Previous Article | Next Article 
Journal of Bacteriology, January 2005, p. 795-799, Vol. 187, No. 2
0021-9193/05/$08.00+0 doi:10.1128/JB.187.2.795-799.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Cloning, Purification, and Enzymatic Properties of Dipeptidyl Peptidase IV from the Swine Pathogen Streptococcus suis
Marie-Claude Jobin,1
Gabriela Martinez,2
Julie Motard,1
Marcelo Gottschalk,2,3 and
Daniel Grenier1,3*
Groupe de Recherche en Écologie Buccale, Faculté de Médecine Dentaire, Université Laval, Quebec City,1
Groupe de Recherche sur les Maladies Infectieuses du Porc, Faculté de Médecine Vétérinaire, Université de Montréal,2
Canadian Research Network on Bacterial Pathogens of Swine, Natural Sciences and Engineering Research Council of Canada, Saint-Hyacinthe, Quebec, Canada3
Received 5 July 2004/
Accepted 15 October 2004

ABSTRACT
In this study, the dipeptidyl peptidase IV (DPP IV) of the swine
pathogen
Streptococcus suis was cloned, overexpressed in
Escherichia coli, and characterized. The coding region comprises 2,268 nucleotides
containing an open reading frame that codes for a 755-amino-acid
protein with a calculated molecular mass of 85 kDa. The amino
acid sequence contained the sequence Gly-X-Ser-X-X-Gly, which
is a consensus motif flanking the active-site serine shared
by serine proteases. The recombinant DPP IV showed a high affinity
for the synthetic peptide glycine-proline-
p-nitroanilide and
was strongly inhibited by Hg
2+ and diprotin A.

TEXT
Streptococcus suis, an early colonizer of the upper respiratory
tract, is a major swine pathogen worldwide (
13). Thirty-five
serotypes (1 to 34 and 1/2) have been identified so far and
serotype 2 is the one most commonly isolated from diseased pigs
(
8). Infections caused by this pathogen include meningitis,
arthritis, pneumonia, and septicemia (
9).
S. suis is also an
important zoonotic agent that can cause severe infections in
workers in the pig industry (
5,
24). The mechanisms by which
S. suis invades and infects the host are still unclear even
though numerous studies on potential virulence factors have
been carried out over the past decade. Many virulence candidate
determinants produced by
S. suis have been identified (
21).
Among these virulence factors, the polysaccharide capsule, which
provides protection against phagocytosis (
3), appears critical
for the pathogenicity of
S. suis.
Proteases are important virulence factors for a variety of microbial pathogens and may contribute to tissue degradation and perturbation of the host defense system (14, 23). Recently, our laboratory reported that S. suis produces four major proteases (arginine aminopeptidase, chymotrypsin-like, caseinase, and dipeptidyl peptidase IV [DPP IV]) (11). DPP IV (EC 3.4.14.5) is a highly specific protease that cleaves after the X-Pro and X-Ala residues at the N terminus of polypeptide chains. The DPP IV produced by eukaryotic cells, also called CD26, has been associated with several biological functions (16). Many bacterial species, including Lactobacillus helveticus (26), Streptococcus gordonii (7), Streptococcus thermophilus (25), Porphyromonas gingivalis (12), and Prevotella albensis (27) produce DPP IV. Interestingly, a P. gingivalis mutant deficient in DPP IV was found to be much less virulent than the parent strain in a mouse model, indicating that DPP IV may contribute to the pathogenicity of this microorganism (28). Since DPP IV may play a critical role in virulence, we cloned, purified, and characterized the DPP IV produced by S. suis.
