Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gaur, R. Articles by Varshney, U. Search for Related Content PubMed PubMed Citation Articles by Gaur, R. Articles by Varshney, U.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 2005, p. 6893-6901, Vol. 187, No. 20
0021-9193/05/$08.00+0     doi:10.1128/JB.187.20.6893-6901.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Genetic Analysis Identifies a Function for the queC (ybaX) Gene Product at an Initial Step in the Queuosine Biosynthetic Pathway in Escherichia coli

Rahul Gaur and Umesh Varshney^*

Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India

Received 17 May 2005/ Accepted 4 August 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
Queuosine (Q), one of the most complex modifications occurring at the wobble position of tRNAs with GUN anticodons, is implicated in a number of biological activities, including accuracy of decoding, virulence, and cellular differentiation. Despite these important implications, its biosynthetic pathway has remained unresolved. Earlier, we observed that a naturally occurring strain of Escherichia coli B105 lacked Q modification in the tRNAs. In the present study, we developed a genetic screen to map the defect in E. coli B105 to a single gene, queC (renamed from ybaX), predicted to code for a 231-amino-acid-long protein with a pI of 5.6. As analyzed by mobility of tRNA^Tyr on acid urea gels and two-dimensional thin-layer chromatography of the modified nucleosides, expression of QueC from a plasmid-borne copy confers a Q⁺ phenotype to E. coli B105. Further, analyses of tRNA^Tyr from E. coli JE10651 (queA mutant), its derivative generated by deletion of chromosomal queC (queA queC), and E. coli JE7325, deficient in converting preQ₀ to preQ₁, have provided the first genetic evidence for the involvement of QueC at a step leading to production of preQ₀, the first known intermediate in the generally accepted pathway that utilizes GTP as the starting molecule. In addition, we discuss the possibilities of collaboration of QueC with other cellular proteins in the production of preQ₀.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Modified nucleosides found in all tRNAs make important contributions to their structural integrity and biological functions (4). Biochemistry of modified nucleoside biosynthesis ranges from a simple one-step reaction mediated by a single enzyme to a complex multistep pathway involving a battery of enzymes and cofactors. Queuosine (Q), 7-{5-[(4S, 5R-dihydrooxy-2-cyclopenten1S-yl)amino]methyl}-7-deazaguanosine, one of the most complex nucleoside modifications, occurs at the wobble position of GUN anticodons in tRNAs for Asn, Asp, Tyr, and His (14, 18). Queuosine is found in nearly all eukaryotic and eubacterial organisms, with the known exceptions of Saccharomyces cerevisiae and Mycoplasma spp. (47). Archaea lack Q but possess a related modified nucleoside, archaeosine (12). Biosynthesis of Q is restricted to eubacteria. Eukaryotes obtain queuine, the base of Q, from diet or intestinal microflora (19) and insert it into the tRNAs using the tRNA guanine transglycosylase.

Queuosine modification modulates the codon-anticodon interactions and enhances translational fidelity (3, 25, 44). Interestingly, cells deficient in Q modification downregulate translation of VirF, the most upstream regulator of virulence in Shigella flexneri (9). Queuosine deficiency adversely affects the fitness of Escherichia coli under limiting nutrient conditions (8, 28) and prevents aggregate formation in Dictyostelium discoideum (19). Hypomodification of tRNAs for Q has also been correlated with cellular differentiation (23), malignant tumors, neoplastic cell lines (2, 10, 33), and oncogenic transformation of fibroblasts (27). A surprising aspect of Q biochemistry that was recently revealed is its glutamylation in tRNA^Asp by YadB (36). The presence of this "modification of a hypermodification" further deepens the mystery of the physiological roles of Q and its analogs.

Although the Q modification has been known for over three decades, details of its biosynthetic pathway remain unresolved. As shown in Fig. 1, Q is believed to arise from GTP (17, 21) by the action of an unknown cyclohydrolase-like enzyme to form 7-cyano-7-deazaguanine, preQ₀ (29), which is then converted to 7-aminomethyl-7-deazaguanine (preQ₁) (31). The enzyme Tgt exchanges the base of G34 in the anticodon with preQ₁ (30). However, Tgt is also known to utilize preQ₀ and guanine as substrates with lower efficiencies (17). preQ₁ is further modified at the level of tRNA. The enzyme QueA utilizes S-adenosylmethionine (40) to form epoxyqueuosine (oQ) (11, 32). In the final step, an unknown enzyme reduces oQ to Q in a vitamin B12-dependent manner (11).

View larger version (15K): [in this window] [in a new window]

FIG. 1. Current scheme of queuosine incorporation in tRNAs. The involvement of various proteins at different steps in the pathway and the E. coli strains deficient at these steps are shown. Transformation of GTP to preQ0 at the first step in the pathway is shown by an open arrow. This transformation may involve additional proteins (such as QueD and QueE [13]) or may represent a multistep process.

Genetic studies have played a major role in identification of both the Tgt and the QueA steps in Q biosynthesis (29, 31, 35). However, difficult genetic screens to isolate such strains (28) combined with complex biochemical assays have rendered most other proposed steps in the Q biosynthetic pathway virtually intractable. Recently, a bioinformatics approach led to identification of a tetracistronic operon, ykvJKLM (renamed queCDEF), in Bacillus subtilis for its involvement at uncharacterized steps of Q biosynthesis upstream of Tgt (34). In E. coli, orthologs of these cistrons (ybaX, ygcM, ygcF, and yqcD, respectively) are found independently in different locations. Further, the product of queF thought to be the missing cyclohydrolase turned out to be an enzyme that converts preQ₀ to preQ₁ (45). Functional details of the products of the other cistrons (queC, queD, and queE) have not been established.

