JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braun, T. F.
Right arrow Articles by McBride, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braun, T. F.
Right arrow Articles by McBride, M. J.
Journal of Bacteriology, October 2005, p. 6943-6952, Vol. 187, No. 20
0021-9193/05/$08.00+0     doi:10.1128/JB.187.20.6943-6952.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Flavobacterium johnsoniae Gliding Motility Genes Identified by mariner Mutagenesis

Timothy F. Braun, Manjeet K. Khubbar, Daad A. Saffarini, and Mark J. McBride*

Department of Biological Sciences, University of Wisconsin—Milwaukee, P.O. Box 413, Milwaukee, Wisconsin 53201

Received 2 June 2005/ Accepted 27 July 2005


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells of Flavobacterium johnsoniae glide rapidly over surfaces. The mechanism of F. johnsoniae gliding motility is not known. Eight gld genes required for gliding motility have been described. Disruption of any of these genes results in complete loss of gliding motility, deficiency in chitin utilization, and resistance to bacteriophages that infect wild-type cells. Two modified mariner transposons, HimarEm1 and HimarEm2, were constructed to allow the identification of additional motility genes. HimarEm1 and HimarEm2 each transposed in F. johnsoniae, and nonmotile mutants were identified and analyzed. Four novel motility genes, gldK, gldL, gldM, and gldN, were identified. GldK is similar in sequence to the lipoprotein GldJ, which is required for gliding. GldL, GldM, and GldN are not similar in sequence to proteins of known function. Cells with mutations in gldK, gldL, gldM, and gldN were defective in motility and chitin utilization and were resistant to bacteriophages that infect wild-type cells. Introduction of gldA, gldB, gldD, gldFG, gldH, gldI, and gldJ and the region spanning gldK, gldL, gldM, and gldN individually into 50 spontaneous and chemically induced nonmotile mutants restored motility to each of them, suggesting that few additional F. johnsoniae gld genes remain to be identified.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Cells of Flavobacterium johnsoniae move rapidly over surfaces in a process called gliding motility. Gliding motility is common in the phylum Bacteroidetes (also known as the Cytophaga-Flavobacterium-Bacteroides group), of which F. johnsoniae is a member. Cells of F. johnsoniae move at speeds of up to 10 µm/s, and colonies have thin spreading edges. Cells of F. johnsoniae also adsorb latex spheres and propel these rapidly around the cell in multiple paths. Several models have been proposed to explain gliding motility of F. johnsoniae and related bacteria, but the mechanism of cell movement remains unknown (22, 25, 26).

Development of genetic techniques for F. johnsoniae led to the identification of genes required for motility (29). gldA, gldF, and gldG are thought to encode components of an ATP-binding cassette (ABC) transporter that is required for motility (1, 15). Genes encoding lipoproteins that are required for gliding (GldB, GldD, GldH, GldI, and GldJ) have also been identified (5, 16, 17, 27, 28). Cells with mutations in any of these genes are completely nonmotile. They do not exhibit movement on agar or glass surfaces, fail to propel latex spheres, and form nonspreading colonies. These mutants are deficient in utilization of the insoluble polysaccharide chitin and are resistant to infection by bacteriophages that infect wild-type cells. Some of the Gld proteins are thought to function as transporters, and it has been suggested that gliding motility, chitin utilization, and sensitivity to bacteriophages may each rely on these transporters. The lipoprotein GldJ forms helical bands in the cell envelope, but the organization of the other Gld proteins is not known (5).

Tn4351 mutagenesis was used to identify many of the gld genes described above. A drawback of Tn4351 mutagenesis is that it is not completely random. Nineteen of 37 independent Tn4351-induced nonmotile mutants carried insertions in gldB (reference 17 and unpublished data). Multiple insertions were also obtained in gldA (five insertions), gldD (three insertions), gldF (two insertions), gldG (four insertions), and gldH (four insertions), but insertions in gldI and gldJ were not isolated (references 1, 15, 16, and 28 and unpublished data). gldI and gldJ were identified by cosmid complementation of nonmotile point mutants (5, 27). Complementation analyses using a bank of 50 spontaneous and chemically induced nonmotile mutants suggested that several additional gld genes remained to be identified. Introduction of gldA, gldB, gldD, gldFG, gldH, gldI, and gldJ individually into the 50 mutants restored motility to 33 of them (5). Repeated attempts to identify additional gld genes by cosmid complementation of the remaining 17 mutants were not successful. The nonrandomness of Tn4351 insertion and the difficulties associated with cosmid complementation of some nonmotile mutants suggested that additional tools were needed to identify the remaining gld genes. This paper describes the development of mariner-based transposons, HimarEm1 and HimarEm2, that function in F. johnsoniae and the use of these transposons to identify four additional motility genes.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Bacterial strains and bacteriophages, plasmids, and growth conditions. F. johnsoniae strains UW101, MM101, and FJ1, which are each direct descendants of the F. johnsoniae type strain ATCC 17061 but have diverged slightly through handling in the laboratory, were the wild-type strains used in this study. MM101 differs from UW101 and FJ1 in that it has a partial defect in chitin utilization (27). F. johnsoniae strains MM101 and FJ1 were used for HimarEm mutagenesis. Mutants derived from MM101 were named "CJ" followed by a number, and mutants derived from FJ1 were given the designation "FJ" followed by a number. HimarEm insertions in MM101 were referred to as "HMM" followed by the mutant strain number, and insertions in FJ1 were designated "HFJ" followed by the mutant strain number. The 50 spontaneous and chemically induced motile-nonspreading mutants of F. johnsoniae UW101 were previously described (7, 17, 52) and were designated "UW102-" followed by a number. The bacteriophages active against F. johnsoniae that were used in this study were {phi}Cj1, {phi}Cj13, {phi}Cj23, {phi}Cj28, {phi}Cj29, {phi}Cj42, {phi}Cj48, and {phi}Cj54 (7, 35, 52). The Escherichia coli strains used were EC100D pir+ (Epicenter), Top10 (Invitrogen), S17-1 (42), and S17-1 {lambda} pir (48). E. coli strains were grown in Luria-Bertani medium at 37°C, and F. johnsoniae strains were grown in Casitone-yeast extract (CYE) medium at 30°C, as previously described (29). Growth rates were determined by monitoring optical density at 600 nm of duplicate cultures. To observe colony spreading, F. johnsoniae was grown on PY2 agar medium (1) at 25°C. Chitin utilization was detected as previously described except that strains derived from F. johnsoniae FJ1 were incubated for 3 days whereas strains derived from F. johnsoniae MM101 were incubated for 12 days because of the partial deficiency in chitin utilization (27, 28). Antibiotics were used at the indicated concentrations when needed: ampicillin, 100 µg/ml; cefoxitin, 100 µg/ml; chloramphenicol, 30 µg/ml; erythromycin, 100 µg/ml; kanamycin, 30 µg/ml; tetracycline, 20 µg/ml. Plasmids and primers used in this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Plasmids and primers used in this studya

 
Construction of pHimarEm1 and pHimarEm2. The 2.4-kbp EcoRI-EcoNI fragment of pLYL03 spanning the ermF gene was made blunt using end conversion mix (Novagen) and inserted into the SalI site of pMiniHimarRB1, which had also been treated with end conversion mix. The resulting plasmids, pHimarEm1 and pHimarEm2, are identical except that they have the ermF gene inserted in opposite orientations (Fig. 1).