S. suis S735 (European virulent reference strain) and 89-999 (North American virulent field strain) (19), both of which belong to serotype 2, were routinely grown in Todd-Hewitt broth (BBL Microbiology Systems, Cockeysville, Mass.) or on Todd-Hewitt agar at 37°C under aerobiosis. Escherichia coli TOP10, which was purchased from Invitrogen (Burlington, Ontario, Canada), was grown in Luria-Bertani medium (15) at 37°C under aerobiosis. When required, ampicillin (100 µg/ml) was added to the culture medium. S. suis S735 DNA was isolated as described previously (22). Chromosomal DNA of 16 additional S. suis serotype 2 strains (31533, 94-623, 89-1591, 90-1330, 91-1804, 93-614-3, 94-3037, 95-8242, 89-3977b, 96-52466, ITA228, T15, TD10, 4/3H1, 4/39H1, and 4/40H2), prepared in a previous study (4), were also used to screen for the presence of the S. suis S735 DPP IV gene. Genomic DNA was amplified by PCR using KlenTaq DNA polymerase (AB Peptides, St. Louis, Mo.) or Vent DNA polymerase (New England Biolabs, Mississauga, Ontario, Canada) for its high fidelity, following the manufacturer's instructions. The primers N1 (5' ATTTCACTCCTCAGTCAT 3') and N2 (5' GTTCACTCTATCTCCAACCTTC 3') were designed following the identification of a consensus sequence from several streptococci DPP IV genes and a BLAST against the S. suis P1/7 (serotype 2) genomic sequence produced by the Sanger Institute (www.sanger.ac.uk). They amplified a 2.6-kb fragment containing the DPP IV gene (Ss-xPDPP gene) from chromosomal DNA of S. suis which was directly used for DNA sequencing. Internal sequencing of the gene was performed using primers N3 (5' CTATGGCAACCTTTTCAAC 3') and N4 (5' GGCAGTTGGTAGTTGTTC 3'). The above primers were purchased from Invitrogen.
The cloned fragment presented a coding region of 2,268 nucleotides and had a G+C content of 49%, which was much higher than the usual proportion found in the S. suis genome (38 to 42%) (18). The sequence (approximately 3,000 nucleotides) before and after the gene has a G+C content of 36 and 37%, respectively, and a palindrome of 10 nucleotides was identified at 316 from the start codon and at position 2,325 (stop codon at position 2,268). This suggests that the Ss-xPDPP gene may have been acquired from another microorganism evolving in the same environment of S. suis and that the gene was likely inserted in the genome by transformation. A potential promoter sequence and a ribosome binding site were found upstream of the cloned gene based on the homology with published consensus sequences (6). The Ss-xPDPP (strain S735) sequence showed a high degree of homology (99 and 93% identity) with that of strain P1/7 (Sanger Institute) and 89/1591 (National Center for Biotechnology) for which the genomes were recently sequenced. A search in the GenBank database revealed that the derived amino acid and nucleotide sequences of Ss-xPDPP shared identity with the X-Pro dipeptidyl aminopeptidases of Streptococcus pneumoniae, S. thermophilus, Lactobacillus delbrueckii, Streptococcus pyogenes, Lactococcus lactis subsp. lactis, and S. gordonii but not with that of the gram-negative bacterium P. gingivalis (Table 1). This analysis was performed with GenBank sequences using the BLAST network service and ClustalW program (clustalw.genome.ad.jp). The deduced amino acid sequence from the nucleotide sequence revealed that it contained a complete open reading frame coding for a 755-amino-acid protein with a calculated molecular mass of 85 kDa. This correlates well with the molecular masses previously reported for other DPP IVs, including those from P. albensis (27), S. gordonii (7), Lactobacillus sakei (20), and S. thermophilus (25).
