Previous Article | Next Article ![]()
Journal of Bacteriology, October 2005, p. 6691-6700, Vol. 187, No. 19
0021-9193/05/$08.00+0 doi:10.1128/JB.187.19.6691-6700.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Marjan J. Smeulders,1,
Julia A. M. Hubbard,2
Jacquie Keer,1,
and
Huw D. Williams1*
Division of Biology, Faculty of Life Sciences, Imperial College London, Sir Alexander Fleming Building, Imperial College Road, London SW7 2AZ, United Kingdom,1 Computational, Analytical and Structural Sciences, GlaxoSmithKline, Gunnels Wood Road, Stevenage, Herts SG1 2NY, United Kingdom2
Received 26 April 2005/ Accepted 19 July 2005
|
|
|---|
1,700 proteins during entry into and survival in carbon-starved stationary phase by Mycobacterium smegmatis. Strikingly, among the patterns of expression observed were a group of proteins that were expressed in exponential-phase cultures and severely repressed in 48-h stationary-phase cultures (Spr or stationary-phase-repressed proteins) but were synthesized again at high levels in
128-day stationary-phase cultures (Spr128
proteins). A number of Spr128
proteins were identified, and they included the heat shock protein DnaK, the tricarboxylic acid cycle enzyme succinyl coenzyme A synthase, a FixA-like flavoprotein, a single-stranded DNA binding protein, and elongation factor Tu (EF-Tu). The identification of EF-Tu as an Spr128
protein is significant, as ribosomal components are known to be expressed in a growth rate-dependent way. We interpreted these data in terms of a model whereby stationary-phase mycobacteria comprise populations of cells that differ in both their growth status and gene expression patterns. To investigate this further, we constructed gene fusions between the rpsL gene promoter (which heads the Mycobacterium smegmatis operon encoding the tuf gene encoding EF-Tu) or the rrnA promoter gene and an unstable variant of green fluorescent protein. While the majority of cells in old stationary-phase cultures had low levels of fluorescence and so rpsL expression, a small but consistently observed population of approximately 1 in 1,000 cells was highly fluorescent. This indicates that a small fraction of the cells was expressing rpsL at high levels, and we argue that this represents the growing subpopulation of cells in stationary-phase cultures. |
|
|---|
We have studied adaptation to stationary phase in the fast-growing, nonpathogenic species Mycobacterium smegmatis using carbon-starved stationary phase as a model for mycobacterial persistence. On entry into carbon-starved stationary phase, M. smegmatis undergoes physiological changes resulting in increased stress resistance, an increase in mRNA stability, and an overall decrease in protein synthesis, and the cells underwent reductive cell division (30). Upon recovery in fresh medium, stationary-phase cultures showed an immediate increase in protein synthesis irrespective of culture age. Furthermore, it has been reported that carbon-starved M. smegmatis induces a homologue of the Escherichia coli Dps protein, whichhas a role in protecting the E. coli chromosome (11). During prolonged stationary phase, variants arise which include colony morphology variants which have a growth advantage in stationary phase over exponential-phase-adapted strains. Competition experiments with an exponential-phase-adapted wild-type strain showed that a colony morphology variant from an old stationary-phase culture had a competitive advantage in stationary phase, as well as providing evidence that growth and cell division occurred in stationary-phase cultures of M. smegmatis. The ability of these stationary-phase-adapted strains to take over cultures suggested that the population of stationary-phase M. smegmatis cultures is both heterogeneous and dynamic (30).
Kaprelyants and coworkers have shown that M. tuberculosis and M. smegmatis can form "nonculturable" cells in stationary phase (28, 29). M. smegmatis grown under suboptimal conditions, in particular in the absence of trace elements, which led to a reduced growth rate, formed a stable population of nonculturable cells in stationary phase (28). Furthermore, the same study indicated that purF and devR (dosR) mutants, which show a marked loss of viability under oxygen-starved conditions (5, 8, 17, 26, 36), also transiently enter a nonculturable state (28). M. smegmatis could be resuscitated from this nonculturable state. Nonculturable cells of M. tuberculosis were obtained by the same group upon prolonged stationary-phase incubation under conditions during which oxygen availability was certainly restricted (29). This led to the formation of small nonculturable cells which, in contrast to cells present in the Wayne oxygen depletion model that retain metabolic activity and so cannot be truly dormant, showed no detectable metabolic activity. The authors argued that these cells were truly dormant and went on to show that they could be resuscitated by addition of the Rpf protein or spent culture medium (29).