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 1. Map of pHimarEm1. pHimarEm2 is identical to pHimarEm1 except that ermF is inserted in the opposite orientation.

 
HimarEm mutagenesis of F. johnsoniae and identification of sites of insertion. pHimarEm1 and pHimarEm2 were introduced into wild-type F. johnsoniae by conjugation from E. coli S17-1 {lambda} pir essentially as previously described (17). HimarEm mutants were selected by plating cells on PY2 agar containing erythromycin. Mutants that formed nonspreading colonies and were defective in gliding motility as determined by microscopic analysis (28) were chosen for further study. Chromosomal DNA was isolated from mutants and digested with XbaI or NsiI. The resulting fragments were diluted and ligated to form closed circles and introduced into E. coli EC100D pir+ by electroporation. Cells were plated on LB medium containing kanamycin to select clones carrying HimarEm1 or HimarEm2 and adjacent chromosomal DNA. Plasmids were sequenced using primer 609 and primer 615, which hybridize near inverted repeats 1 and 2, respectively. Nucleic acid sequencing was performed by the University of Chicago Cancer Research Center DNA Sequencing Facility. Sequences were analyzed with MacVector and AssemblyLign software (Accelrys, San Diego, CA), and comparisons to database sequences were made using the BLAST (2) and FASTA (36) algorithms. Predictions regarding cellular localization were made using PSORT (32) and TMpredict (14), and potential coiled-coil structures were identified using COILS (24) and Multicoil (49).

Cloning of the region spanning gldK through gldO. The region of DNA spanning gldK through gldO was assembled from two plasmids, pMM306 and pMU5, which carry HimarEm2 insertions HMM1300 and HMM1304, respectively (Fig. 2 and Table 1). The 3.0-kbp EcoRV-EcoRI fragment of pMU5 spanning gldK and gldL was inserted into pAED4, which had been digested with EcoRV and EcoRI, to create pTB46. The 3.8-kbp EcoRI fragment of pMM306 spanning gldM, gldN, and gldO was inserted into the EcoRI site of pTB46 to generate pTB74. To facilitate transfer of the region spanning gldK through gldO into the shuttle vector pCP29, the 2.1-kbp BamHI fragment of pHP45{Omega}kan, which confers resistance to kanamycin, was inserted into the BamHI site within the polycloning region of pTB74 to generate pTB84. The 9.0-kb SalI fragment of pTB84 which includes the kanamycin resistance cassette and spans gldK, gldL, gldM, gldN, and gldO was inserted into the SalI site of the shuttle vector pCP29 to generate pTB90 (Fig. 2 and Table 1). pTB98, (which carries gldL, gldM, gldN, and gldO) was constructed by deleting the 798-bp NsiI fragment from pTB90, resulting in an in-frame deletion within gldK.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 2. Map of the gldKLMNO region of F. johnsoniae. Restriction sites are indicated as follows: E, EcoRI; N, NsiI; V, EcoRV; X, XbaI. Numbers below the map refer to kilobase pairs of sequence. Fragments of DNA present in plasmids are indicated beneath the map. The sites of HimarEm insertions are indicated by inverted triangles.

 
For complementation analyses, a series of plasmids were constructed that carried portions of the gldK through gldO region (Fig. 2 and Table 1). The following restriction fragments were used: the 3.0-kbp EcoRV-EcoRI fragment spanning gldK and gldL (pTB88), the 1.3-kbp PstI fragment spanning gldL (pTB81a), the 2.7-kbp HindIII fragment spanning gldM and the first 781 bp of gldN (pTB94a), the 1.8-kbp PstI fragment spanning gldN (pTB79), and the 3.7-kbp XbaI fragment of pTB90 spanning gldO and the kanamycin resistance cassette (pTB97a). To generate pTB99, which carries just gldK, an 1,868-bp fragment was amplified using primers 685 and 696 and ligated into the SmaI site of pCP23. Plasmids were introduced into the F. johnsoniae mutants by conjugation or electroporation as previously described (17, 29).

RNA analysis. Probes for Northern blot analyses were made using the DIG RNA labeling kit (Roche Diagnostics Corp.). Internal fragments of gldK, gldL, gldM, and gldN were amplified using the primer pairs 690/617, 616/691, 692/693, and 694/695, respectively. Products were gel purified and ligated into pBCSK+. The ligation products were used as templates in a second amplification using the T7 primer and primers 690, 616, 692, and 694 for the gldK, gldL, gldM, and gldN products, respectively. The products were used for in vitro transcription to produce digoxigenin-labeled probes. Total RNA for Northern blots was isolated from overnight cultures of F. johnsoniae using RNeasy and RNA Protect bacterial reagent (QIAGEN). Northern blotting was performed essentially as described previously (40).

RNA for identification of the gldK and gldL transcription start sites was isolated from overnight cultures of F. johnsoniae using RiboPure-Bacteria (Ambion). The transcription start sites were identified by 5' rapid amplification of cDNA ends (RACE) using the BD SMART RACE cDNA amplification kit (BD Biosciences). The gldK specific nested primers 611, 617, and 699 were used to amplify and sequence the 5' end of the gldK transcript region, and the nested primers 693, 682, and 691, which hybridize within gldM and gldL, were used to amplify and sequence the 5' end of the gldLMN transcript region.

Western blot analysis. F. johnsoniae cells were grown to late log phase, pelleted, and suspended in 100 µl 10 mM Tris, pH 7.5. Two microliters was used to determine protein concentration with the bicinchoninic acid reagent (Pierce). Ninety-eight microliters of 2x sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer was added to the remainder, and samples were boiled for 3 min and sonicated briefly. Proteins (2 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Western blot analyses were performed as previously described (17), except that Opti-4CN (Bio-Rad) was used for detection.

Measurements of bacteriophage sensitivity. Sensitivity to F. johnsoniae bacteriophages was determined essentially as previously described by spotting 3 µl of phage lysates (109 PFU/ml) onto lawns of cells in CYE overlay agar (17). The plates were incubated for 24 h at 25°C to observe lysis.

Nucleotide sequence accession number. The sequence reported in this paper has been deposited in the GenBank database (accession no. AY882986).


