Previous Article | Next Article 
Journal of Bacteriology, October 2005, p. 6893-6901, Vol. 187, No. 20
0021-9193/05/$08.00+0 doi:10.1128/JB.187.20.6893-6901.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Genetic Analysis Identifies a Function for the queC (ybaX) Gene Product at an Initial Step in the Queuosine Biosynthetic Pathway in Escherichia coli
Rahul Gaur and
Umesh Varshney*
Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India
Received 17 May 2005/
Accepted 4 August 2005

ABSTRACT
Queuosine (Q), one of the most complex modifications occurring
at the wobble position of tRNAs with GUN anticodons, is implicated
in a number of biological activities, including accuracy of
decoding, virulence, and cellular differentiation. Despite these
important implications, its biosynthetic pathway has remained
unresolved. Earlier, we observed that a naturally occurring
strain of
Escherichia coli B105 lacked Q modification in the
tRNAs. In the present study, we developed a genetic screen to
map the defect in
E. coli B105 to a single gene,
queC (renamed
from
ybaX), predicted to code for a 231-amino-acid-long protein
with a pI of 5.6. As analyzed by mobility of tRNA
Tyr on acid
urea gels and two-dimensional thin-layer chromatography of the
modified nucleosides, expression of QueC from a plasmid-borne
copy confers a Q
+ phenotype to
E. coli B105. Further, analyses
of tRNA
Tyr from
E. coli JE10651 (
queA mutant), its derivative
generated by deletion of chromosomal
queC (
queA
queC), and
E. coli JE7325, deficient in converting preQ
0 to preQ
1, have provided
the first genetic evidence for the involvement of QueC at a
step leading to production of preQ
0, the first known intermediate
in the generally accepted pathway that utilizes GTP as the starting
molecule. In addition, we discuss the possibilities of collaboration
of QueC with other cellular proteins in the production of preQ
0.

INTRODUCTION
Modified nucleosides found in all tRNAs make important contributions
to their structural integrity and biological functions (
4).
Biochemistry of modified nucleoside biosynthesis ranges from
a simple one-step reaction mediated by a single enzyme to a
complex multistep pathway involving a battery of enzymes and
cofactors. Queuosine (Q), 7-{5-[(4S, 5R-dihydrooxy-2-cyclopenten1S-yl)amino]methyl}-7-deazaguanosine,
one of the most complex nucleoside modifications, occurs at
the wobble position of GUN anticodons in tRNAs for Asn, Asp,
Tyr, and His (
14,
18). Queuosine is found in nearly all eukaryotic
and eubacterial organisms, with the known exceptions of
Saccharomyces cerevisiae and
Mycoplasma spp. (
47). Archaea lack Q but possess
a related modified nucleoside, archaeosine (
12). Biosynthesis
of Q is restricted to eubacteria. Eukaryotes obtain queuine,
the base of Q, from diet or intestinal microflora (
19) and insert
it into the tRNAs using the tRNA guanine transglycosylase.
Queuosine modification modulates the codon-anticodon interactions and enhances translational fidelity (3, 25, 44). Interestingly, cells deficient in Q modification downregulate translation of VirF, the most upstream regulator of virulence in Shigella flexneri (9). Queuosine deficiency adversely affects the fitness of Escherichia coli under limiting nutrient conditions (8, 28) and prevents aggregate formation in Dictyostelium discoideum (19). Hypomodification of tRNAs for Q has also been correlated with cellular differentiation (23), malignant tumors, neoplastic cell lines (2, 10, 33), and oncogenic transformation of fibroblasts (27). A surprising aspect of Q biochemistry that was recently revealed is its glutamylation in tRNAAsp by YadB (36). The presence of this "modification of a hypermodification" further deepens the mystery of the physiological roles of Q and its analogs.
Although the Q modification has been known for over three decades, details of its biosynthetic pathway remain unresolved. As shown in Fig. 1, Q is believed to arise from GTP (17, 21) by the action of an unknown cyclohydrolase-like enzyme to form 7-cyano-7-deazaguanine, preQ0 (29), which is then converted to 7-aminomethyl-7-deazaguanine (preQ1) (31). The enzyme Tgt exchanges the base of G34 in the anticodon with preQ1 (30). However, Tgt is also known to utilize preQ0 and guanine as substrates with lower efficiencies (17). preQ1 is further modified at the level of tRNA. The enzyme QueA utilizes S-adenosylmethionine (40) to form epoxyqueuosine (oQ) (11, 32). In the final step, an unknown enzyme reduces oQ to Q in a vitamin B12-dependent manner (11).
Genetic studies have played a major role in identification of
both the Tgt and the QueA steps in Q biosynthesis (
29,
31,
35).
However, difficult genetic screens to isolate such strains (
28)
combined with complex biochemical assays have rendered most
other proposed steps in the Q biosynthetic pathway virtually
intractable. Recently, a bioinformatics approach led to identification
of a tetracistronic operon,
ykvJKLM (renamed
queCDEF), in
Bacillus subtilis for its involvement at uncharacterized steps of Q biosynthesis
upstream of Tgt (
34). In
E. coli, orthologs of these cistrons
(
ybaX, ygcM, ygcF, and
yqcD, respectively) are found independently
in different locations. Further, the product of
queF thought
to be the missing cyclohydrolase turned out to be an enzyme
that converts preQ
0 to preQ
1 (
45). Functional details of the
products of the other cistrons (
queC, queD, and
queE) have not
been established.
Earlier, we reported (8) on the serendipitous observation of an uncharacterized mutation in E. coli B105 resulting in the absence of Q (Q). Here, we present a genetic analysis of this strain to identify queC (ybaX) as a new member of the Q biosynthetic pathway whose gene product is essential in biosynthesis of preQ0 in E. coli.