Earlier, we reported (8) on the serendipitous observation of an uncharacterized mutation in E. coli B105 resulting in the absence of Q (Q^–). Here, we present a genetic analysis of this strain to identify queC (ybaX) as a new member of the Q biosynthetic pathway whose gene product is essential in biosynthesis of preQ₀ in E. coli.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains, plasmids and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. All strains were grown in LB broth or agar medium (26). When required, ampicillin (Amp, 100 µg ml^–1), kanamycin (Kan, 25 µg ml^–1) chloramphenicol (Cam, 30 µg ml^–1), or tetracycline (Tet, 7.5 µg ml^–1) was added to the medium. For growth curve experiments, 0.05% (vol/vol) of saturated cultures was inoculated into 50 ml fresh LB broth with the appropriate antibiotic. Growth was monitored by measuring absorbance (595 nm) at hourly intervals.

View this table: [in this window] [in a new window]

TABLE 1. List of E. coli strains and plasmids used in this study

Generation of a transposon library in E. coli BL21 and isolation of E. coli B105 (Q⁺). Transposon (Tn10 Kan^r version) delivery vehicle NK1316 was prepared by infecting a permissive host, E. coli LE392, and used to generate a transposon insertion library (26,000 colonies) in E. coli BL21 (20). The P1 phage lysate raised on the library (donor) was used for genetic transfer into E. coli B105 (recipient) by P1-mediated transduction (26). Transductants (13,000) thus obtained were pooled and made competent by the CaCl₂ method (37) to take up pTZqueA-tgt (Amp^r), and the earliest appearing transformants (12 h) were screened for the Q⁺ phenotype by analysis of Tyr-tRNA^Tyr using acid urea gels (46).

Isolation of tRNA, acid urea polyacrylamide gel electrophoresis, and Northern analysis. Total tRNA was isolated under acidic conditions from log-phase cultures of various strains, fractionated on polyacrylamide (6.5%) acidic (pH 5.0) urea (8 M) gels, and transferred onto a Nytran membrane (46). When needed, the tRNA preparations were subjected to alkaline treatment (0.1 M Tris-HCl, pH 9.0, at 37°C for 30 min) to deacylate the tRNAs prior to electrophoresis. Northern blot analysis was performed using a 5'-³²P end-labeled DNA oligomer (5' TACAGTCTGCTCCCTTTGGCCGCTC 3') complementary to tRNA^Tyr (8).

Mapping of the transposon insertion site in B105 (Q⁺). The inverse-PCR approach (15) was used to map the transposon insertion site in B105 (Q⁺). Briefly, 1 µg genomic DNA from E. coli B105 (Q⁺) was treated with 10 U of Sau3AI at 37°C for 5 h in a 30-µl volume, followed by heating at 70°C for 20 min to inactivate the enzyme. The reaction was diluted to 300 µl, and a 150-µl aliquot was supplemented with 16.6 µl of 10x ligase buffer and 5 U of T4 DNA ligase and incubated at 16°C for 12 h. The DNA was ethanol precipitated and taken up in 10 µl water, and a 5-µl aliquot was used for PCR in a 50-µl reaction containing 200 µM deoxynucleoside triphosphates (dNTPs), 20 pmol each of forward and reverse primers (15), 5 µl of 10x Taq buffer, and 1 U Taq DNA polymerase. The PCR conditions were as follows: 94°C for 4 min, followed by 29 cycles of 94°C for 1 min, 53°C for 30 s, and 70°C for 1 min, followed by 70°C for 10 min and 4°C for 5 min. The product (600 bp) was cloned into pGEMTeasy and sequenced by Sanger's dideoxy method using the vector-specific reverse primer 5' CAGGAAACAGCTATGAC 3'.

Cloning of queC (ybaX). queC was amplified from E. coli HB101 DNA using Pfu DNA polymerase in a 50-µl PCR containing 20 pmol each of forward (5' AAACGTGCTGTCGTTGTGTTC 3') and reverse (5' GTGGATCCGGATGCTCAAGCCG 3') primers, as well as 200 µM dNTPs in the supplied buffer. Initial denaturation was done at 95°C for 4 min, followed by 30 cycles of 94°C for 1 min, 46°C for 30 s, and 70°C for 1 min 35 s, and a final extension of 10 min at 70°C. For cloning, the vector pTrc99C was digested with NcoI, supplemented with dNTPs (final concentration of 200 µM), and end filled with the Klenow fragment of DNA polymerase I. The vector was then digested with BamHI, eluted after agarose gel electrophoresis, and ligated to a BamHI-digested queC amplicon.

In vivo labeling of tRNA and enrichment of tRNA^Tyr. Exponentially growing cells of E. coli B105 harboring vector (pTrc99C) or pTrcqueC were harvested, metabolically labeled with [³²P]orthophosphate in low-phosphate medium, and used to isolate total tRNA by phenol extraction of the cells (38, 42). Approximately 75 ng of a biotinylated DNA oligomer (5' Biotin-GTCTGCTCCCTTTGGCCGCTCGGGAA 3') complementary to tRNA^Tyr was mixed with total tRNA preparation in 2x SET buffer (0.3 M NaCl, 50 mM Tris-HCl [pH 8.0], and 2 mM EDTA), heated at 95°C for 5 min, and allowed to return to room temperature over 3 h. A 50-µl aliquot of streptavidin-iron oxide resin (Sigma) was added to the mix, allowed to bind for 30 min, and pulled down under a magnetic field. The pellet was washed with 100 µl water, resuspended in 75 µl water, heated to 95°C for 5 min, and quick-chilled on ice, and the particles were repelleted with a magnet. The supernatant was used for base analysis (8, 28).