In this paper, we have used a proteomic approach to study the changes in protein synthesis that occur in M. smegmatis upon entry into carbon-starved stationary phase and during prolonged starvation. This was achieved by using two-dimensional (2D) gel electrophoresis of radiolabeled cellular protein extracts, followed by computer-aided analysis of the synthesis levels of individual proteins.
|
|
|---|
Preparation of radioactively labeled protein samples for 2D gel electrophoresis. One-milliliter samples from 50-ml cultures of M. smegmatis were labeled with 20 µCi of [35S]methionine (code SJ1515; Amersham) for 30 min (exponentially growing cells) or 50 µCi for 6 h (stationary-phase cells) in 5-ml sterile tubes in an orbital incubator at 37°C, 200 rpm. Labeling was stopped by addition of 10 µl of 100 mM unlabeled methionine for 5 min.
Samples were prepared for 2D gel electrophoresis using a modified version of the Tempst method (32): One milliliter of mid-exponential-phase culture (approximately 5 x 107 cells) and 1 ml of stationary-phase culture (approximately 1 x 109 cells) were spun down and washed in 0.4 ml of wash buffer (1 mM Tris HCl [pH 7.4], 10 mM MgCl2). The cells were resuspended in 115 µl of lysis buffer (50 mM Tris HCl [pH 6.8], 5% [vol/vol] ß-mercaptoethanol, 5% [vol/vol] glycerol). An approximately half volume of glass beads was added, and the cells were broken by beating for 100 s in a Mini-Beadbeater (Stratech Scientific). Sodium dodecyl sulfate (SDS) was then added to 2% (wt/vol), and the mixture was heated at 95°C for 4 min. The samples were centrifuged for 4 min at 12,000 rpm in a microcentrifuge to remove insoluble cell debris and glass beads. The supernatant was diluted 1:10 with solubilization buffer (9 M urea, 4% [vol/vol] Nonidet P-40, 2% [vol/vol] ampholytes [pH 3 to 10], 1% [wt/vol] dithiothreitol). The samples were stored as 1-ml aliquots at 80°C. The amount of radiolabel incorporated in each protein sample was assayed by liquid scintillation counting (9).
Sample concentration. When required, protein samples were concentrated by ultrafiltration using either a Centricon-3 (Amicon) or an Ultrafree-4 (Millipore) concentrator unit with a molecular mass cutoff of 3 or 5 kDa, respectively.
First-dimension isoelectric focusing. Precast, dry polyacrylamide gel strips containing an immobilized pH gradient between pHs 4 and 7 or between pHs 3 and 10 were obtained from Amersham (Immobiline Dry Strip) and prepared for use as recommended by the manufacturer. First-dimension isoelectric focusing was done using the Pharmacia Multiphor II flat-bed system connected to a Pharmacia MultiDrive XL power pack and a thermostatic circulator (Endocal RTE-100; NESLAB). Samples between 20 and 100 µl were loaded onto rehydrated gel strips, and proteins were focused in two stages (8 h at 300 V, 1 mA, and 5 W, followed by 8 h at 2,000 V, 1 mA, and 5 W) at 20°C to prevent urea in the gel strips from crystallizing. After the first-dimension run, gels were stored at 80°C or used immediately in the second dimension.