MATERIALS AND METHODS
Bacterial strains, plasmids and growth conditions.
The bacterial strains and plasmids used in this study are listed
in Table
1. All strains were grown in LB broth or agar medium
(
26). When required, ampicillin (Amp, 100 µg ml
1),
kanamycin (Kan, 25 µg ml
1) chloramphenicol (Cam,
30 µg ml
1), or tetracycline (Tet, 7.5 µg
ml
1) was added to the medium. For growth curve experiments,
0.05% (vol/vol) of saturated cultures was inoculated into 50
ml fresh LB broth with the appropriate antibiotic. Growth was
monitored by measuring absorbance (595 nm) at hourly intervals.
Generation of a transposon library in E. coli BL21 and isolation of E. coli B105 (Q+).
Transposon (Tn
10 Kan
r version) delivery vehicle

NK1316 was
prepared by infecting a permissive host,
E. coli LE392, and
used to generate a transposon insertion library (

26,000 colonies)
in
E. coli BL21 (
20). The P1 phage lysate raised on the library
(donor) was used for genetic transfer into
E. coli B105 (recipient)
by P1-mediated transduction (
26). Transductants (

13,000) thus
obtained were pooled and made competent by the CaCl
2 method
(
37) to take up pTZ
queA-tgt (Amp
r), and the earliest appearing
transformants (12 h) were screened for the Q
+ phenotype by analysis
of Tyr-tRNA
Tyr using acid urea gels (
46).
Isolation of tRNA, acid urea polyacrylamide gel electrophoresis, and Northern analysis.
Total tRNA was isolated under acidic conditions from log-phase cultures of various strains, fractionated on polyacrylamide (6.5%) acidic (pH 5.0) urea (8 M) gels, and transferred onto a Nytran membrane (46). When needed, the tRNA preparations were subjected to alkaline treatment (0.1 M Tris-HCl, pH 9.0, at 37°C for 30 min) to deacylate the tRNAs prior to electrophoresis. Northern blot analysis was performed using a 5'-32P end-labeled DNA oligomer (5' TACAGTCTGCTCCCTTTGGCCGCTC 3') complementary to tRNATyr (8).
Mapping of the transposon insertion site in B105 (Q+).
The inverse-PCR approach (15) was used to map the transposon insertion site in B105 (Q+). Briefly, 1 µg genomic DNA from E. coli B105 (Q+) was treated with 10 U of Sau3AI at 37°C for 5 h in a 30-µl volume, followed by heating at 70°C for 20 min to inactivate the enzyme. The reaction was diluted to 300 µl, and a 150-µl aliquot was supplemented with 16.6 µl of 10x ligase buffer and 5 U of T4 DNA ligase and incubated at 16°C for 12 h. The DNA was ethanol precipitated and taken up in 10 µl water, and a 5-µl aliquot was used for PCR in a 50-µl reaction containing 200 µM deoxynucleoside triphosphates (dNTPs), 20 pmol each of forward and reverse primers (15), 5 µl of 10x Taq buffer, and 1 U Taq DNA polymerase. The PCR conditions were as follows: 94°C for 4 min, followed by 29 cycles of 94°C for 1 min, 53°C for 30 s, and 70°C for 1 min, followed by 70°C for 10 min and 4°C for 5 min. The product (
600 bp) was cloned into pGEMTeasy and sequenced by Sanger's dideoxy method using the vector-specific reverse primer 5' CAGGAAACAGCTATGAC 3'.
Cloning of queC (ybaX).
queC was amplified from E. coli HB101 DNA using Pfu DNA polymerase in a 50-µl PCR containing 20 pmol each of forward (5' AAACGTGCTGTCGTTGTGTTC 3') and reverse (5' GTGGATCCGGATGCTCAAGCCG 3') primers, as well as 200 µM dNTPs in the supplied buffer. Initial denaturation was done at 95°C for 4 min, followed by 30 cycles of 94°C for 1 min, 46°C for 30 s, and 70°C for 1 min 35 s, and a final extension of 10 min at 70°C. For cloning, the vector pTrc99C was digested with NcoI, supplemented with dNTPs (final concentration of 200 µM), and end filled with the Klenow fragment of DNA polymerase I. The vector was then digested with BamHI, eluted after agarose gel electrophoresis, and ligated to a BamHI-digested queC amplicon.
In vivo labeling of tRNA and enrichment of tRNATyr.
Exponentially growing cells of E. coli B105 harboring vector (pTrc99C) or pTrcqueC were harvested, metabolically labeled with [32P]orthophosphate in low-phosphate medium, and used to isolate total tRNA by phenol extraction of the cells (38, 42). Approximately 75 ng of a biotinylated DNA oligomer (5' Biotin-GTCTGCTCCCTTTGGCCGCTCGGGAA 3') complementary to tRNATyr was mixed with total tRNA preparation in 2x SET buffer (0.3 M NaCl, 50 mM Tris-HCl [pH 8.0], and 2 mM EDTA), heated at 95°C for 5 min, and allowed to return to room temperature over 3 h. A 50-µl aliquot of streptavidin-iron oxide resin (Sigma) was added to the mix, allowed to bind for 30 min, and pulled down under a magnetic field. The pellet was washed with 100 µl water, resuspended in 75 µl water, heated to 95°C for 5 min, and quick-chilled on ice, and the particles were repelleted with a magnet. The supernatant was used for base analysis (8, 28).
Generation of E. coli JE10651
queC (queA
queC).
The queC (ybaX) knockout in E. coli JE10651 was generated as described by Datsenko and Wanner (7). Briefly, 10 pmol each of the ybaXko_fp (5' GCTGTCGTTGTGTTCAGTGGAGGTCAGGATTCCACCGTGTA-GGCTGGAGCTGCTTCG 3') and ybaXko_rp (5' CCTCAACCCGGTTTTCTGCTTCAT-CGCTGCCATCACCATATGAATATCCTCCTTA 3') primers was used to amplify a Camr cassette from pKD3 with Pfu DNA polymerase. The linear DNA was purified and electroporated into E. coli JE10651 harboring pKD46. The transformants were selected on Cam, and the allelic exchange (queC::Cam) was confirmed by PCR amplification of the queC locus with an upstream ybaXupfp primer (5' ATGAATAGCTGGTCCGGG 3') and the downstream cloning primer, ybaXrp. Subsequently, the Cam cassette was excised by introduction of the plasmid pCP20 (Ampr), and the culture was grown at 42°C to lose pCP20 (7). The queA
queC strain thus generated was sensitive to the antibiotics used and suitable for the introduction of plasmids harboring the queA or queC gene.