Generation of E. coli JE10651queC (queA queC). The queC (ybaX) knockout in E. coli JE10651 was generated as described by Datsenko and Wanner (7). Briefly, 10 pmol each of the ybaXko_fp (5' GCTGTCGTTGTGTTCAGTGGAGGTCAGGATTCCACCGTGTA-GGCTGGAGCTGCTTCG 3') and ybaXko_rp (5' CCTCAACCCGGTTTTCTGCTTCAT-CGCTGCCATCACCATATGAATATCCTCCTTA 3') primers was used to amplify a Cam^r cassette from pKD3 with Pfu DNA polymerase. The linear DNA was purified and electroporated into E. coli JE10651 harboring pKD46. The transformants were selected on Cam, and the allelic exchange (queC::Cam) was confirmed by PCR amplification of the queC locus with an upstream ybaXupfp primer (5' ATGAATAGCTGGTCCGGG 3') and the downstream cloning primer, ybaXrp. Subsequently, the Cam cassette was excised by introduction of the plasmid pCP20 (Amp^r), and the culture was grown at 42°C to lose pCP20 (7). The queA queC strain thus generated was sensitive to the antibiotics used and suitable for the introduction of plasmids harboring the queA or queC gene.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Development of a genetic screen to identify defect in queuosine biosynthetic pathway in E. coli B105. By making use of the acid urea gels, we identified a Q^– strain of E. coli B105 (8). Detailed analyses revealed that both cistrons of the queA-tgt operon in the strain coded for functional products. Interestingly, multicopy presence of the queA-tgt plasmid, but not of a queAtgt plasmid, was found to be toxic to E. coli B105. Expectedly, as shown in Fig. 2, when transformants of E. coli B105 harboring either the vector or the queA-tgt plasmid (which appear upon prolonged incubation) were patched, the transformants harboring the vector but not the queA-tgt plasmid grew prominently in 10 h (Fig. 2A, rows 1 and 2). The transformants harboring the queA-tgt plasmid revealed weak growth when the plates were left further for 20 h (Fig. 2B, row 2). On the contrary, growth of E. coli BL21, a common laboratory B strain (Q⁺, but not isogenic with E. coli B105), containing either the vector or the queA-tgt plasmid was indistinguishable at any time (Fig. 2A and B, rows 3 and 4). While the reasons behind the toxicity of the queA-tgt plasmid in E. coli B105 are unclear, the observations suggested that a genetic transfer converting E. coli B105 Q^– to Q⁺ could alleviate the toxicity caused by the queA-tgt plasmid and allow for a simple genetic screen to identify the missing genetic information.

View larger version (26K): [in this window] [in a new window]

FIG. 2. Growth of E. coli B105 (rows 1 and 2) and E. coli BL21 (rows 3 and 4) transformants on LB agar (Amp) plates. Transformants in rows 1 and 3 harbored pTZ19R vector, whereas those in rows 2 and 4 harbored the pTZqueA-tgt plasmid. Randomly picked transformants (20 each) were patched and grown at 37°C for 10 h, photographed (A), and incubated further for 20 h at 33°C (B).

Transductional crosses between E. coli BL21 (Q⁺) and E. coli B105 (Q^–). Using standard genetic methods, we first prepared a library of randomly inserted transposon (Kan^r) in the chromosome of E. coli BL21 (Q⁺). The P1 phage raised on this library was then used to transduce E. coli B105. A pool of 13,000 transductants (Kan^r) was made competent to take up the queA-tgt plasmid, and the status of Tyr-tRNA^Tyr from the earliest-appearing transformants was analyzed by acid urea gels. This analysis resulted in isolation of one Q⁺ transductant (Fig. 3A, lane 3). The stability of the Q⁺ phenotype and its linkage with the Kan^r transposon were further confirmed by its growth on a Kan plate and analysis of the tRNA from the daughter colonies. The Tyr-tRNA^Tyr from all daughter colonies (Fig. 3B, lanes 3 to 5) migrated with the same mobility as that from the Q⁺ strains such as E. coli TG1 (Fig. 3B, lane 1) and donor E. coli BL21 (Fig. 3B, lane 6). In contrast, Tyr-tRNA^Tyr from parent E. coli B105 (Q^–) showed the characteristic faster mobility (Fig. 3B, lane 2). Back transductions using E. coli B105 (Q⁺) as the donor and parent E. coli B105 harboring pACDH (to mark it with Tet^r) as the recipient showed a cotransduction of the Kan^r transposon and the acquired marker(s) conferring the Q⁺ phenotype, with a frequency of 50% (out of 18 transductants analyzed, 9 were Q⁺ [data not shown]) suggesting a close linkage between the two. Furthermore, as with E. coli BL21, when the queA-tgt plasmid was introduced into the E. coli B105 (Q⁺) transductant, its growth was no longer discriminated from that harboring the vector (Fig. 3C, panels i and ii).

View larger version (37K): [in this window] [in a new window]

FIG. 3. Analysis of tRNATyr in E. coli B105 transductants (A and B) and growth of the E. coli B105 (Q+) transductant and the E. coli BL21 control (C). Total tRNA was fractionated on an acid urea gel, transferred to a nylon membrane, hybridized to 32P-labeled probe against tRNATyr, and subjected to BioImage analysis (FLA2000; Fuji). (A) Analysis of tRNA from the putative transductants (lanes 1, 3, and 4); the Q+ control strains, E. coli TG1 and E. coli BL21 (lanes 5 and 6, respectively); and the recipient strain, E. coli B105 (Q–) (lane 2). (B) The positive transductant b (shown in lane 3 of panel A) was streaked, and three daughter colonies [b(i), b(ii), and b(iii)] were analyzed (lanes 3 to 5) along with positive (lanes 1 and 6) and negative (lane 2) controls. (C) Growth of the E. coli B105 (Q+) transductant (i) and E. coli BL21 (ii), harboring vector (pTZ19R) or pTZqueA-tgt, as indicated.