Second-dimension SDS-polyacrylamide gel electrophoresis. First-dimension gel strips were equilibrated for 10 min in 10 ml of SDS equilibration solution (per 200 ml: 0.05 M Tris HCl [pH 6.8], 72 g of urea, 60 ml of glycerol, and 2 g of SDS) with 25 mg of dithiothreitol and for another 10 min in 10 ml of equilibration solution with 0.45 g of iodoacetamide. Precast polyacrylamide gels with a linear polyacrylamide gradient of 8 to 18% (ExcelGel SDS; Pharmacia) for the Multiphor II system were used, with precast anodic and cathodic buffer strips (ExcelGel SDS buffer strips; Amersham), according to the supplier's instructions. Molecular weight markers used were Dalton Mark VII-L (Sigma). The gel was run at 600 V, 20 mA, and 30 W for 25 min, after which the first-dimension strip gels were removed. The gel was then run at 600 V, 50 mA, and 30 W for a further 75 min. The temperature was maintained at 16°C.
Protein visualization. Radioactive gels were stained with silver according to the Multiphor II instruction manual (Amersham). They were then removed from their plastic backing using a FilmRemover (Amersham) and dried onto 3-mm Whatman paper under a vacuum at 55°C for 3 h (Slab Gel Drier 4050; Savant). The dried gels were exposed to Biomax X-ray film (Kodak, IBI), together with radioactive calibration strips, which are essential for quantitative analysis of the gel spots (9). Exposure times varied between 7 and 30 days.
Analysis of 2D gels using PDQuest. For quantitative analysis of changes in protein expression after entry into carbon-starved stationary phase, samples from several independent cultures of each condition were obtained, and usually two gels were run of each sample. Most gels were exposed to film twice, once for about 7 days and once for 30 days. Calibration strips were exposed alongside the gels. As well as qualitative visual analysis, all autoradiographs were analyzed using PDQuest 5.0 2D gel analysis software (Protein and DNA ImageWare Systems Inc.), which is derived from the QUEST system (10). The software was run on a SUN Sparc IPC workstation. Files were saved on rewritable optical disks using a RICOH MO optical disk drive (Raytek Scientific Ltd.).
Scanning gels. Autoradiographs of gels and calibration strips were scanned using a densitometer (Discovery Series, model DNA 35; Protein and DNA ImageWare Systems Inc.). Before the gels were scanned, the conversion of the densitometer signal to OD with the appropriate filter was calibrated using an OD step tablet (Kodak photographic step tablet no. 3). The radioactivity of the calibration strip segments and the date of counting were entered, as well as the counts loaded onto the gel, the gel run date, and the start and duration of the exposure for each gel. This information was used by the PDQuest software to calculate a calibration curve that enabled quantification of each protein spot on the gels in disintegrations per minute.
Image processing and spot detection. The file produced after scanning, the 2D scan, was first processed by the median smooth algorithm to reduce possible scanning single-pixel errors and then by the averaging smooth algorithm to reduce high-frequency noise in small areas. Next, multiple exposures of the same gels were merged. By using multiple exposures, the number of saturated and faint spots could be reduced. Merging yielded the gel image file, which was then subjected to vertical-streak and background removal, followed by two cycles of averaging smooth. PDQuest next automatically detected and fitted all spots (at medium sensitivity, 2D Gaussian fitting), creating the gel spot file. The detected spots on each gel were subsequently checked by eye. Spots that were missed were added, and wrongly detected spots were removed (about 20% of the spots).
Creating matchsets. Once spots had been detected on each gel, they were combined in matchsets. In each matchset, the best gel was chosen as the standard gel. The spots from all other gels in the matchset were subsequently matched to the standard by identifying the same spot in each gel and landmarking it. After landmarking at least 10% of the total number of spots, PDQuest could then automatically match most other spots. Unmatched spots (i.e., spots that were present in some of the member gels but not in the standard gel) were added to the standard. The spots in all gels of the matchset were checked manually for matching errors. In each gel, individual spot disintegrations per minute were normalized by dividing the spot quantity by the total disintegrations per minute of the spots in that gel and multiplying by 1,000,000 to get parts per million. This allowed direct comparison of quantitative values of spots in different gels of the matchset.