RESULTS
Development of a genetic screen to identify defect in queuosine biosynthetic pathway in E. coli B105.
By making use of the acid urea gels, we identified a Q
strain of
E. coli B105 (
8). Detailed analyses revealed that
both cistrons of the
queA-
tgt operon in the strain coded for
functional products. Interestingly, multicopy presence of the
queA-tgt plasmid, but not of a
queA
tgt plasmid, was found to
be toxic to
E. coli B105. Expectedly, as shown in Fig.
2, when
transformants of
E. coli B105 harboring either the vector or
the
queA-tgt plasmid (which appear upon prolonged incubation)
were patched, the transformants harboring the vector but not
the
queA-tgt plasmid grew prominently in 10 h (Fig.
2A, rows
1 and 2). The transformants harboring the
queA-tgt plasmid revealed
weak growth when the plates were left further for 20 h (Fig.
2B, row 2). On the contrary, growth of
E. coli BL21, a common
laboratory B strain (Q
+, but not isogenic with
E. coli B105),
containing either the vector or the
queA-tgt plasmid was indistinguishable
at any time (Fig.
2A and B, rows 3 and 4). While the reasons
behind the toxicity of the
queA-tgt plasmid in
E. coli B105
are unclear, the observations suggested that a genetic transfer
converting
E. coli B105 Q
to Q
+ could alleviate the toxicity
caused by the
queA-tgt plasmid and allow for a simple genetic
screen to identify the missing genetic information.
Transductional crosses between E. coli BL21 (Q+) and E. coli B105 (Q).
Using standard genetic methods, we first prepared a library
of randomly inserted transposon (Kan
r) in the chromosome of
E. coli BL21 (Q
+). The P1 phage raised on this library was then
used to transduce
E. coli B105. A pool of

13,000 transductants
(Kan
r) was made competent to take up the
queA-tgt plasmid, and
the status of Tyr-tRNA
Tyr from the earliest-appearing transformants
was analyzed by acid urea gels. This analysis resulted in isolation
of one Q
+ transductant (Fig.
3A, lane 3). The stability of the
Q
+ phenotype and its linkage with the Kan
r transposon were further
confirmed by its growth on a Kan plate and analysis of the tRNA
from the daughter colonies. The Tyr-tRNA
Tyr from all daughter
colonies (Fig.
3B, lanes 3 to 5) migrated with the same mobility
as that from the Q
+ strains such as
E. coli TG1 (Fig.
3B, lane
1) and donor
E. coli BL21 (Fig.
3B, lane 6). In contrast, Tyr-tRNA
Tyr from parent
E. coli B105 (Q
) showed the characteristic
faster mobility (Fig.
3B, lane 2). Back transductions using
E. coli B105 (Q
+) as the donor and parent
E. coli B105 harboring
pACDH (to mark it with Tet
r) as the recipient showed a cotransduction
of the Kan
r transposon and the acquired marker(s) conferring
the Q
+ phenotype, with a frequency of