Mapping of the transposon insertion site in E. coli B105 (Q⁺). To characterize the site of transposon insertion, we used a divergent set of primers at the ends of the known sequences of the transposon to amplify the flanking DNA from E. coli B105 (Q⁺) by inverse PCR and to sequence it. Use of the 60-nucleotide sequence obtained for the DNA flanking the transposon, as a query for BLAST, revealed no significant matches with any of the presently available E. coli genome sequences (none of which are from B strains). However, this analysis showed a remarkably good match (98%) with Shigella flexneri 2a strain 2457T (Fig. 4A) and the unfinished genome of Shigella sonnei. The region of match in S. flexneri lies between hypothetical genes S4812 and S0372 (Fig. 4B), about 700 bp away from cyoE. Interestingly, the genome organizations in the vicinity of cyoE for E. coli K-12 and S. flexneri are very similar (compare Fig. 4B and C), allowing us to deduce that the Kan^r transposon in the E. coli B105 (Q⁺) transductant landed in the vicinity of cyoE (9.61 min). At this juncture, a report (34) showed that the genes of the ykvJKLM operon are involved in Q biosynthesis in B. subtilis. One of the genes at the 10-min locus in the E. coli genome, queC (renamed from ybaX), showed 57% sequence identity and 75% sequence similarity to ykvJ at the amino acid level. These observations, and the linkage of 50% between the Q⁺ and Kan^r (at 9.61 min) markers in P1-mediated transductions, encouraged us to investigate a possible role of QueC in conferring the Q⁺ phenotype to E. coli B105.

View larger version (20K): [in this window] [in a new window]

FIG. 4. Mapping of transposon insertion site in E. coli BL21 (Q+) transductant. (A) Alignment of the sequence flanking the transposon (Query) with the homologous sequence found between the S4812 and S0372 genes in S. flexneri. (B) Gene map of S. flexneri in the vicinity of S4812 and S0372 (as annotated for S. flexneri 2a strain 2457T, GenBank accession no. AE014073, version AE014073.1). (C) Corresponding genome region in E. coli (as annotated for E. coli K-12 MG1655, GenBank accession no. U00096, version U00096.1).

queC complements E. coli B105 Q^– phenotype. The queC open reading frame was cloned into pTrc99C to yield the pTrcqueC expression construct and introduced into E. coli B105. As shown in Fig. 5A, the presence of pTrcqueC in E. coli B105, irrespective of induction by IPTG (isopropyl-ß-D-thiogalactopyranoside), conferred slower mobility to Tyr-tRNA^Tyr, which corresponded to the Q⁺ phenotype (Fig. 5A, compare lanes 3 and 4 with lanes 1 and 2). However, to further confirm the role of QueC, ³²P-body-labeled tRNA from E. coli strain B105 harboring either the vector (pTrc99C) or the expression construct (pTrcqueC) was enriched for tRNA^Tyr and subjected to modified base analysis (8, 28). As shown in Fig. 5B, the tRNA^Tyr from E. coli B105 containing pTrcqueC (Fig. 5B, panel ii) revealed a spot corresponding to queuosine (Qp) which was absent from the tRNA^Tyr prepared from E. coli B105 with vector control (Fig. 5B, panel i). These data demonstrate that a lack of functional QueC in E. coli B105 led to its Q^– phenotype and that queC codes for a function in the Q biosynthesis pathway in E. coli.

View larger version (52K): [in this window] [in a new window]

FIG. 5. Analysis of the effect of QueC expression in E. coli B105. (A) Northern blot analysis for Tyr-tRNATyr from E. coli B105 harboring pTrc99C vector (lanes 1 and 2) or E. coli B105 harboring pTrcqueC (lanes 3 and 4), not induced (lanes 1 and 3) or induced (lanes 2 and 4) with 0.5 mM IPTG. (B) Modified base analysis of tRNATyr enriched from E. coli B105 harboring the pTrc99C vector (i) or pTrcqueC (ii) by two-dimensional thin-layer chromatography on cellulose F. The spot corresponding to queuosine (Qp), marked by the arrow, is seen in panel ii but not in panel i.

queC gene product functions at an initial step in Q biosynthesis pathway. The penultimate step in Q biosynthesis is the conversion of preQ₁ to oQ, which is carried out by QueA (Fig. 1). To map the step at which QueC participates, we generated a knockout of queC in E. coli JE10651 (queA mutant). The tRNA from E. coli JE10651, a queA mutant strain, migrates as a diffuse band between Q⁺ and Q^– tRNAs (Fig. 6A, compare lane 3 with lanes 1 and 2). Expectedly, when the strain was provided with a plasmid-borne copy of queA, mobility of the tRNA was rescued to that of the Q⁺ form (Fig. 6A, compare lane 3 with lanes 2 and 4). On the other hand, introduction of a plasmid-borne copy of queC did not alter the mobility of the tRNA (Fig. 6A, compare lanes 3 and 5). However, deletion of the queC gene from the strain resulted in a faster mobility of the tRNA, corresponding to the Q^– form (Fig. 6A, compare lanes 3 and 6), which could not be rescued by the presence of plasmid-borne queA (Fig. 6A, compare lanes 4 and 7). As a control, plasmid-borne queC restored its mobility to that of the tRNA from E. coli JE10651 (Fig. 6A, compare lanes 3 and 8). Similar observations were made when the analysis was repeated using deacylated preparations of tRNA (Fig. 6B). Taken together, these observations clearly suggest that QueC functions upstream of QueA (Fig. 1). Since Tgt is known to be involved immediately upstream of QueA, the function of queC can be unambiguously placed at a step prior to that of Tgt in the generally accepted scheme of Q biosynthesis (Fig. 1).