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
HimarEm mutagenesis and identification of gldK, gldL, gldM, and gldN. pHimarEm1 and pHimarEm2 were constructed to facilitate identification of novel F. johnsoniae motility genes. F. johnsoniae was mutagenized with HimarEm1 and HimarEm2, and 140 mutants that formed nonspreading colonies were isolated. Twenty of the mutants were completely deficient in gliding motility as determined by microscopic analysis of individual cells in wet mounts. Five of these exhibited filamentous morphology and were not considered further in this study. The sites of insertion in the remaining 15 nonmotile mutants were identified by cloning HimarEm and adjacent F. johnsoniae chromosomal DNA as plasmids in E. coli and determining the DNA sequences. FJ109 had an insertion in gldI, and FJ123 and FJ129 had insertions in gldJ. gldI and gldJ have previously been described (5, 27). Eleven insertions mapped to a 5-kb region of DNA spanning four genes which we designated gldK, gldL, gldM, and gldN (Fig. 2). Cells with insertions in any of these genes formed nonspreading colonies (Fig. 3F, I, K, and M). Cells of the gldK mutants (CJ1309, CJ1361, CJ1372, CJ1373, FJ131, and FJ150), gldL mutants (CJ1253 and CJ1300), and gldM mutant (FJ113) were completely deficient in gliding motility. Unlike wild-type cells, the mutant cells failed to move in wet mounts and failed to propel polystyrene latex spheres over their surfaces. Cells of the gldN mutants (CJ1304 and CJ1382) were almost completely nonmotile, but a small percentage of cells (less than 1%) exhibited slight movements when examined in wet mounts.



View larger version (96K):
[in this window]
[in a new window]
  		FIG. 3. Photomicrographs of F. johnsoniae colonies. Colonies were incubated at 25°C on PY2 agar medium for 30 h except for those in panels C and D, which were incubated for 40 h, and those in panel I, which were incubated for 32 h. Photomicrographs were taken with a Kodak DC290 digital camera mounted on an Olympus IMT-2 inverted microscope. Bar, 1 mm. (A) Wild-type F. johnsoniae FJ1. (B) Wild-type F. johnsoniae MM101 with shuttle vector pCP29. (C) Wild-type F. johnsoniae MM101 with pTB90 which carries gldK, gldL, gldM, gldN, and gldO. (D) Wild-type F. johnsoniae MM101 with pTB88 which carries gldK and gldL. (E) Wild-type F. johnsoniae MM101 with pTB98 which carries gldL, gldM, gldN, and gldO. (F) gldK mutant CJ1372 with pCP29. (G) CJ1372 complemented with pTB90. (H) CJ1372 with pTB98. (I) gldL mutant CJ1300 with pCP29. (J) CJ1300 complemented with pTB98. (K) gldM mutant FJ113. (L) FJ113 complemented with pTB98. (M) gldN mutant CJ1304. (N) CJ1304 complemented with pTB98.

 
Analysis of the gld genes and proteins. The gldK coding region is 1,395 nucleotides in length. A sequence that matches a Bacteroides consensus promoter region (TAXXTTTG) (3) ends 97 bp upstream of the gldK start codon. The amino-terminal sequence of GldK (MKKFIAFAAMLTLVIGCGKSGDKGE) contains a hydrophobic stretch terminated by a cysteine (underlined), which is characteristic of lipoproteins. GldK is similar to a protein of unknown function from the distantly related gliding bacterium Cytophaga hutchinsonii (GenBank accession no. ZP00309779). The C. hutchinsonii protein is 120 amino acids shorter than F. johnsoniae GldK but exhibits 50.1% identity with GldK over 305 amino acids if a large gap is allowed. F. johnsoniae GldK displays more limited similarity to proteins that exhibit sequence similarity to the domain of unknown function DUF323. These include F. johnsoniae GldJ (30% identity with GldK over 382 amino acids), human SUMF1 (31% identity over 195 amino acids), Geobacillus stearothermophilus XaiF (33% identity over 152 amino acids), and Pectobacterium carotovorum CarF (39% amino acid identity over 84 amino acids). GldJ is required for gliding motility (5); SUMF1 is an enzyme that activates sulfatases by converting a cysteine residue into the active-site formylglycine (9, 10); XaiF is involved in the production, export, or activation of extracellular xylanase (8); and CarF is involved in resistance to the ß-lactam antibiotic carbapenem (30). Given the diverse functions of these proteins, the exact function of GldK remains uncertain.

gldL, gldM, and gldN lie downstream of gldK. The predicted untranslated regions between gldK and gldL, gldL and gldM, and gldM and gldN are 84, 54, and 47 nucleotides, respectively. An inverted repeat (AAAAAACTCTTACTACCTTTGTAGTAAGAGTTTTTT) that may function as a transcription terminator begins 22 bp downstream of the gldN stop codon. GldL, GldM, and GldN do not exhibit significant amino acid sequence similarity to proteins of known functions. Amino acid sequence analyses suggest that GldM and GldN are likely to be periplasmic proteins. TMpredict analysis suggests that GldL has two membrane-spanning helices near its amino terminus and a domain of about 150 amino acids that may reside in the periplasm. The carboxy-terminal 60 amino acids are predicted to form an {alpha}-helical coiled-coil structure, which may indicate that this region is involved in multimerization or interaction with other proteins.

The gldO start codon begins 144 nucleotides after the putative gldN transcription terminator. Two potential promoter sequences (TACCTTTG and TAATTTTG) begin 166 and 76 bp upstream of the start codon, respectively. A potential transcription terminator (AAAAAACTCTTGCTACCTTTGCAGTAAGAGTTTTTT) lies 22 nucleotides downstream of the gldO stop codon. GldO exhibits 85% identity over 329 amino acids with GldN. gldO mutants have not been isolated, and it is not known whether gldO is required for motility. fjo30 (which encodes a protein of unknown function) lies downstream of gldO, and fjo29 (which encodes a putative arginase family protein) lies upstream of gldK. There is no evidence that these genes are involved in gliding.

The sequence analyses described above suggest that several of the gld genes may constitute an operon. Northern blot analyses were performed to determine the nature of the predominant transcripts in this region. Internal probes for gldL, gldM, and gldN each hybridized to a transcript of 3.4 kb, suggesting that these genes are cotranscribed (Fig. 4). We were unable to detect a gldK transcript by Northern blot analysis. gldK may have been expressed at a low level under the conditions employed in these experiments. The gldK transcript was detected by 5'-RACE analysis with a start site at the "G" 92 bases upstream of the gldK start codon. The transcription start site of the gldLMN operon was also identified by 5'-RACE analysis at the "U" 70 bases upstream of the gldL start codon.