50% (out of 18 transductants
analyzed, 9 were Q
+ [data not shown]) suggesting a close linkage
between the two. Furthermore, as with
E. coli BL21, when the
queA-tgt plasmid was introduced into the
E. coli B105 (Q
+) transductant,
its growth was no longer discriminated from that harboring the
vector (Fig.
3C, panels i and ii).
Mapping of the transposon insertion site in E. coli B105 (Q+).
To characterize the site of transposon insertion, we used a
divergent set of primers at the ends of the known sequences
of the transposon to amplify the flanking DNA from
E. coli B105
(Q
+) by inverse PCR and to sequence it. Use of the 60-nucleotide
sequence obtained for the DNA flanking the transposon, as a
query for BLAST, revealed no significant matches with any of
the presently available
E. coli genome sequences (none of which
are from B strains). However, this analysis showed a remarkably
good match (98%) with
Shigella flexneri 2a strain 2457T (Fig.
4A) and the unfinished genome of
Shigella sonnei. The region
of match in
S. flexneri lies between hypothetical genes S4812
and S0372 (Fig.
4B), about 700 bp away from
cyoE. Interestingly,
the genome organizations in the vicinity of
cyoE for
E. coli K-12 and
S. flexneri are very similar (compare Fig.
4B and C),
allowing us to deduce that the Kan
r transposon in the
E. coli B105 (Q
+) transductant landed in the vicinity of
cyoE (

9.61
min). At this juncture, a report (
34) showed that the genes
of the
ykvJKLM operon are involved in Q biosynthesis in
B. subtilis.
One of the genes at the 10-min locus in the
E. coli genome,
queC (renamed from
ybaX), showed 57% sequence identity and 75%
sequence similarity to
ykvJ at the amino acid level. These observations,
and the linkage of

50% between the Q
+ and Kan
r (at 9.61 min)
markers in P1-mediated transductions, encouraged us to investigate
a possible role of QueC in conferring the Q
+ phenotype to
E. coli B105.
queC complements E. coli B105 Q phenotype.
The
queC open reading frame was cloned into pTrc99C to yield
the pTrc
queC expression construct and introduced into
E. coli B105. As shown in Fig.
5A, the presence of pTrc
queC in
E. coli B105, irrespective of induction by IPTG (isopropyl-ß-
D-thiogalactopyranoside),
conferred slower mobility to Tyr-tRNA
Tyr, which corresponded
to the Q
+ phenotype (Fig.
5A, compare lanes 3 and 4 with lanes
1 and 2). However, to further confirm the role of QueC,
32P-body-labeled
tRNA from
E. coli strain B105 harboring either the vector (pTrc99C)
or the expression construct (pTrc
queC) was enriched for tRNA
Tyr and subjected to modified base analysis (
8,
28). As shown in
Fig.
5B, the tRNA
Tyr from
E. coli B105 containing pTrc
queC (Fig.
5B, panel ii) revealed a spot corresponding to queuosine (Qp)
which was absent from the tRNA
Tyr prepared from
E. coli B105
with vector control (Fig.
5B, panel i). These data demonstrate
that a lack of functional QueC in
E. coli B105 led to its Q
phenotype and that
queC codes for a function in the Q biosynthesis
pathway in
E. coli.
queC gene product functions at an initial step in Q biosynthesis pathway.
The penultimate step in Q biosynthesis is the conversion of
preQ
1 to oQ, which is carried out by QueA (Fig.
1). To map the
step at which QueC participates, we generated a knockout of
queC in
E. coli JE10651 (
queA mutant). The tRNA from
E. coli JE10651, a
queA mutant strain, migrates as a diffuse band between
Q
+ and Q
tRNAs (Fig.
6A, compare lane 3 with lanes 1
and 2). Expectedly, when the strain was provided with a plasmid-borne
copy of
queA, mobility of the tRNA was rescued to that of the
Q
+ form (Fig.
6A, compare lane 3 with lanes 2 and 4). On the
other hand, introduction of a plasmid-borne copy of
queC did
not alter the mobility of the tRNA (Fig.
6A, compare lanes 3
and 5). However, deletion of the
queC gene from the strain resulted
in a faster mobility of the tRNA, corresponding to the Q
form (Fig.
6A, compare lanes 3 and 6), which could not be rescued
by the presence of plasmid-borne
queA (Fig.
6A, compare lanes
4 and 7). As a control, plasmid-borne
queC restored its mobility
to that of the tRNA from
E. coli JE10651 (Fig.
6A, compare lanes
3 and 8). Similar observations were made when the analysis was
repeated using deacylated preparations of tRNA (Fig.
6B). Taken
together, these observations clearly suggest that QueC functions
upstream of QueA (Fig.
1). Since Tgt is known to be involved
immediately upstream of QueA, the function of
queC can be unambiguously
placed at a step prior to that of Tgt in the generally accepted
scheme of Q biosynthesis (Fig.
1).
To fine map the step of QueC function, we exploited yet another
strain,
E. coli JE7325, deficient in converting preQ
0 to preQ
1.
Although the site of mutation responsible for this deficiency
has not been characterized, its phenotype is more severe at
a nonpermissive temperature of 43°C (
29). As seen in Fig.
7, when
E. coli JE7325 is grown at 30°C, Tyr-tRNA
Tyr bands
corresponding to Q
+ and Q
forms are present. The faster-migrating
band in the
E. coli JE7325 sample most likely represents a population
of tRNAs containing both G and preQ
0 at position 34 (
29). Nevertheless,
it is clear that the presence of pTrc
queC does not result in
any increase in Q
+ tRNA
Tyr or a change in the relative abundance
of the two bands in
E. coli JE7325 (Fig.
7, compare lanes 2
and 3). Expectedly, when the samples were subcultured at 43°C,
the amount of tRNA in the Q
+ form decreased. At this temperature
also, the presence of
queC in
E. coli JE7325 did not rescue
the mobility of Tyr-tRNA
Tyr (Fig.
7, compare lanes 4 and 5).
These observations clearly show that introduction of the
queC plasmid in
E. coli JE7325 does not complement the defect in
the Q biosynthesis pathway and thus makes it unlikely that
queC codes for a function involved in the conversion of preQ
0 to
preQ
1. In fact, a very recent report has now shown that conversion
of preQ
0 to preQ
1 is carried out by QueF (YkvM in
B. subtilis)
(
45). Taken together, these observations strongly suggest that
the function of QueC is upstream of preQ
0.