The matchset used in the experiments reported here comprised three gels of samples from three independent cultures of exponentially growing M. smegmatis, three gels of samples from three independent 48-h stationary-phase cultures, and four gels of four independent cultures at 128, 276, 210, and 260 days of stationary phase. In the matchset, one of the exponential-phase gels acted as the standard. This matchset was used to analyze the changes that occur in protein expression upon entry into and during prolonged carbon-limited stationary phase. This was done by creating groups of gels within the matchset, one containing the three exponential-phase gels, another with the three stationary-phase gels, and a third with the four old gels. It was then possible to create sets of spots that were either unique to one of these groups or that were quantitatively different. Statistically significantly differently induced spots were identified by creating a statistical set of spots using Student's t test to a confidence limit of P = 0.05.
Sequencing of proteins. For N-terminal sequencing, gels were run as described above and proteins transferred to polyvinylidene difluoride membrane. The membrane was washed in several changes of distilled H2O (dH2O) for 20 min, in 50% methanol for 20 min, and again in dH2O for 20 min. It was then immersed in 100% methanol for a few seconds, stained with Coomassie brilliant blue (CBB) solution (1 g of CBB R250 was dissolved in 400 ml of methanol, and then 10 ml of acetic acid and 590 ml of dH2O were added) for 45 s, and destained in several washes of 50% methanol over 15 min. The membrane was then rinsed in dH2O for 2 x 5 min and air dried until the background color had changed from blue to white. Spots were excised and stored at 20°C. They were N terminally sequenced by ProSeq, Inc. (proseq@tiac.net). To increase our confidence that we had actually obtained sequence from the induced proteins, we only selected well-isolated spots for analysis.
Construction of gene fusions. The rpsL and rrnA promoters from M. smegmatis (18, 19) were amplified by PCR using M. smegmatis genomic DNA as a template with primers rpsL-F (CCGGAATTCGCGAACGTAGGGTGG), rpsL-R (CGCGGATCCGGCTTTCTCTGTGTTGC), rrnA-F (CCGGAATTCGTGGAAAACCTGGTCAGC), and rrnA-R (CGCGGATCCAACAACAAACAAAAACCA). The primers incorporate restriction enzyme recognition sites (bold). The promoters were cloned into the EcoRI-BamHI sites in the multiple cloning site of plasmids pOT51 (wild-type green fluorescent protein [GFP]) and pFlame3 (unstable GFP) (4). This resulted in plasmids pOT51-rpsL, pFlame3-rpsL, and pFlame3-rrnA, which were introduced into M. smegmatis strains by electroporation. Where appropriate, strains were grown in the presence of 50 µg of kanamycin ml1 (plasmid selection). The stability of the plasmids in stationary-phase cultures was checked by plating samples on medium with and without kanamycin, and following this, no evidence for plasmid instability was detected.
Flow cytometry and cell sorting. Samples were analyzed using a Becton Dickinson FACScan II flow cytometer. All parameters were detected on logarithmic scales, and detector sensitivities were set as follows: forward scatter, E00; side scatter, 280; green fluorescence, 780. Two hundred thousand events were analyzed using CellQuest v3.3 (Becton Dickinson). Samples were also run on a Becton Dickinson FacsVintageSorter where single cells were sorted onto Luria-Bertani agar plates or in 96-well microtiter plates containing Luria-Bertani broth.
|
|
|---|
128-day stationary-phase cultures. The global changes that were observed are summarized in Table 1 and Fig. 1, and examples of gels are shown in Fig. 2. Upon entry into carbon-starved stationary phase, 1,172 proteins (66%) continued to be synthesized (usually at a changed level; see below); the synthesis of 430 proteins (24%) was switched off to levels below the detection limit, and 185 proteins (10%) were newly synthesized in stationary phase (Table 1). Of the 1,172 proteins that were found in both exponential and stationary phases, the synthesis rate of 482 proteins (27% of the total number of proteins in the matchset) had not changed more than twofold in stationary phase compared with exponential phase. The synthesis rate of 417 proteins (23%) was reduced after 48 h of stationary phase. For most of the repressed proteins, expression was reduced between 2- and 20-fold compared with the level in exponential phase (Fig. 1). Finally, the expression of 273 spots (15%) was increased at least twofold in stationary phase. Of these, about half were induced 2- to 4-fold compared with exponential phase and 14 proteins showed a synthesis rate that was more than 20-fold higher than in exponential phase (Fig. 1). In summary, in stationary-phase M. smegmatis cultures, the synthesis of 47% of the resolved proteins was repressed (Spr proteins, for stationary phase repressed), 25% of the proteins were upregulated or synthesized for the first time (Spi proteins, for stationary phase induced), and the synthesis of 27% of the proteins did not change more than twofold (Spm proteins, for stationary-phase expression maintained). |
View this table: [in a new window] |
TABLE 1. Global changes in protein expressiona
|
![]() View larger version (24K): [in a new window] |
FIG. 1. Plot of the n-fold changes in the expression levels of proteins after 48 h in carbon-starved stationary phase, compared with the levels in exponential phase. The bar at zero change shows the number of proteins where expression was less than twofold different in stationary phase. The bars on either side of the zero bar show the total number of spots where expression was more than twofold repressed (to the left) or induced (to the right). Bars without a < or > symbol represent the number of spots with expression levels changed more than the number of the previous bar but less than the number of the indicated bar, e.g., fourfold increased means that expression was three- to fourfold increased.
