nitrogen intermediates (18, 19). Indeed, [Fe-S] cluster-containing proteins play important physiological roles and, notably, participate in electron transfer, redox regulation, nitrogen fixation, and sensing for regulatory processes as regulators of gene expression (13, 19). They may also represent intermediates in the storage of intracellular iron. Importantly, most of the intracellular iron in mycobacteria is available either chelated by siderophores (50) or in [Fe-S] clusters bound to specific proteins (1, 10, 39).

The mechanisms of iron regulation are known to play a key role in the susceptibility and outcome of many infections (7, 38, 39). Hence, the response to changes in iron availability is strictly regulated in pathogens in order to maintain sufficient but not excessive and potentially toxic levels of iron (39, 40), this response being a determinant for the intracellular survival of pathogenic bacteria. Supporting the concept that iron is essential for mycobacterial virulence, failure to produce mycobactin siderophores results in defective bacilli multiplication inside macrophagic cells where the access to iron is restricted (11). Accordingly, it can be expected that metabolism of [Fe-S] cluster is of major importance for mycobacterial survival. The SUF multiprotein complex of E. coli (24, 29, 32) and E. chrysanthemi (22, 24, 25) participates in [Fe-S] cluster biogenesis under stressful conditions, such as iron deprivation or oxidative stress, and has been shown to be overexpressed in such conditions (21, 24, 32, 55). Consistently, Rv1461 to Rv1466 suf genes are overexpressed in M. tuberculosis grown in low iron conditions (41). Moreover, Rv1460, Rv1463, and Rv1464 genes have been described by Murugasu-Oei and collaborators as stress response genes transcriptionally upregulated in anaerobic stationary phase M. smegmatis (23). Moreover, the SUF system of E. chrysanthemi, the pathogenic bacteria responsible for soft-rot disease in a variety of plants, has been shown to be involved in virulence during plant cell infection (24, 25). Since the [Fe-S] cluster synthesis and repair probably becomes a determining and limiting step for M. tuberculosis inside the macrophage, the mycobacterial SUF system likely plays a fundamental role in the pathogen intracellular survival.

Components of the SUF system in various organisms have been described (12), but the majority of our knowledge about this highly conserved multiprotein system comes from the studies of Suf proteins from E. coli and E. chrysanthemi. SufB, SufC, and SufD, which are highly conserved proteins in nature, associate in a stable cytosolic complex that possesses an ATPase activity via SufC (25, 37, 53). SufE and SufS form another complex; the interaction between these two proteins stimulating the cysteine desulfurase activity of SufS (22, 28). Moreover, in the presence of SufE, the SufBCD complex further stimulates SufS activity (30), illustrating the synergistic activity of the protein of the SUF system. Besides, SufA is responsible for the scaffold of [Fe-S] clusters (27). Based on these data, Loiseau et al. (22) have proposed a model for assembly by the SUF system, as follows: SufS mobilizes sulfur atoms from cysteine, [Fe-S] clusters are then scaffold by SufA, and, finally, the clusters are transferred to the specific target proteins, with the ATPase activity of SufBCD providing energy for each of the assembly steps.

As shown in the yeast two-hybrid experiments (Table 2), interactions between the Suf proteins of M. tuberculosis exist. Effectively, the central SufC probable ATPase interacts with both SufB and SufD, while SufB also is able to exhibit homotypic interactions, as described for its SufD homolog in E. chrysanthemi. It is thus conceivable that a SufBCD complex with structure and function similar to those of E. chrysanthemi complex may be built in M. tuberculosis. Furthermore, it appeared that SufS weakly interacts with SufB, meaning that the interaction between SufS and the SufBCD complex is possible through specific contact between these two proteins. Moreover, SufS is able to exhibit homotypic interactions, as shown for E. coli SufS (28). Since no gene encoding a putative SufE ortholog was observed in the mycobacterial genomes, it is probable that the intrinsic cysteine desulfurase activity of the mycobacterial SufS protein would be sufficient. Consistent with the structural data of Goldsmith-Fischman and collaborators (16), the function of SufE and/or SufA in the [Fe-S] cluster scaffold is probably played by the NifU-like protein in M. tuberculosis. This mycobacterial protein is not part of the stable SUF complex but may, rather, have short-lived contacts with the other Suf proteins. Notably, the SufB protein of M. smegmatis can participate in interactions with SufBCD proteins of M. tuberculosis, underlying the high functional conservation of the SUF machinery in mycobacteria. Altogether, these results confirm that the Suf proteins of mycobacteria likely have the same functionality as the Suf proteins of E. chrysanthemi and E. coli.