View larger version (57K): [in this window] [in a new window]

FIG. 6. Analysis of the effect of deletion of queC on tRNATyr in E. coli JE1065. Total tRNA from the indicated strains was prepared under acidic conditions (A) or deacylated by treatment under alkaline conditions (B) and subjected to Northern blot analysis to probe for tRNATyr, followed by electronic autoradiography on a BioImage analyzer (FLA2000; Fuji). Details of tRNA samples are indicated above each lane.

To fine map the step of QueC function, we exploited yet another strain, E. coli JE7325, deficient in converting preQ₀ to preQ₁. Although the site of mutation responsible for this deficiency has not been characterized, its phenotype is more severe at a nonpermissive temperature of 43°C (29). As seen in Fig. 7, when E. coli JE7325 is grown at 30°C, Tyr-tRNA^Tyr bands corresponding to Q⁺ and Q^– forms are present. The faster-migrating band in the E. coli JE7325 sample most likely represents a population of tRNAs containing both G and preQ₀ at position 34 (29). Nevertheless, it is clear that the presence of pTrcqueC does not result in any increase in Q⁺ tRNA^Tyr or a change in the relative abundance of the two bands in E. coli JE7325 (Fig. 7, compare lanes 2 and 3). Expectedly, when the samples were subcultured at 43°C, the amount of tRNA in the Q⁺ form decreased. At this temperature also, the presence of queC in E. coli JE7325 did not rescue the mobility of Tyr-tRNA^Tyr (Fig. 7, compare lanes 4 and 5). These observations clearly show that introduction of the queC plasmid in E. coli JE7325 does not complement the defect in the Q biosynthesis pathway and thus makes it unlikely that queC codes for a function involved in the conversion of preQ₀ to preQ₁. In fact, a very recent report has now shown that conversion of preQ₀ to preQ₁ is carried out by QueF (YkvM in B. subtilis) (45). Taken together, these observations strongly suggest that the function of QueC is upstream of preQ₀.

View larger version (50K): [in this window] [in a new window]

FIG. 7. Analysis of the effect of QueC expression on tRNATyr in E. coli JE7325. Total tRNA was isolated from E. coli JE7325 harboring the indicated plasmids, grown at 30°C (lanes 2 and 3) or 43°C (lanes 4 and 5), and subjected to Northern blot analysis to probe for the status of tRNATyr, followed by BioImage analysis (FLA2000; Fuji). Relative ratios of Q+ and Q– forms of Tyr-tRNATyr shown as percent values were calculated from pixel values in the corresponding bands by the following equation: 100 x [Q+/(Q– + Q+)]. The dash indicates that no quantitation was carried out for the sample in lane 1 (a marker for Q+ Tyr-tRNATyr).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Queuosine is one of the most complex modifications occurring in the tRNAs. This modification influences such crucial functions as accuracy of decoding, virulence, and cellular differentiation. Furthermore, recently it was discovered that Q modification in tRNA^Asp served as an unusual site for glutamylation by YadB, a paralog of GluRS. Such significant biological properties of the Q modification have made it engaging to study its biosynthetic pathway (13, 16, 36).

In an earlier study, we observed that a naturally occurring strain of E. coli B105 lacked Q modification in the tRNAs because of a defect in an uncharacterized gene(s). In the present study, we have genetically mapped the defect in E. coli B105 to a single gene, queC (ybaX), predicted to code for a 231-amino-acid-long protein with a pI of 5.6 and a molecular mass of 25.36 kDa (http://genolist.pasteur.fr/Colibri/). This study provides the first genetic evidence for the involvement of QueC at a step upstream of preQ₀, the first known intermediate in the generally accepted pathway that utilizes GTP as the starting molecule. Our findings may appear to contradict the predictions of this step being carried out by QueF (34). However, in a very recent report, QueF has been demonstrated to convert preQ₀ to preQ₁ (45), further supporting our analysis of the involvement of QueC in the generation of preQ₀.

The distribution of queC orthologs is another important indication of the role of queC in Q biosynthesis. Archaea are known to synthesize preQ₀ but not preQ₁ (17). As expected, queC orthologs are present in archaea (Fig. 8) (34). In the case of mammals, the situation is reversed: mammals obtain the free base queuine and insert it into tRNA. This obviates a requirement for the queC ortholog, and in fact the queC ortholog is not seen in a BLAST search with the mammalian genomes at the NCBI server. Only seven sequences relating to argininosuccinate or asparagine synthetases come up in such an analysis. Some classes of bacteria, viz., actinobacteria (Mycobacterium spp. and Streptomyces spp.) and mollicutes (Mycoplasma spp. and Ureaplasma spp.), also do not seem to possess a QueC-like sequence, and their genomes present argininosuccinate synthases as the best matches to QueC.

View larger version (53K): [in this window] [in a new window]

FIG. 8. Sequence alignment of QueC orthologs from archaeal and eubacterial species. Simel, Sinorhizobium meliloti; Memar, Methanococcus maripaludis; Feaci, Ferroplasma acidiphilum; Thvol, Thermoplasma volcanium; Anvar, Anabaena varibilis; Hamar, Haloarcula marismortui; Negon, Neisseria gonorrhoeae FA 1090; Basub, B. subtilis; Eco, E. coli; Buaph, Buchnera aphidicola strain Sg; Hepyl, Helicobacter pylori. The alignments were done with ClustalW, and the most-conserved residues were manually shaded.