|
![]() View larger version (82K): [in a new window] |
FIG. 2. Examples of autoradiographs of gels from exponential-phase (a), 48-h carbon-starved stationary-phase (b), and 128-day carbon-starved stationary-phase cultures (c).
|
Stationary-phase-induced (Spi) proteins.
Of 458 proteins that were upregulated in 48-h stationary-phase compared to exponential-phase cultures or whose synthesis was detected for the first time (Spi proteins, stationary phase induced), 58 showed statistically significantly increased expression in 48-h stationary-phase cultures. After checking the 58 spots manually for matching errors, two were discarded. Examples of the expression levels of these spots are shown in Fig. 3A and in the supplemental material. Of these proteins, the expression of 36 was downregulated in cultures at
128 days of stationary phase relative to levels at 48 h of stationary phase (Spi128
). These transiently expressed proteins may be required for the initial adaptation to stationary-phase conditions. Continued high synthesis levels may not be required for survival, either because the protein is stable or because it is no longer required. The remaining 22 proteins had either similarly high (14 proteins) or higher (6 proteins) expression levels in old cultures (Spi128
). This group may represent Spi proteins that need to be continuously synthesized during stationary phase for survival of the cell.
![]() View larger version (17K): [in a new window] |
FIG. 3. Examples of protein expression patterns of M. smegmatis during growth, entry into, and survival in carbon-starved stationary phase. (A) Stationary-phase-induced (Spi) proteins. The Spi proteins all show statistically significant induction at 48 h into stationary phase (Student's t test, P = 0.05). Quantities are given in mean parts per million (ppm) ± the standard error (se), and these were calculated by dividing the disintegrations per minute of the spot by the total disintegrations per minute of all the spots in that gel and multiplying by 1,000,000 ppm. The SSP (standard spot number) is the unique number that PDQuest assigns to each spot of the matchset. (B) Proteins with expression levels maintained at exponential-phase levels at 48 h of stationary phase (Spm proteins). The expression of the Spm proteins was maintained at 48 h of stationary phase within 1.1-fold of the level in exponential phase. (C) Stationary-phase-repressed (Spr) proteins. The Spr proteins all show statistically significant repression in 48 h of stationary phase compared with exponential phase (Student's t test, P = 0.05). The proteins shown here are all Spr128 , i.e., proteins with increased expression levels after 128 days in stationary phase compared with 48 h of stationary phase.
|
128 days of stationary phase (Spm128=). The expression of 21 spots had dropped in prolonged stationary phase (Spm128
). Finally, 14 proteins showed increased expression in cultures at
128 days of stationary phase compared with either exponential phase or 48 h of stationary phase (Spm128
). To this last group were added 14 proteins which had a low level of expression in exponential phase and at 48 h of stationary phase but a statistically significant increase in expression after prolonged stationary phase.
Proteins repressed in early (48 h) stationary phase (Spr proteins).