View this table:
[in this window]
[in a new window]
|
TABLE 1. Motif of the serine active site and nucleotide and amino acid sequence homologies of S. suis S735 DPP IV with other bacterial DPP IVs
|
Chromosomal DNA (30 µg) from
S. suis S735 (European origin)
and 89-999 (North American origin) was digested with EcoRI and
KpnI to investigate the copy number of the gene and possible
differences related to strain origin. The digested DNA was separated
on a 0.8% agarose gel and transferred to a nylon membrane as
previously described (
15). A DNA probe was produced using primers
N5 (5' CCAGCATCACCAAGTTAGA 3') and N6 (5' TGGAAGGCAGAGTAGGATTTG
3') to amplify an internal segment (nucleotides 728 to 1,757)
of the DPP IV gene. The PCR product (4 µl) was labeled
with digoxigenin using a digoxigenin DNA labeling and detection
kit from Boehringer-Mannheim (Laval, Quebec, Canada), following
the manufacturer's instructions. The hybridization was performed
at 68°C with the previously amplified probe (25 ng/ml).
As shown in Fig.
1, only one copy of the gene was present in
the genome of both strains although the profiles were not the
same. For this reason, the region was further characterized
in different
S. suis serotype 2 strains by amplification with
internal and external primers for the Ss-xPDPP gene. All strains
(17
S. suis strains) except one (91-1804) presented the expected
band when the internal primers N7 and N8 (sequences presented
below) were used (data not shown). When primers (N1 and N2)
external to the Ss-xPDPP gene were used to analyze the same
isolates, the number of positive strains remained the same (data
not shown). These observations suggest that the gene is highly
conserved. The strain 91-1804, which was negative for the presence
of the Ss-xPDPP gene, showed the capacity to hydrolyze the chromogenic
substrate for DPP IV. Further studies may be required to determine
the extent of the variability in the open reading frame of the
strain 91-1804 and the other strains tested.
The primers N7 (5' CGCTTTAATCAATTTTCTTTCATAAAAAAAGAGAC 3') and
N8 (5' TTTGGATTTTCATTGAGTATTAGTGCG 3') were designed and used
to produce a fragment containing the Ss-xPDPP gene without putative
start and stop codons in concordance with the pBAD/thio-TOPO
system (Invitrogen). This system produces a recombinant protein
with six histidine residues at the C terminus and thioredoxin
at the N terminus. A total of 90
E. coli clones were obtained
and 10 were screened for the presence of the gene by PCR. All
10 clones were positive following screening; one was chosen
for further analysis and a second was kept as backup. The chosen
clone overexpressed the protease responsible for
S. suis S735
DPP IV activity in the following induction with 0.2% arabinose.
The cytosol extract of the
E. coli TOP10 clone was prepared
according to the manufacturer's instructions. Glycerol (10%)
was added to the cytoplasmic fraction, which was then loaded
on a Ni
2+-nitrilotriacetic acid affinity chromatography column.
Fractions (1 ml) were collected and analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed
by Coomassie blue staining and were tested for DPP IV activity
using the chromogenic substrate glycine-proline-
p-nitroanilide
(
pNa). The release of
p-nitroaniline was quantified by measuring
the absorbance at 415 nm (
A415). One unit was defined as the
amount of enzyme that generated 1 µmol of
p-nitroaniline
per minute. Fractions with DPP IV activity were pooled and stored
at 20°C. Approximately 1 µg of recombinant
DPP IV was recovered from 1 mg of
E. coli cells (wet weight).
The SDS-PAGE analysis of the purified recombinant DPP IV indicated
a molecular mass of approximately 100 kDa, which represents
the total molecular mass taking into account the His tag and
the thioredoxin attached to the protein (Fig.
2).
Various synthetic peptides labeled with
pNA (Table
2) were tested
for their susceptibility to the recombinant DPP IV. The reaction
mixtures contained 90 µl of diluted (in phosphate-buffered
saline [PBS]) enzyme preparation (324 µU) and 10 µl
of the tested substrate (20 mM). Prior to adding the substrate,
the enzyme was preincubated for 10 min at 37°C. The recombinant
DPP IV had a high affinity for the synthetic substrates Gly-Pro-
pNa
and Ala-Pro-
pNa. To a lesser extent, other dipeptides, including
Lys-Ala-
pNa, Arg-Pro-
pNa, Ala-Ala-
pNa, and Asp-Pro-
pNa, were
also hydrolyzed by the protease. A similar observation was previously
reported for other bacterial DPP IVs (
2,
7,
17,
25).