DISCUSSION
Queuosine is one of the most complex modifications occurring
in the tRNAs. This modification influences such crucial functions
as accuracy of decoding, virulence, and cellular differentiation.
Furthermore, recently it was discovered that Q modification
in tRNA
Asp served as an unusual site for glutamylation by YadB,
a paralog of GluRS. Such significant biological properties of
the Q modification have made it engaging to study its biosynthetic
pathway (
13,
16,
36).
In an earlier study, we observed that a naturally occurring strain of E. coli B105 lacked Q modification in the tRNAs because of a defect in an uncharacterized gene(s). In the present study, we have genetically mapped the defect in E. coli B105 to a single gene, queC (ybaX), predicted to code for a 231-amino-acid-long protein with a pI of 5.6 and a molecular mass of 25.36 kDa (http://genolist.pasteur.fr/Colibri/). This study provides the first genetic evidence for the involvement of QueC at a step upstream of preQ0, the first known intermediate in the generally accepted pathway that utilizes GTP as the starting molecule. Our findings may appear to contradict the predictions of this step being carried out by QueF (34). However, in a very recent report, QueF has been demonstrated to convert preQ0 to preQ1 (45), further supporting our analysis of the involvement of QueC in the generation of preQ0.
The distribution of queC orthologs is another important indication of the role of queC in Q biosynthesis. Archaea are known to synthesize preQ0 but not preQ1 (17). As expected, queC orthologs are present in archaea (Fig. 8) (34). In the case of mammals, the situation is reversed: mammals obtain the free base queuine and insert it into tRNA. This obviates a requirement for the queC ortholog, and in fact the queC ortholog is not seen in a BLAST search with the mammalian genomes at the NCBI server. Only seven sequences relating to argininosuccinate or asparagine synthetases come up in such an analysis. Some classes of bacteria, viz., actinobacteria (Mycobacterium spp. and Streptomyces spp.) and mollicutes (Mycoplasma spp. and Ureaplasma spp.), also do not seem to possess a QueC-like sequence, and their genomes present argininosuccinate synthases as the best matches to QueC.
An alignment of several QueC orthologs (Fig.
8) from diverse
species of archaea and eubacteria reveals the conserved motifs
of this protein. The N terminus contains the SGGXDS motif that
matches the SXGXDS signature motif of PP-loop ATPases (
1). In
addition, the comparison reveals the presence of four conserved
cysteines in QueC towards the C terminus. Similar motifs have
been found in the iron-sulfur cluster-containing and zinc-containing
proteins involved in tRNA modifications (
17,
22). The way in
which these predicted biochemical properties may be related
to a role for QueC at the initial step in the accepted Q biosynthetic
pathway, wherein queuosine is believed to arise from GTP (reviewed
in reference
17), remains to be investigated. The formation
of preQ
0 was found to be similar to the biosynthesis of toyocamycin
(
21), and a GTP cyclohydrolase-like enzyme was proposed to catalyze
this step. However, later studies ruled out the involvement
of GTP cyclohydrolases I and II in this reaction (
39). Considering
that complex chemical transformations are needed for the conversion
of GTP to preQ
0, such a role for QueC may well necessitate its
functional interaction with other cellular proteins. Notably,
QueD (
ykvK, ygcM), QueE (
ykvL, ygcF), and QueF (
ykvM, yqcD)
have also been suggested to function upstream of Tgt (
13,
34).
With the recent biochemical characterization that QueF carries
out preQ
0-to-preQ
1 conversion (
45), it is quite likely that
QueD and QueE collaborate with QueC in the production of preQ
0,
which may well be a multistep reaction. On the other hand, according
to a recent large-scale protein-protein interaction study (
6),
QueC has been shown to interact with components of translation
machinery (
rpsJ, tufA), putative enzymes (
aidB, yfiD), a transporter
(
yegT), and a chaperone (
dnaK). However, the implications of
these interactions for Q biosynthesis are not clear. Furthermore,
although toyocamycin production has been studied for
Streptomyces rimosus (
43), its close relatives
Streptomyces avermitilis MA4680
and
Streptomyces coelicolor A3 (and actinobacteria in general)
do not reveal a QueC ortholog in a protein-protein BLAST, which
casts doubt on the proposal of similarity between toyocamycin
and queuosine biosynthesis at this step.
Interestingly, with the characterization of the genetic defect in E. coli B105, we now have each of the steps in Q biosynthesis identified by a well-defined mutation in E. coli (Fig. 1). These strains, and the genetic screen developed in this study, could prove to be crucial in the biochemical characterization of the various proteins involved in this important pathway. Especially, the identification of the genetic defect in E. coli B105 at the initial step(s) in Q biosynthesis will be instrumental in detailed biochemical analysis of the reaction mediated by the queC gene product.