Eight hundred forty-seven protein spots were either unique to the exponential phase or repressed more than twofold in 48 h of stationary phase, of which 79 showed statistically significant changes as determined by Student t tests. We refer to this protein spot set as stationary-phase-repressed (Spr) proteins. This group could be subdivided depending upon what happened to their expression in stationary-phase cultures
128 days old (see supplemental material). For 17 Spr proteins, synthesis levels remained low or dropped further during prolonged stationary phase (Spr128= or Spr128
). However, expression of the remaining 62 proteins was increased in
128-day stationary-phase cultures compared with 48 h of stationary phase (Spr128
proteins, Fig. 3C, and see also the supplemental material). The fact that proteins with high expression levels in exponential phase are synthesized again during prolonged stationary phase after a temporary shutdown early in stationary phase is intriguing and suggests that cell growth and division may be occurring in older cultures.
How can the protein synthesis patterns be explained?
Particularly striking was the finding that a group of proteins (Spr128
, Fig. 3C) was expressed in exponential phase and their expression was repressed at 48 h of stationary phase but increased again in
128-day-old stationary-phase cultures. Another group of proteins was clearly more highly expressed in stationary phase, a subgroup of which maintained or increased expression in old stationary-phase cultures (Fig. 3A). The observed protein synthesis patterns can be explained by the presence of physiologically distinct populations of cells in stationary phase, which have specific gene expression profiles. We set out to test the hypothesis that carbon-starved cultures of mycobacteria are physiologically heterogeneous and comprise populations of cells that differ in their patterns of gene expression. This first required the identification of these proteins.
Identification of Spr128
proteins.
The identification of proteins proved problematic primarily because of the difficulty in superimposing images of autoradiographs of 2D gels obtained from protein expression experiments onto 2D gels of protein content obtained by CBB staining, which were used to prepare samples for mass spectrometry and N-terminal sequencing. In many cases, proteins that were synthesized at high levels under given conditions were not particularly abundant. However, we were able to identify five Spr128
proteins (Table 2). These included the heat shock protein and molecular chaperone DnaK, the alpha subunit of the tricarboxylic acid (TCA) cycle enzyme succinyl coenzyme A (CoA) synthase, a FixA-like flavoprotein, and a single-stranded DNA binding protein homologue. Of particular interest was our finding that one of the Spr128
proteins was elongation factor Tu (EF-Tu), the ribosomal component with a role in translation.
|
View this table: [in a new window] |
TABLE 2. Identities of Spr128 proteins
|
rpsL-gfp (unstable) expression is growth phase dependent. Analysis of rpsL- and rrnA-gfp expression in M. smegmatis populations using flow cytometry shows a shift in population expression distribution following entry into stationary phase (Fig. 4A and B and data not shown). In exponential-phase cultures, the largest population of cells is expressing these fusions at high levels. However, this population rapidly switches off expression of these genes upon entry into stationary phase. A shift in the fluorescence in the cell population was observed as the culture entered stationary phase until a stable low-fluorescence (low-expression) population was obtained (Fig. 4A). In Fig. 4B, fluorescence from the fusion-containing bacteria is plotted against forward scatter, which approximates to cell size in flow cytometry experiments. The intrinsic propensity of mycobacteria to clump can interfere with the flow cytometry of M. smegmatis cultures. In experiments where cells were sorted, we found that samples from the left-hand quadrants of the plots were composed of single cells while clumps of cells were primarily found in samples from the right-hand quadrants. The scatter plots clearly show the shift from a highly expressing population in exponentially growing cultures to a largely nonexpressing population by 3 days into carbon-starved stationary phase.
![]() View larger version (55K): [in a new window] |
FIG. 4. Flow cytometry analysis of rpsL-gfp (unstable) expression in M. smegmatis during exponential phase and entry into carbon-starved stationary phase (SP). Early SP is 10 h after entry into stationary phase.
|
![]() View larger version (41K): [in a new window] |
FIG. 5. Flow cytometry analysis of rpsL-gfp (unstable) expression in carbon-starved stationary-phase (SP) cultures of M. smegmatis. Cultures carrying the gene fusion were grown into carbon-starved stationary phase. Cultures represented in the left panels carried the rpsL-gfp (unstable) fusion, while those in the right panels carried control plasmid pFlame3.