While the essentiality of the SufB-encoding pps1 gene was expected from that of its ortholog in Synechocystis spp. (20) and from the transposition mutant M. tuberculosis libraries (44), the essentiality of the whole suf operon in mycobacteria was established by our inability to knock out the pps1 gene in M. smegmatis. Effectively, the integration of a suicide vector containing the pps1 gene interrupted by an hygromycin resistance cassette (Fig. 3A), by a single recombination event in the mycobacterial genome, systematically resulted in the reconstitution of the suf operon lacking the 5' extremity of the first gene; this gene was concurrently reconstituted upstream in the genome (Fig. 3B). Moreover, we failed to select the double recombinant mycobacteria harboring an interrupted suf operon, even when the mycobacteria were complemented with an additional copy of the native Rv1461 and/or Rv1462 and/or Rv1463 genes from M. tuberculosis or the Ms1461 gene from M. smegmatis, either in low- or high-iron-containing media. A bias in the recombination frequency that would direct the first recombination event and totally impede the second crossover reaction is rather improbable. Similarly, a polar effect of the integration on the upstream gene expression is rather unlikely, since the Rv1459c gene, oriented in the opposite direction, is located around 1,500 bp upstream of the interruption site. Hence, we concluded that not only the pps1 gene but also, more generally, the suf operon are essential for the mycobacterial growth. Moreover, the genetic organization of the mutant issued from the first recombination event (Fig. 3B) showed that the first gene of the operon, which encodes the putative transcriptional regulator, can be transcribed independently of the other suf genes, as is the case for a Synechocystis sp. where the sufR gene is transcribed in the opposite direction (52). Underlining the implication of the pps1 operon in iron metabolism, this mutant M. smegmatis better tolerates the presence of iron chelator for in vitro growth (Fig. 4), which suggests an alteration of the suf genes regulation. Our results are consistent with the high-density mutagenesis study of Sassetti and collaborators, who classified the six genes Rv1461 to Rv1466 among the genes required for in vitro mycobacterial growth (44). They are also in agreement with those obtained for enterobacteria. For instance, in E. coli, the disruption of suf genes is not lethal (32), but the concomitant disruptions of the isc and suf operons is not viable. Moreover, the suf operon can complement the disruption of the isc operon (49) in spite of the apparent specificity of each system (29). In E. chrysanthemi, the separate genes of the suf operon are not essential in the presence of iron, presumably because the [Fe-S] cluster formation is catalyzed by another system functionally equivalent to SUF, such as ISC (24). In contrast with the redundancy of the functions of the two systems in enterobacteria, it is rational that the SUF machinery is essential in mycobacteria that lack both the ISC and NIF systems.

In conclusion, we presented evidence for the implication of the pps1 gene-containing operon in a crucial function of M. tuberculosis, as suspected from the presence of an intein-coding sequence in the pps1 gene. More precisely, we identified the mycobacterial SUF system encoded by this operon as the unique mechanism of [Fe-S] cluster assembly and repair in mycobacteria. Considering that the ability to acquire iron and to resist oxidative burst are a determining criterion for bacterial initiation of infection, the SUF system is presumed to play a key role in the pathogenicity of M. tuberculosis. Hence, the blockage of the SUF machinery may be of pharmacological interest, and the inhibition of the protein splicing of the SufB (Pps1) precursor may be a novel way to fight tuberculosis.