ACKNOWLEDGMENTS
We thank our laboratory colleagues and the anonymous reviewers
for their suggestions and Akiko Nishimura, National Institute
of Genetics, Mishima, Shizuoka-ken, 411-8540, Japan, for providing
us with various JE series strains.
This work was supported by grants from the Department of Science and Technology, Department of Biotechnology, and Indian Council of Medical Research, New Delhi, India. R.G. is a senior research fellow of the Council of Scientific and Industrial Research, New Delhi, India.

FOOTNOTES
* Corresponding author. Mailing address: Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India. Phone: 91-80-2293 2686. Fax: 91-80-2360 2697. E-mail:
varshney{at}mcbl.iisc.ernet.in.


REFERENCES
1 - Aravind, L., V. Anantharaman, and E. V. Koonin. 2002. Monophyly of class I aminoacyl tRNA synthetase, USPA, ETFP, photolyase, and PP-ATPase nucleotide-binding domains: implications for protein evolution in the RNA. Proteins 48:1-14.[CrossRef][Medline]
2 - Baranowski, W., G. Dirheimer, J. A. Jakowicki, and G. Keith. 1994. Deficiency of queuine, a highly modified purine base, in transfer RNAs from primary and metastatic ovarian malignant tumors in women. Cancer Res. 54:4468-4471.[Abstract/Free Full Text]
3 - Bienz, M., and E. Kubli. 1981. Wild type tRNATyr reads the TMV RNA stop codon, but Q base-modified tRNATyr does not. Nature 294:188-190.[CrossRef]
4 - Björk, G. R. 1995. Biosynthesis and function of modified nucleosides, p. 165-205. In D. Söll and U. L. RajBhandary (ed.), tRNA: structure, biosynthesis and function. ASM Press, Washington, D.C.
5 - Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472.[CrossRef][Medline]
6 - Butland, G., J. M. Peregrin-Alvarez, J. Li, W. Yang, X. Yang, V. Canadien, A. Starostine, D. Richards, B. Beattie, N. Krogan, M. Davey, J. Parkinson, J. Greenblatt, and A. Emili. 2005. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433:531-537.[CrossRef][Medline]
7 - Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
8 - Dineshkumar, T. K., S. Thanedar, C. Subbulakshmi, and U. Varshney. 2002. An unexpected absence of queuosine modification in the tRNAs of an Escherichia coli B strain. Microbiology 148:3779-3787.[Abstract/Free Full Text]
9 - Durand, J. M., B. Dagberg, B. E. Uhlin, and G. R. Björk. 2000. Transfer RNA modification, temperature and DNA superhelicity have a common target in the regulatory network of the virulence of Shigella flexneri: the expression of the virF gene. Mol. Microbiol. 35:924-935.[CrossRef][Medline]
10 - Emmerich, B., E. Zubrod, H. Weber, P. A. Maubach, H. Kersten, and W. Kersten. 1985. Relationship of queuine-lacking transfer RNA to the grade of malignancy in human leukemias and lymphomas. Cancer Res. 45:4308-4314.[Abstract/Free Full Text]
11 - Frey, B., J. McCloskey, W. Kersten, and H. Kersten. 1988. New function of vitamin B12: cobamide-dependent reduction of epoxyqueuosine to queuosine in tRNAs of Escherichia coli and Salmonella typhimurium. J. Bacteriol. 170:2078-2082.[Abstract/Free Full Text]
12 - Gregson, J. M., P. F. Crain, C. G. Edmonds, R. Gupta, T. Hashizume, D. W. Phillipson, and J. A. McCloskey. 1993. Structure of the archaeal transfer RNA nucleoside G*-15 (2-amino-4,7-dihydro-4-oxo-7-ß-D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximidamide (archaeosine)). J. Biol. Chem. 268:10076-10086.[Abstract/Free Full Text]
13 - Grosjean, H., V. de Crecy-Lagard, and G. R. Bjork. 2004. Aminoacylation of the anticodon stem by a tRNA-synthetase paralog: relic of an ancient code? Trends Biochem. Sci. 29:519-522.[CrossRef][Medline]
14 - Harada, F., and S. Nishimura. 1972. Possible anticodon sequences of tRNAHis, tRNAAsn and tRNAAsp from Escherichia coli B. Universal presence of nucleoside Q in the first position of the anticodons of these transfer ribonucleic acids. Biochemistry 11:301-308.[CrossRef][Medline]
15 - Higashitani, A., N. Higashitani, S. Yasuda, and K. Horiuchi. 1994. A general and fast method for mapping mutations on the Escherichia coli chromosome. Nucleic Acids Res. 22:2426-2427.[Free Full Text]