|
![]() View larger version (39K): [in a new window] |
FIG. 6. The rpsL-expressing subpopulation of stationary-phase (SP) cells can become enriched in colony morphology variants. The boxed areas in the 3-month-old cultures indicate the regions from which samples were cell sorted, and the proportion of different normal and flat colony morphology forms obtained in each sample upon plating is indicated.
|
|
|
|---|
). This may reflect the requirement for specific proteins for the initial adaptation to stationary phase. Previously, we showed that the overall protein synthesis rate declined upon entry of M. smegmatis into stationary phase, but it did not stop completely, even after 75 days of carbon starvation (30). In this study, we found that even after 276 days in stationary phase, proteins were still synthesized (data not shown). Intriguingly, many of the proteins synthesized during this prolonged stationary phase were proteins that had been repressed during early stationary phase (Spr128
proteins). How can these protein synthesis patterns be explained? The existence of the Spr128
class of proteins could be explained by the presence of growing and dividing cells in these cultures. This is consistent with our previous observation that new variants, with a competitive survival advantage in stationary phase, accumulate in old stationary-phase cultures of M. smegmatis. These strains are able to take over the stationary-phase population by actively dividing (30), a phenomenon first described for E. coli and referred to as the GASP (growth advantage in stationary phase) phenotype (8, 39). These data suggest a model in which there are heterogeneous populations of cells in stationary phase showing different protein expression profiles, one subpopulation being actively growing and expressing Spr128
proteins. A prediction of this model is that there will be heterogeneity at the level of gene expression or differential levels of posttranscriptional regulation of protein expression in subpopulations of stationary-phase cells, although these possibilities are not mutually exclusive.
Although we did not find any proteins that were uniquely synthesized during prolonged stationary phase, a class of protein was identified with low synthesis levels in the exponential and early stationary phases and high levels in prolonged stationary phase (Spm128
proteins), suggesting that continuous synthesis of some proteins is required for survival. These proteins could be synthesized by cells that were entering, or had entered, a physiological state that was different from either the exponential or the early stationary phase. One such state could be dormancy, and so we cannot rule out the presence of a subpopulation of dormant cells (28, 29). It follows that an alternative model is one in which all the cells in old stationary-phase cultures are a homogenous population in one particular physiological state, in which they express a unique combination of proteins, including those we have identified as Spi128
, Spi128=, and Spr128
.
Support for the first model comes from the identification of five Spr128
proteins (Table 2) and is consistent with metabolic processes involved in growth and cell division being active in stationary-phase cultures. The N terminus of Spr128
protein spot 3322 was highly homologous to M. tuberculosis Rv0952, encoding the
subunit of the TCA cycle enzyme succinyl-CoA synthetase (also known as succinate thiokinase). The synthesis of this protein suggests that there is carbon flux through the TCA cycle in old stationary-phase cultures, which would be consistent with a fraction of the population being actively growing. Another of the Spr128
proteins was identified as homologous to Rv3029c or FixA, which as a probable electron transfer flavoprotein subunit is likely to be involved in intermediary metabolism. It has been suggested that FixA in M. avium may have a role in fatty acid oxidation (6). Single-stranded DNA binding protein was identified as an Spr128
protein. It is an essential protein necessary for the functioning of DNA replication, repair, and recombination machineries and so is of utmost importance in maintaining genome integrity (21). DnaK was also identified as an Spr128
protein. DnaK is a heat shock protein which, with DnaJ and GrpE, forms part of the major Hsp70 chaperone and plays a key role in preventing the aggregation of damaged proteins and is essential for folding nascent proteins under all conditions (12, 13, 20). Particularly striking was the finding that one of the Spr128
proteins was the ribosomal component (EF-Tu), as there is excellent evidence that ribosomal components are synthesized in a growth rate-related way (3, 33). Furthermore, in M. smegmatis cultures carrying an M. tuberculosis rrnA-lacZ transcriptional fusion, ß-galactosidase activity increased up to sixfold in direct proportion to the growth rate (35). Therefore, our demonstration that EF-Tu is synthesized significantly in old stationary-phase cultures directly supports the idea that there is an actively growing subpopulation of cells in old stationary-phase cultures.