arrow
ACKNOWLEDGMENTS
 
We thank P. E. Clottes, C. Guilhot, and D. Zerbib for helpful discussions and for critical reading of the manuscript. We are grateful to R. Veyron-Churlet for technical assistance during yeast two hybrid experiments and L. Park for reading of the manuscript and for language correction.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Mechanisms of Mycobacterial Infections, Institut de Pharmacologie et Biologie Structurale (UMR5089), C.N.R.S./Université Paul Sabatier Toulouse III, 205 Route de Narbonne, F-31077 Toulouse Cedex, France. Phone: 33 (0)561 175 471. Fax: 33 (0)561 175 994. E-mail: Isabelle.Saves{at}ipbs.fr. Back


arrow
REFERENCES
 
    1
  1. Andrews, S. C. 1998. Iron storage in bacteria. Adv. Microb. Physiol. 40:281-351.[Medline]
    2. 2
  2. Bartel, P., C. T. Chien, R. Sternglanz, and S. Fields. 1993. Elimination of false positives that arise in using the two-hybrid system. BioTechniques 14:920-924.[Medline]
    3. 3
  3. Braibant, M., P. Gilot, and J. Content. 2000. The ATP binding cassette (ABC) transport systems of Mycobacterium tuberculosis. FEMS Microbiol. Rev. 24:449-467.[CrossRef][Medline]
    4. 4
  4. Cann, I. K., K. R. Amaya, M. W. Southworth, and F. B. Perler. 2004. Bacteriophage-based genetic system for selection of nonsplicing inteins. Appl. Environ. Microbiol. 70:3158-3162.[Abstract/Free Full Text]
    5. 5
  5. Chien, C. T., P. L. Bartel, R. Sternglanz, and S. Fields. 1991. The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA 88:9578-9582.[Abstract/Free Full Text]
    6. 6
  6. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544.[CrossRef][Medline]
    7. 7
  7. Collins, H. L. 2003. The role of iron in infections with intracellular bacteria. Immunol. Lett. 85:193-195.[CrossRef][Medline]
    8. 8
  8. Colston, M. J. 1996. The molecular basis of mycobacterial infection. Mol. Aspects Med. 17:385-454.[CrossRef]
    9. 9
  9. Davis, E. O., P. J. Jenner, P. C. Brooks, M. J. Colston, and S. G. Sedgwick. 1992. Protein splicing in the maturation of M. tuberculosis RecA protein: a mechanism for tolerating a novel class of intervening sequence. Cell 71:201-210.[CrossRef][Medline]
    10. 10
  10. De Voss, J. J., K. Rutter, B. G. Schroeder, and C. E. Barry III. 1999. Iron acquisition and metabolism by mycobacteria. J. Bacteriol. 181:4443-4451.[Free Full Text]
    11. 11
  11. De Voss, J. J., K. Rutter, B. G. Schroeder, H. Su, Y. Zhu, and C. E. Barry III. 2000. The salicylate-derived mycobactin siderophores of Mycobacterium tuberculosis are essential for growth in macrophages. Proc. Natl. Acad. Sci. USA 97:1252-1257.[Abstract/Free Full Text]
    12. 12
  12. Ellis, K. E., B. Clough, J. W. Saldanha, and R. J. Wilson. 2001. Nifs and Sufs in malaria. Mol. Microbiol. 41:973-981.[CrossRef][Medline]
    13. 13
  13. Frazzon, J., and D. R. Dean. 2003. Formation of iron-sulfur clusters in bacteria: an emerging field in bioinorganic chemistry. Curr. Opin. Chem. Biol. 7:166-173.[CrossRef][Medline]
    14. 14
  14. Frazzon, J., J. R. Fick, and D. R. Dean. 2002. Biosynthesis of iron-sulphur clusters is a complex and highly conserved process. Biochem. Soc. Trans. 30:680-685.[CrossRef][Medline]
    15. 15
  15. Frischkorn, K., P. Sander, M. Scholz, K. Teschner, T. Prammananan, and E. C. Bottger. 1998. Investigation of mycobacterial recA function: protein introns in the RecA of pathogenic mycobacteria do not affect competency for homologous recombination. Mol. Microbiol. 29:1203-1214.[CrossRef][Medline]
    16. 16
  16. Goldsmith-Fischman, S., A. Kuzin, W. C. Edstrom, J. Benach, R. Shastry, R. Xiao, T. B. Acton, B. Honig, G. T. Montelione, and J. F. Hunt. 2004. The SufE sulfur-acceptor protein contains a conserved core structure that mediates interdomain interactions in a variety of redox protein complexes. J. Mol. Biol. 344:549-565.[CrossRef][Medline]