An alignment of several QueC orthologs (Fig. 8) from diverse species of archaea and eubacteria reveals the conserved motifs of this protein. The N terminus contains the SGGXDS motif that matches the SXGXDS signature motif of PP-loop ATPases (1). In addition, the comparison reveals the presence of four conserved cysteines in QueC towards the C terminus. Similar motifs have been found in the iron-sulfur cluster-containing and zinc-containing proteins involved in tRNA modifications (17, 22). The way in which these predicted biochemical properties may be related to a role for QueC at the initial step in the accepted Q biosynthetic pathway, wherein queuosine is believed to arise from GTP (reviewed in reference 17), remains to be investigated. The formation of preQ₀ was found to be similar to the biosynthesis of toyocamycin (21), and a GTP cyclohydrolase-like enzyme was proposed to catalyze this step. However, later studies ruled out the involvement of GTP cyclohydrolases I and II in this reaction (39). Considering that complex chemical transformations are needed for the conversion of GTP to preQ₀, such a role for QueC may well necessitate its functional interaction with other cellular proteins. Notably, QueD (ykvK, ygcM), QueE (ykvL, ygcF), and QueF (ykvM, yqcD) have also been suggested to function upstream of Tgt (13, 34). With the recent biochemical characterization that QueF carries out preQ₀-to-preQ₁ conversion (45), it is quite likely that QueD and QueE collaborate with QueC in the production of preQ₀, which may well be a multistep reaction. On the other hand, according to a recent large-scale protein-protein interaction study (6), QueC has been shown to interact with components of translation machinery (rpsJ, tufA), putative enzymes (aidB, yfiD), a transporter (yegT), and a chaperone (dnaK). However, the implications of these interactions for Q biosynthesis are not clear. Furthermore, although toyocamycin production has been studied for Streptomyces rimosus (43), its close relatives Streptomyces avermitilis MA4680 and Streptomyces coelicolor A3 (and actinobacteria in general) do not reveal a QueC ortholog in a protein-protein BLAST, which casts doubt on the proposal of similarity between toyocamycin and queuosine biosynthesis at this step.

Interestingly, with the characterization of the genetic defect in E. coli B105, we now have each of the steps in Q biosynthesis identified by a well-defined mutation in E. coli (Fig. 1). These strains, and the genetic screen developed in this study, could prove to be crucial in the biochemical characterization of the various proteins involved in this important pathway. Especially, the identification of the genetic defect in E. coli B105 at the initial step(s) in Q biosynthesis will be instrumental in detailed biochemical analysis of the reaction mediated by the queC gene product.

 
We thank our laboratory colleagues and the anonymous reviewers for their suggestions and Akiko Nishimura, National Institute of Genetics, Mishima, Shizuoka-ken, 411-8540, Japan, for providing us with various JE series strains.

This work was supported by grants from the Department of Science and Technology, Department of Biotechnology, and Indian Council of Medical Research, New Delhi, India. R.G. is a senior research fellow of the Council of Scientific and Industrial Research, New Delhi, India.