16 - Ibba, M., and C. Francklyn. 2004. Turning tRNA upside down: when aminoacylation is not a prerequisite to protein synthesis. Proc. Natl. Acad. Sci. USA 101:7493-7494.[Free Full Text]
17 - Iwata-Reuyl, D. 2003. Biosynthesis of the 7-deazaguanosine hypermodified nucleosides of transfer RNA. Bioorg. Chem. 31:24-43.[CrossRef][Medline]
18 - Kasai, H., Z. Oashi, F. Harada, S. Nishimura, and N. J. Oppenheimer. 1975. Structure of the modified nucleoside Q isolated from Escherichia coli transfer ribonucleic acid. 7-(4,5-cis-Dihydroxy-1-cyclopenten-3-ylaminomethyl)-7-deazaguanosine. Biochemistry 14:4198-4208.[CrossRef][Medline]
19 - Kersten, H. 1984. On the biological significance of modified nucleosides in tRNA. Prog. Nucleic Acid Res. Mol. Biol. 31:59-114.[Medline]
20 - Kleckner, N., J. Bender, and S. Gottesman. 1991. Uses of transposons with emphasis on Tn10. Methods Enzymol. 204:139-180.[Medline]
21 - Kuchino, Y., H. Kasai, K. Nihei, and S. Nishimura. 1976. Biosynthesis of the modified nucleoside Q in transfer RNA. Nucleic Acids Res. 3:393-398.
22 - Lee, T. T., S. Agarwalla, and R. M. Stroud. 2004. Crystal structure of RumA, an iron-sulfur cluster containing E. coli ribosomal RNA 5-methyluridine methyltransferase. Structure 12:397-407.[Medline]
23 - Lin, V. K., W. R. Farkas, and P. F. Agris. 1980. Specific changes in Q-ribonucleoside containing transfer RNA species during Friend leukemia cell erythroid differentiation. Nucleic Acids Res. 8:3481-3489.[Abstract/Free Full Text]
24 - Mandal, N., and U. L. RajBhandary. 1992. Escherichia coli B lacks one of the two initiator tRNA species present in E. coli K-12. J. Bacteriol. 174:7827-7830.[Abstract/Free Full Text]
25 - Meier, F., B. Suter, H. Grosjean, G. Keith, and E. Kubli. 1985. Queuosine modification of the wobble base in tRNAHis influences in vivo decoding properties. EMBO J. 4:823-827.[Medline]
26 - Miller, J. H. 1972. Experiments in molecular genetics, p. 201-205. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
27 - Morgan, C. J., F. L. Merrill, and R. W. Trewyn. 1996. Defective transfer RNA-queuine modification in C3H10T1/2 murine fibroblasts transfected with oncogenic ras. Cancer Res. 56:594-598.[Abstract/Free Full Text]
28 - Noguchi, S., Y. Nishimura, Y. Hirota, and S. Nishimura. 1982. Isolation and characterization of an Escherichia coli mutant lacking tRNA-guanine transglycosylase. Function and biosynthesis of queuosine in tRNA. J. Biol. Chem. 257:6544-6550.[Abstract/Free Full Text]
29 - Noguchi, S., Z. Yamaizumi, T. Ohgi, T. Goto, Y. Nishimura, Y. Hirota, and S. Nishimura. 1978. Isolation of Q nucleoside precursor present in tRNA of an E. coli mutant and its characterization as 7-(cyano)-7-deazaguanosine. Nucleic Acids Res. 5:4215-4223.[Abstract/Free Full Text]
30 - Okada, N., S. Noguchi, H. Kasai, N. Shindo-Okada, T. Ohgi, T. Goto, and S. Nishimura. 1979. Novel mechanism of post-transcriptional modification of tRNA. Insertion of bases of Q precursors into tRNA by a specific tRNA transglycosylase reaction. J. Biol. Chem. 254:3067-3073.[Abstract/Free Full Text]
31 - Okada, N., S. Noguchi, S. Nishimura, T. Ohgi, T. Goto, P. F. Crain, and J. A. McCloskey. 1978. Structure determination of a nucleoside Q precursor isolated from E. coli tRNA: 7-(aminomethyl)-7-deazaguanosine. Nucleic Acids Res. 5:2289-2296.[Abstract/Free Full Text]
32 - Phillipson, D. W., C. G. Edmonds, P. F. Crain, D. L. Smith, D. R. Davis, and J. A. McCloskey. 1987. Isolation and structure elucidation of an epoxide derivative of the hypermodified nucleoside queuosine from Escherichia coli transfer RNA. J. Biol. Chem. 262:3462-3471.[Abstract/Free Full Text]
33 - Randerath, E., H. P. Agrawal, and K. Randerath. 1984. Specific lack of the hypermodified nucleoside, queuosine, in hepatoma mitochondrial aspartate transfer RNA and its possible biological significance. Cancer Res. 44:1167-1171.[Abstract/Free Full Text]