View larger version (80K):
[in this window]
[in a new window]
  		FIG. 4. Northern blot analysis. Wild-type RNA was separated on an agarose gel, transferred to a nylon membrane, and probed with digoxigenin-labeled RNA internal to gldK (lane 1), gldL (lane 2), gldM (lane 3), or gldN (lane 4). Numbers correspond to the sizes in kilobases of RNA molecular size markers.

 
gldK, gldL, gldM, and gldN are each required for efficient motility. Complementation analyses revealed that gldK, gldL, gldM, and gldN were each required for efficient motility. Introduction of pTB90, which spans the entire region, resulted in complementation of mutations in each gene. Individual cells glided in wet mounts and propelled latex spheres over their surfaces. The complemented strains also formed spreading colonies on agar, but colonies did not spread as well as those formed by wild-type cells (Fig. 3B and G). Introduction of pTB98, which spans the same region but has an in-frame deletion in gldK, restored motility to the gldL, gldM, and gldN mutants (Fig. 3J, L, and N) but failed to restore motility to the gldK mutants CJ1309 and CJ1372 (Fig. 3H and data not shown). pTB81a, which carries just gldL, failed to complement any of the HimarEm mutants (data not shown). Lack of complementation of the gldL mutants by pTB81a suggests that the insertions in gldL exhibit polar effects on downstream genes as expected from the results of the Northern blot analyses. Plasmid pTB94a, which carries gldM and most of gldN, partially restored motility to the gldM mutant FJ113, and to the gldN mutant CJ1304, but did not restore motility to gldK or gldL mutants (data not shown). pTB94a expresses gldM and gldN from a vector promoter. The weak complementation may be explained by polarity of the gldM insertion on gldN and the inability of truncated GldN (expressed from pTB94a) to restore motility to wild-type levels. These complementation data are consistent with the suggestion that gldL, gldM, and gldN are cotranscribed. pTB79, which spans gldN, restored motility to the gldN mutant CJ1304 but not to the gldM mutant FJ113 (data not shown). The inability of pTB79 to restore motility to FJ113 supports the idea that the motility defect of the gldM mutant is not simply due to polarity on gldN but that gldM is required for gliding. Because of the sequence similarities between GldN and GldO, the ability of pTB97a, which carries gldO, to suppress mutations in gldN was tested. Introduction of pTB97a restored motility to CJ1304, suggesting that GldO can replace GldN.

Overexpression of gldK inhibits gliding. To determine the reason for the poor complementation of mutants with pTB90, which carries gldK, gldL, gldM, gldN, and gldO, we introduced various plasmids into wild-type cells. Introduction of pTB90 or pTB88 (which spans gldK and gldL) into wild-type cells resulted in a dramatic reduction of colony spreading (Fig. 3C and D). In contrast, introduction of pTB98, which is identical to pTB90 except for the deletion of 798 bp within gldK, did not inhibit motility or colony spreading of wild-type cells (Fig. 3E). Introduction of pTB90 and pTB88, and to a lesser extent pTB98, also resulted in a reduction in growth rate. Wild-type F. johnsoniae MM101 carrying pCP29 growing at 30°C in CYE with cefoxitin had a doubling time of 69 min. In contrast, MM101 carrying pTB88 or pTB90 had doubling times of 135 min and MM101 carrying pTB98 had a doubling time of 104 min. Strains carrying pTB88 or pTB90 (Fig. 3C, D, and G) and to a lesser extent strains carrying pTB98 (Fig. 3E, H, J, L, and N) also exhibited slow colony growth on PY2 agar. Surprisingly, cells with pTB99, which carries gldK, or pTB81a, which carries gldL, were fully motile and grew as fast as cells with control vector. All of the plasmids used in these studies have copy numbers of about 10 in F. johnsoniae. It appears that moderate overexpression of gldK and gldL together interferes with normal motility and adversely affects cell growth.

Complementation of spontaneous and chemically induced mutants. Pate and colleagues isolated 50 spontaneous and chemically induced nonmotile mutants of F. johnsoniae UW101 (7, 52). The mutations responsible for the motility defects of 33 of these mutants have previously been identified (1, 5, 15-17, 27, 28). Introduction of pTB90 or subclones of pTB90 into the remaining 17 mutants restored motility to each of them (Table 2). Colonies of the complemented mutants spread over agar, and cells exhibited motility in wet mounts. Complementation analyses allowed tentative identification of the locations of the mutations (Table 2). The complementation results did not allow us to unambiguously assign the sites of the mutations for UW102-78 and UW102-141. Introduction of pTB98, which spans gldL, gldM, gldN, and gldO, restored motility to UW102-78, but introduction of plasmids carrying gldL, gldM, and gldN individually did not (Table 1). UW102-78 may have multiple mutations or a deletion spanning several of the gld genes. UW102-141 appears to have a mutation in gldK since introduction of pTB99 restored motility to near-wild-type levels. Surprisingly, introduction of pTB81a, which spans gldL, also restored some motility to this mutant. Colonies of wild-type cells or of UW102-141 complemented with pTB99 spread extensively in the first 2 days of incubation, whereas colonies of UW102-141 carrying pTB81a failed to spread until 3 or 4 days of incubation, at which time a thin fringe of spreading was typically observed. The complementation results suggest that UW102-141 has a mutation in gldK that can be partially suppressed by overexpression of gldL. To test this prediction, we amplified the region spanning gldK and gldL from UW102-141 using primers 682 and 685 and determined the nucleotide sequence. A single base change was detected in this region, a "G"-to-"A" substitution at position 1158 numbered from the "A" of the gldK start codon. This change converts the codon for W386 into a stop codon. Apparently the C-terminal 79 amino acids of GldK are not absolutely essential for function, since the mutation is partially suppressed by overexpression of gldL.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Complementation of spontaneous and chemically induced gld mutants by plasmidsa

 
Bacteriophage resistance of gld mutants. Many nonmotile mutants of F. johnsoniae are resistant to infection by F. johnsoniae bacteriophages (51). The sensitivity of wild-type and gld mutant cells to bacteriophages was tested. Wild-type cells of F. johnsoniae were readily lysed (Fig. 5A and B) whereas cells with mutations in gldK, gldL, or gldM were resistant to infection by each of the bacteriophages (Fig. 5C, E, and G and data not shown). Complementation restored sensitivity to each of the phages in addition to restoring gliding motility (Fig. 5D, F, and H). The presence of turbid plaques in Fig. 5D may be a result of the partial inhibition of motility or growth caused by pTB90 as described above. GldN mutants, which as described above retain some ability to glide, were resistant to infection by most of the bacteriophages but remained partially susceptible to infection by {phi}28, {phi}42, and {phi}54, resulting in turbid zones of clearing (Fig. 5I). Complementation with pTB79 restored gliding motility and full susceptibility to all of the bacteriophages (Fig. 5J).