Graph Prism 4.0 software was used to study the enzyme kinetics.
The
Km and
Vmax values of the Michaelis-Menten curves of the
recombinant DPP IV preparation were determined using Gly-Pro-
pNA,
Ala-Pro-
pNa, and Lys-Ala-
pNa as substrates. The substrate showing
the highest affinity for the recombinant DPP IV was Gly-Pro-
pNa,
with a
Km of 0.26 mM and a
Vmax of 7.8 µmol mg
1 min
1. This value is comparable to those reported for
P. albensis (
27) and
L. helveticus (
26). The recombinant DPP
IV also had significant affinity for Lys-Ala-
pNa (
Km of 0.87
mM) and Ala-Pro-
pNa (
Km of 12 mM) with
Vmax values of 5.9 and
30 µmol mg
1 min
1, respectively.
By using the synthetic peptide Gly-Pro-pNa as substrate, several inhibitors and compounds were tested for their effect on the activity of the recombinant DPP IV (Table 3). The assay was done as described above. The recombinant S. suis DPP IV was strongly inhibited by Hg2+, diprotin A, and SDS. The sulfhydryl group reagent iodoacetamide caused some inhibition, suggesting the involvement of functional sulfhydryl group(s) at or near the active site of the enzyme. This was also observed for the S. thermophilus DPP IV (25). Two serine protease inhibitors (aminoethyl-benzene sulfonyl fluoride hydrochloride and 3,4-dichloroisocoumarin) that strongly inhibit other bacterial DPP IVs had little or no effect on the recombinant S. suis DPP IV. However, this does not imply that the S. suis DPP IV is a nonserine protease, especially since it contains the conserved Gly-X-Ser-X-X-Gly sequence, which is a consensus motif flanking the active-site serine shared by serine proteases, serine esterases, and other DPPs. As shown in Table 1, the recombinant S. suis DPP IV possessed the Gly-Lys-Ser-Tyr-Leu-Gly motif, which is the same found in S. pyogenes and L. lactis subsp. lactis. The motif was located at residue positions 345 to 350, as for S. gordonii.
The DPP IV activity of the purified preparation was measured
at different pH values using the following buffers at 50 mM:
citrate (pH 3 to 6), phosphate (pH 7), Tris (pH 8 and 9), and
carbonate (pH 10 and 11) (Table
4). The assay mixture contained
324 µU of the recombinant DPP IV in 90 µl of buffer
with 10 µl of Gly-Pro-
pNa (20 mM). The
A415 was recorded
following a 45-min incubation at 37°C. The activity of DPP
IV was optimal at pH 8, although more than 50% of activity was
obtained at pH values of 6 and 9. Several incubation temperatures
were tested (4, 10, 24, 37, 45, and 55°C) using PBS as the
buffer and the optimal temperature was found to be 37°C
(Table
4). These optimal conditions observed for the
S. suis recombinant DPP IV were similar or close to those reported for
other bacterial DPP IVs (
2,
7,
17,
25,
27). To evaluate the
stability of the recombinant DPP IV, the enzyme was diluted
to the working concentration and kept for 24 h at 20,
4, 10, or 24°C prior to assaying the activity as described
above (Table
4). The percent residual activity was established
by comparison with a fresh dilution of recombinant DPP IV. The
diluted preparation of recombinant DPP IV was unstable, with
approximately 14% of the original activity remaining after 24-h
incubation at 4°C. On the other hand, the stock preparation
of recombinant DPP IV was not affected by prolonged storage
at 20°C.
A basal medium (
10) was used to investigate the effect of growth
conditions on DPP IV production by
S. suis S735. This medium
was supplemented with glucose at concentrations ranging from
0.1 to 2% and casein hydrolysate (peptone; Becton Dickinson,
Ontario, Canada) at concentrations ranging from 0.2 to 10%.