    17. 17
  17. Jackson, M., D. C. Crick, and P. J. Brennan. 2000. Phosphatidylinositol is an essential phospholipid of mycobacteria. J. Biol. Chem. 275:30092-30099.[Abstract/Free Full Text]
    18. 18
  18. Johnson, M. K. 1998. Iron-sulfur proteins: new roles for old clusters. Curr. Opin. Chem. Biol. 2:173-181.[CrossRef][Medline]
    19. 19
  19. Kiley, P. J., and H. Beinert. 2003. The role of Fe-S proteins in sensing and regulation in bacteria. Curr. Opin. Microbiol. 6:181-185.[CrossRef][Medline]
    20. 20
  20. Law, A. E., C. W. Mullineaux, E. M. Hirst, J. Saldanha, and R. J. Wilson. 2000. Bacterial orthologues indicate the malarial plastid gene ycf24 is essential. Protist 151:317-327.[Medline]
    21. 21
  21. Lee, J. H., W. S. Yeo, and J. H. Roe. 2004. Induction of the sufA operon encoding Fe-S assembly proteins by superoxide generators and hydrogen peroxide: involvement of OxyR, IHF and an unidentified oxidant-responsive factor. Mol. Microbiol. 51:1745-1755.[CrossRef][Medline]
    22. 22
  22. Loiseau, L., S. Ollagnier-de-Choudens, L. Nachin, M. Fontecave, and F. Barras. 2003. Biogenesis of Fe-S cluster by the bacterial Suf system: SufS and SufE form a new type of cysteine desulfurase. J. Biol. Chem. 278:38352-38359.[Abstract/Free Full Text]
    23. 23
  23. Murugasu-Oei, B., A. Tay, and T. Dick. 1999. Upregulation of stress response genes and ABC transporters in anaerobic stationary-phase Mycobacterium smegmatis. Mol. Gen. Genet. 262:677-682.[CrossRef][Medline]
    24. 24
  24. Nachin, L., M. El Hassouni, L. Loiseau, D. Expert, and F. Barras. 2001. SoxR-dependent response to oxidative stress and virulence of Erwinia chrysanthemi: the key role of SufC, an orphan ABC ATPase. Mol. Microbiol. 39:960-972.[CrossRef][Medline]
    25. 25
  25. Nachin, L., L. Loiseau, D. Expert, and F. Barras. 2003. SufC: an unorthodox cytoplasmic ABC/ATPase required for [Fe-S] biogenesis under oxidative stress. EMBO J. 22:427-437.[CrossRef][Medline]
    26. 26
  26. Noren, C., J, Wang, and F. B. Perler. 2000. Dissecting the chemistry of protein splicing and its applications. Angew. Chem. Int. Ed. 39:450-466.
    27. 27
  27. Ollagnier-de Choudens, S., L. Nachin, Y. Sanakis, L. Loiseau, F. Barras, and M. Fontecave. 2003. SufA from Erwinia chrysanthemi. Characterization of a scaffold protein required for iron-sulfur cluster assembly. J. Biol. Chem. 278:17993-18001.[Abstract/Free Full Text]
    28. 28
  28. Ollagnier-de-Choudens, S., D. Lascoux, L. Loiseau, F. Barras, E. Forest, and M. Fontecave. 2003. Mechanistic studies of the SufS-SufE cysteine desulfurase: evidence for sulfur transfer from SufS to SufE. FEBS Lett. 555:263-267.[CrossRef][Medline]
    29. 29
  29. Outten, F. W., O. Djaman, and G. Storz. 2004. A suf operon requirement for Fe-S cluster assembly during iron starvation in Escherichia coli. Mol. Microbiol. 52:861-872.[CrossRef][Medline]
    30. 30
  30. Outten, F. W., M. J. Wood, F. M. Munoz, and G. Storz. 2003. The SufE protein and the SufBCD complex enhance SufS cysteine desulfurase activity as part of a sulfur transfer pathway for Fe-S cluster assembly in Escherichia coli. J. Biol. Chem. 278:45713-45719.[Abstract/Free Full Text]
    31. 31
  31. Papavinasasundaram, K. G., M. J. Colston, and E. O. Davis. 1998. Construction and complementation of a recA deletion mutant of Mycobacterium smegmatis reveals that the intein in Mycobacterium tuberculosis recA does not affect RecA function. Mol. Microbiol. 30:525-534.[CrossRef][Medline]
    32. 32
  32. Patzer, S. I., and K. Hantke. 1999. SufS is a NifS-like protein, and SufD is necessary for stability of the [2Fe-2S] FhuF protein in Escherichia coli. J. Bacteriol. 181:3307-3309.[Abstract/Free Full Text]