 
* Corresponding author. Mailing address: Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India. Phone: 91-80-2293 2686. Fax: 91-80-2360 2697. E-mail: varshney{at}mcbl.iisc.ernet.in.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Aravind, L., V. Anantharaman, and E. V. Koonin. 2002. Monophyly of class I aminoacyl tRNA synthetase, USPA, ETFP, photolyase, and PP-ATPase nucleotide-binding domains: implications for protein evolution in the RNA. Proteins 48:1-14.[CrossRef][Medline]
2
2. Baranowski, W., G. Dirheimer, J. A. Jakowicki, and G. Keith. 1994. Deficiency of queuine, a highly modified purine base, in transfer RNAs from primary and metastatic ovarian malignant tumors in women. Cancer Res. 54:4468-4471.[Abstract/Free Full Text]
3
3. Bienz, M., and E. Kubli. 1981. Wild type tRNA^Tyr reads the TMV RNA stop codon, but Q base-modified tRNA^Tyr does not. Nature 294:188-190.[CrossRef]
4
4. Björk, G. R. 1995. Biosynthesis and function of modified nucleosides, p. 165-205. In D. Söll and U. L. RajBhandary (ed.), tRNA: structure, biosynthesis and function. ASM Press, Washington, D.C.
5
5. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472.[CrossRef][Medline]
6
6. Butland, G., J. M. Peregrin-Alvarez, J. Li, W. Yang, X. Yang, V. Canadien, A. Starostine, D. Richards, B. Beattie, N. Krogan, M. Davey, J. Parkinson, J. Greenblatt, and A. Emili. 2005. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433:531-537.[CrossRef][Medline]
7
7. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
8
8. Dineshkumar, T. K., S. Thanedar, C. Subbulakshmi, and U. Varshney. 2002. An unexpected absence of queuosine modification in the tRNAs of an Escherichia coli B strain. Microbiology 148:3779-3787.[Abstract/Free Full Text]
9
9. Durand, J. M., B. Dagberg, B. E. Uhlin, and G. R. Björk. 2000. Transfer RNA modification, temperature and DNA superhelicity have a common target in the regulatory network of the virulence of Shigella flexneri: the expression of the virF gene. Mol. Microbiol. 35:924-935.[CrossRef][Medline]
10
10. Emmerich, B., E. Zubrod, H. Weber, P. A. Maubach, H. Kersten, and W. Kersten. 1985. Relationship of queuine-lacking transfer RNA to the grade of malignancy in human leukemias and lymphomas. Cancer Res. 45:4308-4314.[Abstract/Free Full Text]
11
11. Frey, B., J. McCloskey, W. Kersten, and H. Kersten. 1988. New function of vitamin B₁₂: cobamide-dependent reduction of epoxyqueuosine to queuosine in tRNAs of Escherichia coli and Salmonella typhimurium. J. Bacteriol. 170:2078-2082.[Abstract/Free Full Text]
12
12. Gregson, J. M., P. F. Crain, C. G. Edmonds, R. Gupta, T. Hashizume, D. W. Phillipson, and J. A. McCloskey. 1993. Structure of the archaeal transfer RNA nucleoside G*-15 (2-amino-4,7-dihydro-4-oxo-7-ß-D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximidamide (archaeosine)). J. Biol. Chem. 268:10076-10086.[Abstract/Free Full Text]
13
13. Grosjean, H., V. de Crecy-Lagard, and G. R. Bjork. 2004. Aminoacylation of the anticodon stem by a tRNA-synthetase paralog: relic of an ancient code? Trends Biochem. Sci. 29:519-522.[CrossRef][Medline]
14
14. Harada, F., and S. Nishimura. 1972. Possible anticodon sequences of tRNA^His, tRNA^Asn and tRNA^Asp from Escherichia coli B. Universal presence of nucleoside Q in the first position of the anticodons of these transfer ribonucleic acids. Biochemistry 11:301-308.[CrossRef][Medline]
15
15. Higashitani, A., N. Higashitani, S. Yasuda, and K. Horiuchi. 1994. A general and fast method for mapping mutations on the Escherichia coli chromosome. Nucleic Acids Res. 22:2426-2427.[Free Full Text]
16
16. Ibba, M., and C. Francklyn. 2004. Turning tRNA upside down: when aminoacylation is not a prerequisite to protein synthesis. Proc. Natl. Acad. Sci. USA 101:7493-7494.[Free Full Text]
17
17. Iwata-Reuyl, D. 2003. Biosynthesis of the 7-deazaguanosine hypermodified nucleosides of transfer RNA. Bioorg. Chem. 31:24-43.[CrossRef][Medline]
18
18. Kasai, H., Z. Oashi, F. Harada, S. Nishimura, and N. J. Oppenheimer. 1975. Structure of the modified nucleoside Q isolated from Escherichia coli transfer ribonucleic acid. 7-(4,5-cis-Dihydroxy-1-cyclopenten-3-ylaminomethyl)-7-deazaguanosine. Biochemistry 14:4198-4208.[CrossRef][Medline]
19
19. Kersten, H. 1984. On the biological significance of modified nucleosides in tRNA. Prog. Nucleic Acid Res. Mol. Biol. 31:59-114.[Medline]
20
20. Kleckner, N., J. Bender, and S. Gottesman. 1991. Uses of transposons with emphasis on Tn10. Methods Enzymol. 204:139-180.[Medline]
21
21. Kuchino, Y., H. Kasai, K. Nihei, and S. Nishimura. 1976. Biosynthesis of the modified nucleoside Q in transfer RNA. Nucleic Acids Res. 3:393-398.
22
22. Lee, T. T., S. Agarwalla, and R. M. Stroud. 2004. Crystal structure of RumA, an iron-sulfur cluster containing E. coli ribosomal RNA 5-methyluridine methyltransferase. Structure 12:397-407.[Medline]
23
23. Lin, V. K., W. R. Farkas, and P. F. Agris. 1980. Specific changes in Q-ribonucleoside containing transfer RNA species during Friend leukemia cell erythroid differentiation. Nucleic Acids Res. 8:3481-3489.[Abstract/Free Full Text]
24
24. Mandal, N., and U. L. RajBhandary. 1992. Escherichia coli B lacks one of the two initiator tRNA species present in E. coli K-12. J. Bacteriol. 174:7827-7830.[Abstract/Free Full Text]
25
25. Meier, F., B. Suter, H. Grosjean, G. Keith, and E. Kubli. 1985. Queuosine modification of the wobble base in tRNA^His influences ‘in vivo ’ decoding properties. EMBO J. 4:823-827.[Medline]
26
26. Miller, J. H. 1972. Experiments in molecular genetics, p. 201-205. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
27
27. Morgan, C. J., F. L. Merrill, and R. W. Trewyn. 1996. Defective transfer RNA-queuine modification in C3H10T1/2 murine fibroblasts transfected with oncogenic ras. Cancer Res. 56:594-598.[Abstract/Free Full Text]