View larger version (89K):
[in this window]
[in a new window]
  		FIG. 5. Effect of mutation in gldK, gldL, gldM, and gldN on bacteriophage resistance. Bacteriophages (3 µl of lysates containing approximately 109 phage/ml) were spotted onto lawns of cells in CYE overlay agar. The plates were incubated at 25°C for 24 h to observe lysis. Bacteriophages were spotted in the following order from left to right: top row, {phi}Cj1, {phi}Cj13, and {phi}Cj23; middle row, {phi}Cj28, {phi}Cj29, and {phi}Cj42; bottom row, {phi}Cj48 and {phi}Cj54. (A) Wild-type F. johnsoniae MM101 with shuttle vector pCP29. (B) Wild-type F. johnsoniae FJ1 with pCP29. (C) gldK mutant CJ1372 with pCP29. (D) CJ1372 complemented with pTB90. (E) gldL mutant CJ1300 with pCP29. (F) CJ1300 complemented with pTB98. (G) gldM mutant FJ113. (H) FJ113 complemented with pTB98. (I) gldN mutant CJ1304 with pCP23. (J) CJ1304 complemented with pTB79. The diameter of the petri dish is 9 cm.

 
Effect of mutations in gldK, gldL, gldM, and gldN on chitin utilization. Wild-type cells of F. johnsoniae digest chitin (43) whereas many nonmotile mutants fail to utilize this insoluble polysaccharide (5, 7, 27, 28). The effects of mutations in gldK, gldL, gldM, and gldN on chitin utilization were determined in PY2 medium supplemented with chitin. Cells with mutations in gldK, gldL, gldM, and gldN were deficient in chitin utilization, and complementation restored the ability to digest chitin (Fig. 6). Although the gldN mutant was deficient in chitin utilization, it did digest a small amount of chitin (Fig. 6D). This may be explained by the fact that cells of gldN mutants retain some motility.



View larger version (192K):
[in this window]
[in a new window]
  		FIG. 6. Effect of mutations in gld genes on ability to utilize chitin. Approximately 4 x 107 cells of F. johnsoniae were spotted on PY2-chitin medium and incubated at 25°C for 3 days (A and C) or 12 days (B and D). (A) 1, wild-type F. johnsoniae FJ1 with shuttle vector pCP29; 2, gldK mutant FJ131 with pCP29; 3, FJ131 complemented with pTB90. (B) 1, wild-type F. johnsoniae MM101 with pCP29; 2, gldL mutant CJ1300 with pCP29; 3, CJ1300 complemented with pTB98. (C) 1, wild-type F. johnsoniae FJ1 with shuttle vector pCP23; 2, gldM mutant FJ113 with pCP23; 3, FJ113 complemented with pTB94a. (D) 1, wild-type F. johnsoniae MM101 with pCP23; 2, gldN mutant CJ1304 with pCP23; 3, CJ1304 complemented with pTB79.

 
Mutations in gldK, gldL, gldM, and gldN do not affect levels of GldJ protein. A previous study demonstrated that cells with mutations in gldA, gldB, gldD, gldF, gldG, gldH, or gldI had normal levels of gldJ transcript but dramatically reduced levels of GldJ protein (5). It was proposed that GldJ interacts directly or indirectly with the other Gld proteins to form a complex and that removal of any of the Gld proteins destabilized GldJ. Western blot analyses of wild-type and mutant strains revealed that, unlike the previously identified gld mutants, the levels of GldJ protein were not dramatically affected by mutations in gldK, gldL, gldM, and gldN (Fig. 7).



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 7. Effect of gld mutations on levels of GldJ protein. Western blot analysis of whole-cell extracts using antiserum to GldJ. Lane 1, wild-type F. johnsoniae FJ1. Lane 2, wild-type F. johnsoniae MM101. Lane 3, gldJ mutant FJ123. Lane 4, gldA mutant CJ288. Lane 5, gldK mutant CJ1372. Lane 6, gldL mutant CJ1300. Lane 7, gldM mutant FJ113. Lane 8, gldN mutant CJ1304. Equal amounts of protein were loaded in each lane.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Novel mariner transposons, HimarEm1 and HimarEm2, were constructed to allow mutagenesis of F. johnsoniae. Erythromycin-resistant colonies arose as a result of transposition, and motility mutants with insertions in novel genes (gldK, gldL, gldM, and gldN) were identified. Himar insertions occur at positions containing the target nucleotide sequence "TA" and are usually described as being otherwise random (39, 56). Himar insertions in F. johnsoniae were far from random. Eleven independent insertions in the region spanning gldK, gldL, gldM, and gldN were isolated and characterized in this study. The 4,125-bp region between HMM1361, which lies 17 bp upstream of the gldK start codon, and HMM1304, which lies within gldN, contains 690 copies (345 on each strand) of the target sequence "TA," but the 11 insertions were found at only seven sites. Targets with more than one insertion were found in gldK (HMM1372 and HFJ131 at position 159 numbered from the "A" of the gldK start codon and HMM1373 and HFJ150 at position 544), gldL (HMM1300 and HMM1253 at position 486 numbered from the "A" of the gldL start codon), and gldN (HMM1304 and HMM1382 at position 345 numbered from the "A" of the gldN start codon). At each site the orientation of the transposon insertions was conserved, and in each case the mutants with identical transposon insertions were isolated from independent experiments, so that they could not have been siblings. This high frequency of multiple insertions at individual sites would not be expected if the transposons inserted randomly. Although the HimarEm transposons were not completely random, they exhibited different biases than Tn4351 and thus constitute an important addition to the genetic toolbox for F. johnsoniae.

GldK, GldL, GldM, and GldN are predicted to localize to the cell envelope, where the bulk of the motility apparatus is expected to reside. GldL, GldM, and GldN are not similar to proteins of known function, but GldK is similar in sequence to the F. johnsoniae lipoprotein GldJ. GldJ is required for motility and is present in helical arrays in the cell envelope (5). Interestingly, expression of gldJ or gldK and gldL in wild-type cells from plasmids with a copy number of approximately 10 resulted in decreased gliding motility and colony spreading (reference 5 and this study). Overexpression of gldK and gldL together also adversely affected cell growth. The defects in colony spreading and cell growth resulting from the presence of gldK and gldL on a plasmid may explain why identification of gld genes by cosmid complementation of spontaneous and chemically induced gldK, gldL, gldM, and gldN mutants was unsuccessful.

Transposon insertions in gldN resulted in severe motility defects, but occasionally cells were observed to move. The observation that overexpression of gldO, which is similar in sequence to gldN, suppressed mutations in gldN suggests that partial redundancy between GldN and GldO may be responsible for the occasional cell movements observed for gldN mutants.

Strains with mutations in gldK, gldL, gldM, and gldN exhibited increased resistance to bacteriophages that infect wild-type cells and were deficient in chitin utilization. Previous studies have demonstrated that gldA, gldB, gldD, gldF, gldG, gldH, gldI, and gldJ mutants also exhibit bacteriophage resistance and deficiencies in chitin utilization (1, 5, 15-17, 27, 28). Although the connection between bacteriophage resistance, chitin utilization, and gliding motility is not understood, it has been suggested that they may each rely on one or more transporters that are defective in gld mutants (28).