S. suis S735 was grown overnight in Todd-Hewitt broth and inoculated
(10% inoculum) into prewarmed basal medium. Samples were taken
every 30 min and subjected to centrifugation (16,000
x g, 5
min), and residual bacteria in the supernatant were removed
by filtration through a 0.22-µm-pore-size filter. The
pellets were washed once, resuspended in PBS (50 mM phosphate,
150 mM NaCl, pH 7.2), and stored at 20°C until used.
The DPP IV activity of the culture supernatants and bacterial
cells was determined as follows. The reaction mixtures contained
90 µl of cells (optical density at 660 nm of 0.5 in PBS)
or culture supernatant and 10 µl of Gly-Pro-
pNA (20 mg/ml
in 10% dimethyl sulfoxide). They were incubated at 37°C
for 1.5 h and the cells were removed by centrifugation, if needed,
prior to reading the
A415. DPP IV production by
S. suis S735
was modulated by the concentration of casein hydrolysate added
to the basal culture medium. The highest cell-associated activity
was obtained following growth in the presence of 10% casein
hydrolysate (data not shown). This was twice the activity obtained
with 0 and 1% peptone. No differences were noted for extracellular
DPP IV activity. The modulation of DPP IV by casein hydrolysate
was also observed for
P. albensis (
27). The glucose concentration
had no effect on either the cell-associated or extracellular
DPP IV activity of
S. suis S735. The DPP IV produced by
S. suis was both cell bound and extracellular, which differs from those
produced by other bacteria. For instance, DPP IV activity is
extracellular for
S. gordonii (
7), intracellular for
S. thermophilus (
25), and loosely bound to the cell membrane for
L. lactis subsp.
cremoris (
29).
DPP IV cleaves peptides and proteins with either X-Pro or X-Ala at their N termini. The action of the enzyme on proteins and polypeptides may modify the biological activity of the resulting truncated molecule. Many natural cytokines, including interleukin 1ß, interleukin 2, and RANTES (regulated on activation normal T cell expressed and secreted), have a proline in the second position in their polypeptide chains (16). If the S. suis DPP IV is active on these molecules, it may result in local changes to host responses during the course of certain S. suis-associated infections. On the other hand, the removal of dipeptides from the N termini of peptides can generate new biologically active peptides. DPP IV may thus contribute significantly to the deregulation of inflammatory processes during meningitis. The S. suis DPP IV may also contribute to tissue destruction and systemic bacterial dissemination. Indeed, Abiko et al. (1) reported that the DPP IV of P. gingivalis can further degrade peptides from partially digested type I collagen. The dipeptides produced may also promote bacterial growth. Inactivation of the Ss-xPDPP gene in S. suis using genetic tools should make it possible to determine the contribution of this protease to bacterial growth and pathogenicity.
Nucleotide sequence accession number
The Ss-xPDPP (strain S735) sequence has been submitted to GenBank under accession no. AY533504.

ACKNOWLEDGMENTS
This work was supported by a grant from the Natural Sciences
and Engineering Research Council of Canada (NSERC) and the Canadian
Research Network on Bacterial Pathogens of Swine (NSERC).
We would like to thank Sonia Lacouture for technical assistance as well as Katy Vaillancourt and Benjamin Péant for their helpful advice.

FOOTNOTES
* Corresponding author. Mailing address: Groupe de Recherche en Écologie Buccale, Faculté de Médecine Dentaire, Université Laval, Quebec City, Quebec, Canada G1K 7P4. Phone: (418) 656-7341. Fax: (418) 656-2861. E-mail:
Daniel.Grenier{at}greb.ulaval.ca.