28
28. Noguchi, S., Y. Nishimura, Y. Hirota, and S. Nishimura. 1982. Isolation and characterization of an Escherichia coli mutant lacking tRNA-guanine transglycosylase. Function and biosynthesis of queuosine in tRNA. J. Biol. Chem. 257:6544-6550.[Abstract/Free Full Text]
29
29. Noguchi, S., Z. Yamaizumi, T. Ohgi, T. Goto, Y. Nishimura, Y. Hirota, and S. Nishimura. 1978. Isolation of Q nucleoside precursor present in tRNA of an E. coli mutant and its characterization as 7-(cyano)-7-deazaguanosine. Nucleic Acids Res. 5:4215-4223.[Abstract/Free Full Text]
30
30. Okada, N., S. Noguchi, H. Kasai, N. Shindo-Okada, T. Ohgi, T. Goto, and S. Nishimura. 1979. Novel mechanism of post-transcriptional modification of tRNA. Insertion of bases of Q precursors into tRNA by a specific tRNA transglycosylase reaction. J. Biol. Chem. 254:3067-3073.[Abstract/Free Full Text]
31
31. Okada, N., S. Noguchi, S. Nishimura, T. Ohgi, T. Goto, P. F. Crain, and J. A. McCloskey. 1978. Structure determination of a nucleoside Q precursor isolated from E. coli tRNA: 7-(aminomethyl)-7-deazaguanosine. Nucleic Acids Res. 5:2289-2296.[Abstract/Free Full Text]
32
32. Phillipson, D. W., C. G. Edmonds, P. F. Crain, D. L. Smith, D. R. Davis, and J. A. McCloskey. 1987. Isolation and structure elucidation of an epoxide derivative of the hypermodified nucleoside queuosine from Escherichia coli transfer RNA. J. Biol. Chem. 262:3462-3471.[Abstract/Free Full Text]
33
33. Randerath, E., H. P. Agrawal, and K. Randerath. 1984. Specific lack of the hypermodified nucleoside, queuosine, in hepatoma mitochondrial aspartate transfer RNA and its possible biological significance. Cancer Res. 44:1167-1171.[Abstract/Free Full Text]
34
34. Reader, J. S., D. Metzgar, P. Schimmel, and V. de Crecy-Lagard. 2004. Identification of four genes necessary for biosynthesis of the modified nucleoside queuosine. J. Biol. Chem. 279:6280-6285.[Abstract/Free Full Text]
35
35. Reuter, K., R. Slany, F. Ullrich, and H. Kersten. 1991. Structure and organization of Escherichia coli genes involved in biosynthesis of the deazaguanine derivative queuine, a nutrient factor for eukaryotes. J. Bacteriol. 173:2256-2264.[Abstract/Free Full Text]
36
36. Salazar, J. C., A. Ambrogelly, P. F. Crain, J. A. McCloskey, and D. Soll. 2004. A truncated aminoacyl-tRNA synthetase modifies RNA. Proc. Natl. Acad. Sci. USA 101:7536-7541.[Abstract/Free Full Text]
37
37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
38
38. Seong, B. L., and U. L. RajBhandary. 1987. Escherichia coli formylmethionine tRNA: mutations in GGGCCC sequence conserved in anticodon stem of initiator tRNAs affect initiation of protein synthesis and conformation of anticodon loop. Proc. Natl. Acad. Sci. USA 84:334-338.[Abstract/Free Full Text]
39
39. Slany, R. K., and H. Kersten. 1994. Genes, enzymes and coenzymes of queuosine biosynthesis in procaryotes. Biochimie 76:1178-1182.[Medline]
40
40. Slany, R. K., M. Bosl, P. F. Crain, and H. Kersten. 1993. A new function of S-adenosylmethionine: the ribosyl moiety of AdoMet is the precursor of the cyclopentenediol moiety of the tRNA wobble base queuine. Biochemistry 32:7811-7817.[CrossRef][Medline]
41
41. Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130.[CrossRef][Medline]
42
42. Thanedar, S., T. K. Dineshkumar, and U. Varshney. 2001. The mere lack of rT modification in initiator tRNA does not facilitate formylation-independent initiation in Escherichia coli. J. Bacteriol. 183:7397-7402.[Abstract/Free Full Text]
43
43. Uematsu, T., and R. J. Suhadolnik. 1970. Nucleoside antibiotics. VI. Biosynthesis of the pyrrolopyrimidine nucleoside antibiotic toyocamycin by Streptomyces rimosus. Biochemistry 9:1260-1266.[CrossRef][Medline]
44
44. Urbonavicius, J., Q. Qian, J. M. Durand, T. G. Hagervall, and G. R. Bjork. 2001. Improvement of reading frame maintenance is a common function for several tRNA modifications. EMBO J. 20:4863-4873.[CrossRef][Medline]
45
45. Van Lanen, S. G., J. S. Reader, M. A. Swairjo, V. de Crecy-Lagard, B. Lee, and D. Iwata-Reuyl. 2005. From cyclohydrolase to oxidoreductase: discovery of nitrile reductase activity in a common fold. Proc. Natl. Acad. Sci. USA 102:4264-4269.[Abstract/Free Full Text]
46
46. Varshney, U., C. P. Lee, and U. L. RajBhandary. 1991. Direct analysis of aminoacylation levels of tRNAs in vivo. Application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase. J. Biol. Chem. 266:24712-24718.[Abstract/Free Full Text]
47
47. Yokoyama, S., and S. Nishimura. 1995. Modified nucleosides and codon recognition, p. 207-223. In D. Söll and U. L. RajBhandary (ed.), tRNA: structure, biosynthesis and function. ASM Press, Washington, D.C.

---

Journal of Bacteriology, October 2005, p. 6893-6901, Vol. 187, No. 20
0021-9193/05/$08.00+0     doi:10.1128/JB.187.20.6893-6901.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Phillips, G., El Yacoubi, B., Lyons, B., Alvarez, S., Iwata-Reuyl, D., de Crecy-Lagard, V. (2008). Biosynthesis of 7-Deazaguanosine-Modified tRNA Nucleosides: a New Role for GTP Cyclohydrolase I. J. Bacteriol. 190: 7876-7884 [Abstract] [Full Text]  
• Liu, Y., Dong, Y., Chen, Y.-Y. M., Burne, R. A. (2008). Environmental and Growth Phase Regulation of the Streptococcus gordonii Arginine Deiminase Genes. Appl. Environ. Microbiol. 74: 5023-5030 [Abstract] [Full Text]  
• Meyer, M. M., Roth, A., Chervin, S. M., Garcia, G. A., Breaker, R. R. (2008). Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria. RNA 14: 685-695 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gaur, R. Articles by Varshney, U. Search for Related Content PubMed PubMed Citation Articles by Gaur, R. Articles by Varshney, U.