    33. 33
  33. Paulus, H. 2003. Inteins as targets for potential antimycobacterial drugs. Front. Biosci. 8:S1157-S1165.
    34. 34
  34. Perler, F. B., G. J. Olsen, and E. Adam. 1997. Compilation and analysis of intein sequences. Nucleic Acids Res. 25:1087-1093.[Abstract/Free Full Text]
    35. 35
  35. Portevin, D., C. De Sousa-D'Auria, C. Houssin, C. Grimaldi, M. Chami, M. Daffé, and C. Guilhot. 2004. A polyketide synthase catalyzes the last condensation step of mycolic acid biosynthesis in mycobacteria and related organisms. Proc. Natl. Acad. Sci. USA 101:314-319.[Abstract/Free Full Text]
    36. 36
  36. Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127:15-21.[CrossRef][Medline]
    37. 37
  37. Rangachari, K., C. T. Davis, J. F. Eccleston, E. M. Hirst, J. W. Saldanha, M. Strath, and R. J. Wilson. 2002. SufC hydrolyzes ATP and interacts with SufB from Thermotoga maritima. FEBS Lett. 514:225-228.[CrossRef][Medline]
    38. 38
  38. Ratledge, C. 2004. Iron, mycobacteria and tuberculosis. Tuberculosis 84:110-130.
    39. 39
  39. Ratledge, C., and L. G. Dover. 2000. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 54:881-941.[CrossRef][Medline]
    40. 40
  40. Rodriguez, G. M., and I. Smith. 2003. Mechanisms of iron regulation in mycobacteria: role in physiology and virulence. Mol. Microbiol. 47:1485-1494.[CrossRef][Medline]
    41. 41
  41. Rodriguez, G. M., M. I. Voskuil, B. Gold, G. K. Schoolnik, and I. Smith. 2002. ideR, an essential gene in Mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Infect. Immun. 70:3371-3381.[Abstract/Free Full Text]
    42. 42
  42. Saluja, D., and G. N. Godson. 1995. Biochemical characterization of Escherichia coli temperature-sensitive dnaB mutants dnaB8, dnaB252, dnaB70, dnaB43, and dnaB454. J. Bacteriol. 177:1104-1111.[Abstract/Free Full Text]
    43. 43
  43. Sander, P., K. G. Papavinasasundaram, T. Dick, E. Stavropoulos, K. Ellrott, B. Springer, M. J. Colston, and E. C. Bottger. 2001. Mycobacterium bovis BCG recA deletion mutant shows increased susceptibility to DNA-damaging agents but wild-type survival in a mouse infection model. Infect. Immun. 69:3562-3568.[Abstract/Free Full Text]
    44. 44
  44. Sassetti, C. M., D. H. Boyd, and E. J. Rubin. 2003. Genes required for mycobacterial growth defined by high density mutagenesis. Mol. Microbiol. 48:77-84.[CrossRef][Medline]
    45. 45
  45. Saves, I., M. A. Laneelle, M. Daffé, and J. M. Masson. 2000. Inteins invading mycobacterial RecA proteins. FEBS Lett. 480:221-225.[CrossRef][Medline]
    46. 46
  46. Saves, I., L. A. Lewis, F. Westrelin, R. Warren, M. Daffé, and J. M. Masson. 2002. Specificities and functions of the recA and pps1 intein genes of Mycobacterium tuberculosis and application for diagnosis of tuberculosis. J. Clin. Microbiol. 40:943-950.[Abstract/Free Full Text]
    47. 47
  47. Soni, R. K., P. Mehra, N. R. Choudhury, G. Mukhopadhyay, and S. K. Dhar. 2003. Functional characterization of Helicobacter pylori DnaB helicase. Nucleic Acids Res. 31:6828-6840.[Abstract/Free Full Text]
    48. 48
  48. Stover, C. K., V. F. de la Cruz, T. R. Fuerst, J. E. Burlein, L. A. Benson, L. T. Bennett, G. P. Bansal, J. F. Young, M. H. Lee, G. F. Hatfull, et al. 1991. New use of BCG for recombinant vaccines. Nature 351:456-460.[CrossRef][Medline]