REFERENCES
1 - Abiko, Y., M. Hayakawa, S. Murai, and H. Takiguchi. 1985. Glycylprolyl dipeptidylaminopeptidase from Bacteroides gingivalis. J. Dent. Res. 64:106-111.[Abstract/Free Full Text]
2 - Banbula, A., M. Bugno, J. Goldstein, J. Yen, D. Nelson, J. Travis, and J. Potempa. 2000. Emerging family of proline-specific peptidases of Porphyromonas gingivalis: purification and characterization of serine dipeptidyl peptidase, a structural and functional homologue of mammalian prolyl dipeptidyl peptidase IV. Infect. Immun. 68:1176-1182.[Abstract/Free Full Text]
3 - Charland, N., J. Harel, M. Kobisch, S. Lacasse, and M. Gottschalk. 1998. Streptococcus suis serotype 2 mutants deficient in capsular expression. Microbiology 144:325-332.[Abstract/Free Full Text]
4 - Chatellier, S., M. Gottschalk, R. Higgins, R. Brousseau, and J. Harel. 1999. Relatedness of Streptococcus suis serotype 2 isolates from different geographic origins as evaluated by molecular fingerprinting and phenotyping. J. Clin. Microbiol. 37:362-366.[Abstract/Free Full Text]
5 - Durand, F., C. L. Perino, C. Recule, J. P. Brion, M. Kobish, F. Guerber, and J. Croize. 2001. Bacteriological diagnosis of Streptococcus suis meningitis. Eur. J. Clin. Microbiol. Infect. Dis. 20:519-521.[CrossRef][Medline]
6 - Ferretti, J. J., and R. Curtiss. 1987. Compilation of nucleotide sequences that signal the initiation of transcription and translation in streptococci, p. 282. In J. J. Ferretti and R. Curtiss III (ed.), Streptococcal genetics. ASM Press, Washington, D.C.
7 - Goldstein, J. M., A. Banbula, T. Kordula, J. A. Mayo, and J. Travis. 2001. Novel extracellular x-prolyl dipeptidyl-peptidase (DPP) from Streptococcus gordonii FSS2: an emerging subfamily of viridans streptococcal x-prolyl DPPs. Infect. Immun. 69:5494-5501.[Abstract/Free Full Text]
8 - Gottschalk, M., and M. Segura. 2000. The pathogenesis of the meningitis caused by Streptococcus suis: the unresolved questions. Vet. Microbiol. 76:259-272.[CrossRef][Medline]
9 - Higgins, R., and M. Gottschalk. 1999. Streptococcal diseases, p. 563-578. In B. E. I. Straw, S. Allaire, W. L. Mangeling, and D. J. Taylor (ed.), Diseases of swine, 8th ed. Iowa University Press, Iowa City.
10 - Ikeda, T., T. Iwanami, M. Hirasawa, C. Watanabe, J. R. McGhee, and T. Shiota. 1982. Purification and certain properties of a bacteriocin from Streptococcus mutans. Infect. Immun. 35:861-868.[Abstract/Free Full Text]
11 - Jobin, M. C., and D. Grenier. 2003. Identification and characterization of four proteases produced by Streptococcus suis. FEMS Microbiol. Lett. 220:113-119.[CrossRef][Medline]
12 - Kumagai, Y., K. Konishi, T. Gomi, H. Yagishita, A. Yajima, and M. Yoshikawa. 2000. Enzymatic properties of dipeptidyl aminopeptidase IV produced by the periodontal pathogen Porphyromonas gingivalis and its participation in virulence. Infect. Immun. 68:716-724.[Abstract/Free Full Text]
13 - MacInnes, J. I., and R. Desrosiers. 1999. Agents of the "suis-ide diseases" of swine: Actinobacillus suis, Haemophilus parasuis, and Streptococcus suis. Can. J. Vet. Res. 63:83-89.[Medline]
14 - Maeda, H. 1996. Role of microbial proteases in pathogenesis. Microbiol. Immunol. 40:685-699.[Medline]
15 - Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
16 - Mentlein, R. 1999. Dipeptidyl-peptidase IV (CD26)-role in the inactivation of regulatory peptides. Regul. Pept. 85:9-24.[CrossRef][Medline]
17 - Meyer, J., and R. Jordi. 1987. Purification and characterization of X-prolyl-dipeptidyl-aminopeptidase from Lactobacillus lactis and from Streptococcus thermophilus. J. Dairy Sci. 70:738-745.