The identification of Spr128
proteins allowed us to start to test the hypothesis that carbon-starved cultures of mycobacteria are physiologically heterogeneous and comprise populations of cells that differ in their patterns of gene expression. In many bacteria, including mycobacteria, the tuf gene coding for EF-Tu is in an operon headed by the rpsL gene that encodes the ribosomal protein S12 (19). Construction of transcriptional fusions between the promoters of rpsL and rrnA and an unstable variant of GFP allowed us to use flow cytometry to investigate expression of these fusions at the single-cell level to try to identify subpopulations of cells with different expression patterns. A highly fluorescent subpopulation of cells expressing rpsL and rrnA existed in old stationary-phase cultures, which we estimated to consist of approximately 1 in 1,000 cells. It is well established that rRNA and ribosomal protein genes are expressed in a growth rate-dependent manner; indeed, this has been directly shown in mycobacteria (1, 3, 33, 34). Not all cells in the stationary-phase population will grow. Cells will be limited by the availability of nutrients from dying cells, and while most live cells in a stationary-phase population will have potential access to nutrients, cells with a selective advantage under the prevailing environmental conditions will be favored for growth. Therefore, we propose that the highly expressing population is a growing and dividing fraction of the stationary-phase population. Fitter variants, similar to the GASP mutants described in E. coli, accumulate in stationary-phase cultures of M. smegmatis. These often manifest themselves as stable colony morphology variants (30), as indeed has been also demonstrated for E. coli (8). It is within the rpsL-expressing (growing) population that one would expect GASP mutants to arise, and this was shown by the experiment described in Fig. 6. Using a stable rpsL-gfp fusion, we found that a highly fluorescent, rpsL-expressing population which accumulated in stationary phase was highly enriched in colony morphology variants compared to the nonexpressing (nongrowing?) population.
Only 1 in 1,000 cells of the population is transcribing from the rpsL and rrnA promoters at any time in old stationary-phase cultures. Therefore, it is perhaps surprising that the EF-Tu synthesis levels are apparently so high in stationary phase when only a fraction of the population is expressing rpsL. mRNA stability may be an important factor here, and it is certainly the case that bulk mRNA stability increases significantly in stationary-phase cultures (30). It is possible that the Spr128
-encoding mRNAs are very stable and so long lived in a significant fraction of the population. This would result in a subpopulation, which would be much larger than the fraction expressing rpsL, being capable of translating Spr128
proteins such as EF-Tu, with perhaps a trigger being the availability of nutrients from dying cells. This might explain an apparent lack of correlation between EF-Tu synthesis levels and rpsL-gfp expression in the population. Of course, the tuf gene encoding EF-Tu is in a polycistronic mRNA with rpsL rpsG and fusA, and posttranscriptional regulatory effects may mean that rpsL expression levels are a poor indicator of EF-Tu levels.
An intriguing issue is whether M. tuberculosis shows physiological heterogeneity during infection. It has been known for some time that treatment of tuberculosis with conventional drugs is slow and difficult. So antitubercular drugs such as isoniazid are able to kill all the bacteria in a growing M. tuberculosis culture in days while the same drug takes months in tissues during infection. Yet evidence suggests that this failure does not result from failure of the drug to reach optimal concentrations in tissues. Mitchison proposed some years ago that the persistence of M. tuberculosis cells following drug treatment might result from physiological heterogeneity of bacteria in the tissues, some of which may be actively growing and so sensitive to drug treatment and others of which may be slow growing or in a nongrowing state (15, 24). These issues have been considered in more depth in a review article by McKinney (23). Our present work suggests strategies that might be adapted to looking at heterogeneity in infection models of tuberculosis.
We thank Aaron Rae for his expert assistance with flow cytometry.
¶ Supplemental material for this article may be found at http://jb.asm.org/. ![]()
M.C.J.B. and M. J. S. contributed equally to this work. ![]()
Present address: LGC Ltd., Queens Road, Teddington, Middlesex TW11 0LY, United Kingdom. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»