34 - Reader, J. S., D. Metzgar, P. Schimmel, and V. de Crecy-Lagard. 2004. Identification of four genes necessary for biosynthesis of the modified nucleoside queuosine. J. Biol. Chem. 279:6280-6285.[Abstract/Free Full Text]
35 - Reuter, K., R. Slany, F. Ullrich, and H. Kersten. 1991. Structure and organization of Escherichia coli genes involved in biosynthesis of the deazaguanine derivative queuine, a nutrient factor for eukaryotes. J. Bacteriol. 173:2256-2264.[Abstract/Free Full Text]
36 - Salazar, J. C., A. Ambrogelly, P. F. Crain, J. A. McCloskey, and D. Soll. 2004. A truncated aminoacyl-tRNA synthetase modifies RNA. Proc. Natl. Acad. Sci. USA 101:7536-7541.[Abstract/Free Full Text]
37 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
38 - Seong, B. L., and U. L. RajBhandary. 1987. Escherichia coli formylmethionine tRNA: mutations in GGGCCC sequence conserved in anticodon stem of initiator tRNAs affect initiation of protein synthesis and conformation of anticodon loop. Proc. Natl. Acad. Sci. USA 84:334-338.[Abstract/Free Full Text]
39 - Slany, R. K., and H. Kersten. 1994. Genes, enzymes and coenzymes of queuosine biosynthesis in procaryotes. Biochimie 76:1178-1182.[Medline]
40 - Slany, R. K., M. Bosl, P. F. Crain, and H. Kersten. 1993. A new function of S-adenosylmethionine: the ribosyl moiety of AdoMet is the precursor of the cyclopentenediol moiety of the tRNA wobble base queuine. Biochemistry 32:7811-7817.[CrossRef][Medline]
41 - Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130.[CrossRef][Medline]
42 - Thanedar, S., T. K. Dineshkumar, and U. Varshney. 2001. The mere lack of rT modification in initiator tRNA does not facilitate formylation-independent initiation in Escherichia coli. J. Bacteriol. 183:7397-7402.[Abstract/Free Full Text]
43 - Uematsu, T., and R. J. Suhadolnik. 1970. Nucleoside antibiotics. VI. Biosynthesis of the pyrrolopyrimidine nucleoside antibiotic toyocamycin by Streptomyces rimosus. Biochemistry 9:1260-1266.[CrossRef][Medline]
44 - Urbonavicius, J., Q. Qian, J. M. Durand, T. G. Hagervall, and G. R. Bjork. 2001. Improvement of reading frame maintenance is a common function for several tRNA modifications. EMBO J. 20:4863-4873.[CrossRef][Medline]
45 - Van Lanen, S. G., J. S. Reader, M. A. Swairjo, V. de Crecy-Lagard, B. Lee, and D. Iwata-Reuyl. 2005. From cyclohydrolase to oxidoreductase: discovery of nitrile reductase activity in a common fold. Proc. Natl. Acad. Sci. USA 102:4264-4269.[Abstract/Free Full Text]
46 - Varshney, U., C. P. Lee, and U. L. RajBhandary. 1991. Direct analysis of aminoacylation levels of tRNAs in vivo. Application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase. J. Biol. Chem. 266:24712-24718.[Abstract/Free Full Text]
47 - Yokoyama, S., and S. Nishimura. 1995. Modified nucleosides and codon recognition, p. 207-223. In D. Söll and U. L. RajBhandary (ed.), tRNA: structure, biosynthesis and function. ASM Press, Washington, D.C.
Journal of Bacteriology, October 2005, p. 6893-6901, Vol. 187, No. 20
0021-9193/05/$08.00+0 doi:10.1128/JB.187.20.6893-6901.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Feng, Y., Cronan, J. E.
(2009). A New Member of the Escherichia coli fad Regulon: Transcriptional Regulation of fadM (ybaW). J. Bacteriol.
191: 6320-6328
[Abstract]
[Full Text]
-
Phillips, G., El Yacoubi, B., Lyons, B., Alvarez, S., Iwata-Reuyl, D., de Crecy-Lagard, V.
(2008). Biosynthesis of 7-Deazaguanosine-Modified tRNA Nucleosides: a New Role for GTP Cyclohydrolase I. J. Bacteriol.
190: 7876-7884
[Abstract]
[Full Text]
-
Liu, Y., Dong, Y., Chen, Y.-Y. M., Burne, R. A.
(2008). Environmental and Growth Phase Regulation of the Streptococcus gordonii Arginine Deiminase Genes. Appl. Environ. Microbiol.
74: 5023-5030
[Abstract]
[Full Text]
-
Meyer, M. M., Roth, A., Chervin, S. M., Garcia, G. A., Breaker, R. R.
(2008). Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria. RNA
14: 685-695
[Abstract]
[Full Text]