18 - Okwumabua, O., J. S. Persaud, and P. G. Reddy. 2001. Cloning and characterization of the gene encoding the glutamate dehydrogenase of Streptococcus suis serotype 2. Clin. Diagn. Lab. Immunol. 8:251-257.[Abstract/Free Full Text]
19 - Quessy, S., J. D. Dubreuil, M. Caya, and R. Higgins. 1995. Discrimination of virulent and avirulent Streptococcus suis capsular type 2 isolates from different geographical origins. Infect. Immun. 63:1975-1979.[Abstract]
20 - Sanz, Y., and F. Toldra. 2001. Purification and characterization of an X-prolyl-dipeptidyl peptidase from Lactobacillus sakei. Appl. Environ. Microbiol. 67:1815-1820.[Abstract/Free Full Text]
21 - Segura, M., and M. Gottschalk. 2004. Extracellular virulence factors of streptococci associated with animal diseases. Front. Biosci. 9:1157-1188.[Medline]
22 - Stuart, J. G., E. J. Zimmerer, and R. L. Maddux. 1992. Conjugation of antibiotic resistance in Streptococcus suis. Vet. Microbiol. 30:213-222.[CrossRef][Medline]
23 - Supuran, C. T., A. Scozzafava, and B. W. Clare. 2002. Bacterial protease inhibitors. Med. Res. Rev. 22:329-372.[CrossRef][Medline]
24 - Tarradas, C., I. Luque, D. de Andres, Y. E. Abdel-Aziz Shahein, P. Pons, F. Gonzalez, C. Borge, and A. Perea. 2001. Epidemiological relationship of human and swine Streptococcus suis isolates. J. Vet. Med. B Infect. Dis. Vet. Public Health 48:347-355.[Medline]
25 - Tsakalidou, E., R. Anastasiou, K. Papadimitriou, E. Manolopoulou, and G. Kalantzopoulos. 1997. Purification and characterisation of an intracellular X-prolyl-dipeptidyl aminopeptidase from Streptococcus thermophilus ACA-DC 4. J. Biotechnol. 59:203-211.[Medline]
26 - Vesanto, E., K. Savijoki, T. Rantanen, J. L. Steele, and A. Palva. 1995. An X-prolyl dipeptidyl aminopeptidase (pepX) gene from Lactobacillus helveticus. Microbiology 141:3067-3075.[Abstract/Free Full Text]
27 - Walker, N. D., N. R. McEwan, and R. J. Wallace. 2003. Cloning and functional expression of dipeptidyl peptidase IV from the ruminal bacterium Prevotella albensis M384(T). Microbiology 149:2227-2234.[Abstract/Free Full Text]
28 - Yagishita, H., Y. Kumagai, K. Konishi, Y. Takahashi, T. Aoba, and M. Yoshikawa. 2001. Histopathological studies on virulence of dipeptidyl aminopeptidase IV (DPPIV) of Porphyromonas gingivalis in a mouse abscess model: use of a DPPIV-deficient mutant. Infect. Immun. 69:7159-7161.[Abstract/Free Full Text]
29 - Yan, T. R., S. C. Ho, and C. L. Hou. 1992. Catalytic properties of X-prolyl dipeptidyl aminopeptidase from Lactococcus lactis subsp. cremoris nTR. Biosci. Biotechnol. Biochem. 56:704-707.[Medline]
Journal of Bacteriology, January 2005, p. 795-799, Vol. 187, No. 2
0021-9193/05/$08.00+0 doi:10.1128/JB.187.2.795-799.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.