Twelve gld genes (gldA, gldB, gldD, gldF, gldG, gldH, gldI, gldJ, gldK, gldL, gldM, and gldN) that play important roles in gliding motility have been identified (references 1, 5, 15-17, 27, and 28 and this study). Introduction of these genes into 50 spontaneous and chemically induced nonmotile mutants restored motility to each of them. This suggests that few if any additional F. johnsoniae gld genes required for gliding motility remain to be discovered. gld genes which are essential for viability would have been difficult to identify by transposon mutagenesis but presumably could have been found by complementation of spontaneous or chemically induced mutants. gld genes with redundant or overlapping functions, however, may have been missed by our analyses.

GldA, GldF, and GldG are thought to constitute an ABC transporter (1, 15). GldB, GldD, GldH, GldI, and GldJ and perhaps GldK are lipoproteins whose exact roles in gliding are not known (references 5, 27, and 28 and this study). Many of the Gld proteins (GldB, GldD, GldH, GldL, GldM, and GldN) exhibit no significant similarity to proteins of known function, suggesting that the bacteroidete gliding "motor" may be a novel structure. The gliding motor converts chemical energy into mechanical work. Previous studies indicate that proton motive force (PMF) is required for gliding (12, 34). ATP may also be needed, since it has been reported that cells depleted for ATP fail to propel latex spheres (12). The motor presumably has one or more components that span the cytoplasmic membrane to harvest cellular energy. The only Gld proteins required for movement that are likely to span the cytoplasmic membrane are GldF, GldG, and GldL. GldF and GldG interact with GldA and are thought to form an ABC transporter. This transporter presumably uses ATP to perform its essential function in gliding, but it is possible that it also utilizes the PMF. The E. coli HlyA hemolysin exporter is an example of an ABC transporter that requires PMF and ATP hydrolysis for transport (20). GldL may span the cytoplasmic membrane and could be in a position to perform a role in energy transduction. One possible explanation for the inhibition of growth and motility by plasmids carrying gldK and gldL is that these proteins are involved in harvesting PMF, and moderate overexpression results in the formation of an unregulated channel that dissipates PMF. The fact that neither GldK alone (encoded by pTB99) nor GldL alone (encoded by pTB81a) inhibited growth or motility indicates that overexpression of both proteins is needed for inhibition and suggests that these proteins interact. The suppression of the gldK mutant UW102-141 by pTB81a also suggests that GldK and GldL interact.

Many of the genes required for F. johnsoniae gliding motility have been identified. Some of the genes involved in gliding of the {delta}-proteobacterium Myxococcus xanthus and of the mollicute Mycoplasma mobile have also been identified (37, 38, 41, 44, 46, 47, 53, 55, 56). Complete genome sequence information is available for M. xanthus (The Institute for Genomic Research, personal communication) and M. mobile (The Broad Institute, Cambridge, MA), facilitating comparative studies. Analysis of the known motility genes from F. johnsoniae, M. mobile, and M. xanthus reveals few similarities. M. mobile gliding motility requires large surface proteins and may involve the cytoskeleton (19, 31, 41). M. mobile has no obvious homologs to any of the proteins known to be required for F. johnsoniae motility with the exception of GldA. Proteins similar to GldA are found in virtually all organisms, so the presence of a distantly related protein in M. mobile is probably not meaningful with respect to gliding motility. M. xanthus has two motility systems. Social motility relies on type IV pili, whereas the mechanism of adventurous motility may involve polysaccharide secretion (45, 50, 53). Analysis of the M. xanthus genome reveals apparent homologs to gldA, gldF, gldG, gldI, gldJ, and gldK. GldA is similar to many putative ATP-binding components of ABC transporters of M. xanthus. One of these, PilH, is involved in social motility. There is no evidence linking the M. xanthus proteins related to GldF, GldG, GldI, GldJ, and GldK to gliding. Obvious homologs to the other gld genes that are required for F. johnsoniae cell movement (gldB, gldD, gldH, gldL, gldM, and gldN) are not found in the M. xanthus genome. While there may be some underlying similarities between the mechanisms of gliding employed by F. johnsoniae and M. xanthus, many of the components of the gliding machineries do not appear to be genetically related.

Complete genome sequences are available for several nongliding (6, 21, 33, 54) and gliding (C. hutchinsonii, DOE-Joint Genome Institute and Los Alamos National Labs) members of the phylum Bacteroidetes. C. hutchinsonii, which is only distantly related to F. johnsoniae, has homologs to each of the F. johnsoniae gld genes and presumably uses the products of these genes to propel itself. In contrast the nonmotile bacteroidetes Bacteroides fragilis, Bacteroides thetaiotaomicron, and Porphyromonas gingivalis each have homologs to some gld genes but lack others. For example, obvious homologs of gldD and gldG are lacking in each of these bacteria, which may account for their inability to glide. Close homologs of gldJ are also lacking, although B. fragilis and P. gingivalis each have a gldK homolog which exhibits some similarity to gldJ. B. fragilis has apparent homologs to gldA, gldB, gldF, gldH, gldK, gldL, and gldM; B. thetaiotaomicron has homologs to gldA, gldB, and gldH; and P. gingivalis has gldA, gldB, gldH, gldI, gldK, gldL, gldM, and gldN homologs. F. johnsoniae gld mutants are deficient in chitin utilization, indicating that Gld proteins may function in both gliding and chitin utilization. The Gld homologs in nonmotile bacteroidetes may perform similar roles in nutrient utilization. Further analysis of the Gld proteins will help elucidate the mechanism of gliding motility employed by F. johnsoniae and other gliding bacteria of the phylum Bacteroidetes and may also identify the functions of similar proteins in nonmotile members of this large and diverse phylum.


   ACKNOWLEDGMENTS
 
This research was supported by a grant from the National Science Foundation (MCB-0130967) and by a Milwaukee Foundation Shaw Scientist Award to M.J.M.