    49. 49
  49. Takahashi, Y., and U. Tokumoto. 2002. A third bacterial system for the assembly of iron-sulfur clusters with homologs in archaea and plastids. J. Biol. Chem. 277:28380-28383.[Abstract/Free Full Text]
    50. 50
  50. Vergne, A. F., A. J. Walz, and M. J. Miller. 2000. Iron chelators from mycobacteria (1954-1999) and potential therapeutic applications. Nat. Prod. Rep. 17:99-116.[CrossRef][Medline]
    51. 51
  51. Veyron-Churlet, R., O. Guerrini, L. Mourey, M. Daffé, and D. Zerbib. 2004. Protein-protein interactions within the Fatty Acid Synthase-II system of Mycobacterium tuberculosis are essential for mycobacterial viability. Mol. Microbiol. 54:1161-1172.[CrossRef][Medline]
    52. 52
  52. Wang, T., G. Shen, R. Balasubramanian, L. McIntosh, D. A. Bryant, and J. H. Golbeck. 2004. The sufR gene (sll0088 in Synechocystis sp. strain PCC 6803) functions as a repressor of the sufBCDS operon in iron-sulfur cluster biogenesis in cyanobacteria. J. Bacteriol. 186:956-967.[Abstract/Free Full Text]
    53. 53
  53. Xu, X. M., and S. G. Møller. 2004. AtNAP7 is a plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Proc. Natl. Acad. Sci. USA 101:9143-9148.[Abstract/Free Full Text]
    54. 54
  54. Zalacain, M., A. Gonzalez, M. C. Guerrero, R. J. Mattaliano, F. Malpartida, and A. Jimenez. 1986. Nucleotide sequence of the hygromycin B phosphotransferase gene from Streptomyces hygroscopicus. Nucleic Acids Res. 14:1565-1581.[Abstract/Free Full Text]
    55. 55
  55. Zheng, M., X. Wang, L. J. Templeton, D. R. Smulski, R. A. LaRossa, and G. Storz. 2001. DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide. J. Bacteriol. 183:4562-4570.[Abstract/Free Full Text]

Journal of Bacteriology, September 2005, p. 6137-6146, Vol. 187, No. 17
0021-9193/05/$08.00+0     doi:10.1128/JB.187.17.6137-6146.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Ayala-Castro, C., Saini, A., Outten, F. W. (2008). Fe-S Cluster Assembly Pathways in Bacteria. Microbiol. Mol. Biol. Rev. 72: 110-125 [Abstract] [Full Text]  
  • Loiseau, L., Gerez, C., Bekker, M., Ollagnier-de Choudens, S., Py, B., Sanakis, Y., Teixeira de Mattos, J., Fontecave, M., Barras, F. (2007). ErpA, an iron sulfur (Fe S) protein of the A-type essential for respiratory metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 104: 13626-13631 [Abstract] [Full Text]  
  • Layer, G., Gaddam, S. A., Ayala-Castro, C. N., Ollagnier-de Choudens, S., Lascoux, D., Fontecave, M., Outten, F. W. (2007). SufE Transfers Sulfur from SufS to SufB for Iron-Sulfur Cluster Assembly. J. Biol. Chem. 282: 13342-13350 [Abstract] [Full Text]  
  • Huet, G., Castaing, J.-P., Fournier, D., Daffe, M., Saves, I. (2006). Protein Splicing of SufB Is Crucial for the Functionality of the Mycobacterium tuberculosis SUF Machinery. J. Bacteriol. 188: 3412-3414 [Abstract] [Full Text]  
  • Wennerhold, J., Bott, M. (2006). The DtxR Regulon of Corynebacterium glutamicum.. J. Bacteriol. 188: 2907-2918 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huet, G.
Right arrow Articles by Saves, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huet, G.
Right arrow Articles by Saves, I.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»