Sequence data for M. xanthus and M. mobile were obtained from The Institute for Genomic Research website at http://www.tigr.org. Sequence data for C. hutchinsonii were obtained from the Joint Genome Institute (http://jgi.doe.gov), Los Alamos National Labs, and the U.S. Department of Energy.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biological Sciences, 181 Lapham Hall, University of Wisconsin—Milwaukee, 3209 N. Maryland Ave., Milwaukee, WI 53211. Phone: (414) 229-5844. Fax: (414) 229-3926. E-mail: mcbride{at}uwm.edu. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Agarwal, S., D. W. Hunnicutt, and M. J. McBride. 1997. Cloning and characterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc. Natl. Acad. Sci. USA 94:12139-12144.[Abstract/Free Full Text]
  2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
  3. Bayley, D. P., E. R. Rocha, and C. J. Smith. 2000. Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure. FEMS Microbiol. Lett. 193:149-154.[CrossRef][Medline]
  4. Bouhenni, R., A. Gehrke, and D. Saffarini. 2005. Identification of genes involved in cytochrome c biogenesis in Shewanella oneidensis, using a modified mariner transposon. Appl. Environ. Microbiol. 71:4935-4937.[Abstract/Free Full Text]
  5. Braun, T. F., and M. J. McBride. 2005. Flavobacterium johnsoniae GldJ is a lipoprotein that is required for gliding motility. J. Bacteriol. 187:2628-2637.[Abstract/Free Full Text]
  6. Cerdeno-Tarraga, A., S. Patrick, L. Crossman, G. Blakely, V. Abratt, N. Lennard, I. Poxton, B. Duerden, B. Harris, M. Quail, A. Barron, L. Clark, C. Corton, J. Doggett, M. Holden, N. Larke, A. Line, A. Lord, H. Norbertczak, D. Ormond, C. Price, E. Rabbinowitsch, J. Woodward, B. Barrell, and J. Parkhill. 2005. Extensive DNA inversions in the B. fragilis genome control variable gene expression. Science 307:1463-1465.[Abstract/Free Full Text]
  7. Chang, L. Y. E., J. L. Pate, and R. J. Betzig. 1984. Isolation and characterization of nonspreading mutants of the gliding bacterium Cytophaga johnsonae. J. Bacteriol. 159:26-35.[Abstract/Free Full Text]
  8. Cho, S. G., and Y. J. Choi. 1998. Characterization of the xaiF gene encoding a novel xylanase-activity-increasing factor, XaiF. J. Microbiol. Biotechnol. 8:378-387.
  9. Cosma, M., S. Pepe, I. Annunziata, R. Newbold, M. Grompe, G. Parenti, and A. Ballabio. 2003. The multiple sulfatase deficiency gene encodes an essential and limiting factor for the activity of sulfatases. Cell 113:445-456.[CrossRef][Medline]
  10. Dierks, T., B. Schmidt, L. Borissenko, J. Peng, A. Preusser, M. Mariappan, and K. von Figura. 2003. Multiple sulfatase deficiency is caused by mutations in the gene encoding the human C(alpha)-formylglycine generating enzyme. Cell 113:435-444.[CrossRef][Medline]
  11. Doering, D. 1992. Ph.D. thesis. Massachusetts Institute of Technology, Cambridge.
  12. Dzink-Fox, J. L., E. R. Leadbetter, and W. Godchaux III. 1997. Acetate acts as a protonophore and differentially affects bead movement and cell migration of the gliding bacterium Cytophaga johnsonae (Flavobacterium johnsoniae). Microbiology 143:3693-3701.[Abstract]
  13. Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative bacteria. Gene 52:147-154.[CrossRef][Medline]
  14. Hofmann, K., and W. Stoffel. 1993. TMbase—a database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler 374:166.
  15. Hunnicutt, D. W., M. J. Kempf, and M. J. McBride. 2002. Mutations in Flavobacterium johnsoniae gldF and gldG disrupt gliding motility and interfere with membrane localization of GldA. J. Bacteriol. 184:2370-2378.[Abstract/Free Full Text]
  16. Hunnicutt, D. W., and M. J. McBride. 2001. Cloning and characterization of the Flavobacterium johnsoniae gliding motility genes gldD and gldE. J. Bacteriol. 183:4167-4175.[Abstract/Free Full Text]
  17. Hunnicutt, D. W., and M. J. McBride. 2000. Cloning and characterization of the Flavobacterium johnsoniae gliding motility genes, gldB and gldC. J. Bacteriol. 182:911-918.[Abstract/Free Full Text]
  18. Kempf, M. J., and M. J. McBride. 2000. Transposon insertions in the Flavobacterium johnsoniae ftsX gene disrupt gliding motility and cell division. J. Bacteriol. 182:1671-1679.[Abstract/Free Full Text]
  19. Korolev, E. V., A. V. Nikonov, M. S. Brudnaya, E. S. Snigirevskaya, G. V. Sabinin, Y. Y. Komissarchik, P. I. Ivanov, and S. N. Borchsenius. 1994. Tubular structures of Mycoplasma gallisepticum and their possible participation in cell motility. Microbiology 140:671-681.[Abstract]
  20. Koronakis, V., C. Hughes, and E. Koronakis. 1991. Energetically distinct early and late stages of HlyB/HlyD-dependent secretion across both Escherichia coli membranes. EMBO J. 10:3263-3272.[Medline]
  21. Kuwahara, T., A. Yamashita, H. Hirakawa, H. Nakayama, H. Toh, N. Okada, S. Kuhara, M. Hattori, T. Hayashi, and Y. Ohnishi. 2004. Genomic analysis of Bacteroides fragilis reveals extensive DNA inversions regulating cell surface adaptation. Proc. Natl. Acad. Sci. USA 101:14919-14924.[Abstract/Free Full Text]
  22. Lapidus, I. R., and H. C. Berg. 1982. Gliding motility of Cytophaga sp. strain U67. J. Bacteriol. 151:384-398.[Abstract/Free Full Text]
  23. Li, L.-Y., N. B. Shoemaker, and A. A. Salyers. 1995. Location and characterization of the transfer region of a Bacteroides conjugative transposon and regulation of the transfer genes. J. Bacteriol. 177:4992-4999.[Abstract/Free Full Text]
  24. Lupas, A. 1996. Prediction and analysis of coiled-coil structures. Methods Enzymol. 266:513-525.[Medline]
  25. McBride, M. J. 2001. Bacterial gliding motility: multiple mechanisms for cell movement over surfaces. Annu. Rev. Microbiol. 55:49-75.[CrossRef][Medline]
  26. McBride, M. J. 2004. Cytophaga-flavobacterium gliding motility. J. Mol. Microbiol. Biotechnol. 7:63-71.[CrossRef][Medline]
  27. McBride, M. J., and T. F. Braun. 2004. GldI is a lipoprotein that is required for Flavobacterium johnsoniae gliding motility and chitin utilization. J. Bacteriol. 186:2295-2302.[Abstract/Free Full Text]
  28. McBride, M. J., T. F. Braun, and J. L. Brust. 2003. Flavobacterium johnsoniae GldH is a lipoprotein that is required for gliding motility and chitin utilization. J. Bacteriol. 185:6648-6657.[Abstract/Free Full Text]
  29. McBride, M. J., and M. J. Kempf. 1996. Development of techniques for the genetic manipulation of the gliding bacterium Cytophaga johnsonae. J. Bacteriol. 178:583-590.[Abstract/Free Full Text]
  30. McGowan, S. J., M. Sebaihia, S. O'Leary, K. R. Hardie, P. Williams, G. S. Stewart, B. W. Bycroft, and G. P. Salmond. 1997. Analysis of the carbapenem gene cluster of Erwinia carotovora: definition of the antibiotic biosynthetic genes and evidence for a novel beta-lactam resistance mechanism. Mol. Microbiol. 26:545-556.[CrossRef][Medline]
  31. Miyata, M., H. Yamamoto, T. Shimizu, A. Uenoyama, C. Citti, and R. Rosengarten. 2000. Gliding mutants of Mycoplasma mobile: relationships between motility and cell morphology, cell adhesion and microcolony formation. Microbiology 146:1311-1320.[Abstract/Free Full Text]
  32. Nakai, K., and M. Kanehisa. 1991. Expert system for predicting protein localization sites in Gram-negative bacteria. Proteins Struct. Funct. Genet. 11:95-110.[CrossRef][Medline]
  33. Nelson, K., R. Fleischmann, R. DeBoy, I. Paulsen, D. Fouts, J. Eisen, S. Daugherty, R. Dodson, A. Durkin, M. Gwinn, D. Haft, J. Kolonay, W. Nelson, T. Mason, L. Tallon, J. Gray, D. Granger, H. Tettelin, H. Dong, J. Galvin, M. Duncan, F. Dewhirst, and C. Fraser. 2003. Complete genome sequence of the oral pathogenic bacterium Porphyromonas gingivalis strain W83. J. Bacteriol. 185:5591-5601.[Abstract/Free Full Text]
  34. Pate, J. L., and L.-Y. E. Chang. 1979. Evidence that gliding motility in prokaryotic cells is driven by rotary assemblies in the cell envelopes. Curr. Microbiol. 2:59-64.
  35. Pate, J. L., S. J. Petzold, and L.-Y. E. Chang. 1979. Phages for the gliding bacterium Cytophaga johnsonae that infect only motile cells. Curr. Microbiol. 2:257-262.
  36. Pearson, W. R. 1990. Rapid and sensitive sequence comparison with FASTP and FASTA. Methods Enzymol. 183:63-98.[Medline]
  37. Rodriguez, A. M., and A. M. Spormann. 1999. Genetic and molecular analysis of cglB, a gene essential for single-cell gliding in Myxococcus xanthus. J. Bacteriol. 181:4381-4390.[Abstract/Free Full Text]
  38. Rodriguez-Soto, J. P., and D. Kaiser. 1997. The tgl gene: social motility and stimulation in Myxococcus xanthus. J. Bacteriol. 179:4361-4371.[Abstract/Free Full Text]
  39. Rubin, E., B. Akerley, V. Novik, D. Lampe, R. Husson, and J. Mekalanos. 1999. In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria. Proc. Natl. Acad. Sci. USA 96:1645-1650.[Abstract/Free Full Text]
  40. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  41. Seto, S., A. Uenoyama, and M. Miyata. 2005. Identification of a 521-kilodalton protein (Gli521) involved in force generation or force transmission for Mycoplasma mobile gliding. J. Bacteriol. 187:3502-3510.[Abstract/Free Full Text]
  42. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 2:784-791.
  43. Stanier, R. Y. 1947. Studies on non-fruiting myxobacteria. I. Cytophaga johnsonae, n. sp., a chitin-decomposing myxobacterium. J. Bacteriol. 53:297-315.[Free Full Text]
  44. Stephens, K., P. Hartzell, and D. Kaiser. 1989. Gliding motility in Myxococcus xanthus: mgl locus, RNA, and predicted protein products. J. Bacteriol. 171:819-830.[Abstract/Free Full Text]
  45. Sun, H., D. R. Zusman, and W. Shi. 2000. Type IV pilus of Myxococcus xanthus is a motility apparatus controlled by the frz chemosensory system. Curr. Biol. 10:1143-1146.[CrossRef][Medline]
  46. Uenoyama, A., A. Kusumoto, and M. Miyata. 2004. Identification of a 349-kilodalton protein (Gli349) responsible for cytadherence and glass binding during gliding of Mycoplasma mobile. J. Bacteriol. 186:1537-1545.[Abstract/Free Full Text]
  47. White, D. J., and P. L. Hartzell. 2000. AglU, a protein required for gliding motility and spore maturation of Myxococcus xanthus, is related to WD-repeat proteins. Mol. Microbiol. 36:662-678.[CrossRef][Medline]
  48. Wilson, K., A. Sessitsch, J. Corbo, K. Giller, A. Akkermans, and R. Jefferson. 1995. ß-Glucuronidase (GUS) transposons for ecological and genetic studies of rhizobia and other gram-negative bacteria. Microbiology 141:1691-1705.[Abstract]
  49. Wolf, E., P. Kim, and B. Berger. 1997. MultiCoil: a program for predicting two- and three-stranded coiled coils. Protein Sci. 6:1179-1189.[Abstract]
  50. Wolgemuth, C., E. Hoiczyk, D. Kaiser, and G. Oster. 2002. How myxobacteria glide. Curr. Biol. 12:369-377.[CrossRef][Medline]
  51. Wolkin, R. H., and J. L. Pate. 1986. Phage adsorption and cell adherence are motility-dependent characteristics of the gliding bacterium Cytophaga johnsonae. J. Gen. Microbiol. 132:355-367.
  52. Wolkin, R. H., and J. L. Pate. 1985. Selection for nonadherent or nonhydrophobic mutants co-selects for nonspreading mutants of Cytophaga johnsonae and other gliding bacteria. J. Gen. Microbiol. 131:737-750.
  53. Wu, S. S., and D. Kaiser. 1995. Genetic and functional evidence that type IV pili are required for social gliding motility in Myxococcus xanthus. Mol. Microbiol. 18:547-558.[CrossRef][Medline]
  54. Xu, J., M. K. Bjursell, J. Himrod, S. Deng, L. K. Carmichael, H. C. Chiang, L. V. Hooper, and J. I. Gordon. 2003. A genomic view of the human-Bacteroides thetaiotaomicron symbiosis. Science 299:2074-2076.[Abstract/Free Full Text]
  55. Yang, Z., Y. Geng, D. Xu, H. B. Kaplan, and W. Shi. 1998. A new set of chemotaxis homologues is essential for Myxococcus xanthus social motility. Mol. Microbiol. 30:1123-1130.[CrossRef][Medline]
  56. Youderian, P., N. Burke, D. J. White, and P. L. Hartzell. 2003. Identification of genes required for adventurous gliding motility in Myxococcus xanthus with the transposable element mariner. Mol. Microbiol. 49:555-570.[CrossRef][Medline]

Journal of Bacteriology, October 2005, p. 6943-6952, Vol. 187, No. 20
0021-9193/05/$08.00+0     doi:10.1128/JB.187.20.6943-6952.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braun, T. F.
Right arrow Articles by McBride, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braun, T. F.
Right arrow Articles by McBride, M. J.

Home Help [Feedback] [For Subscribers] [Archive] [Search]