Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tomenius, H. Articles by Melefors, O. Search for Related Content PubMed PubMed Citation Articles by Tomenius, H. Articles by Melefors, O.

 Previous Article  |  Next Article 

Journal of Bacteriology, November 2005, p. 7317-7324, Vol. 187, No. 21
0021-9193/05/$08.00+0     doi:10.1128/JB.187.21.7317-7324.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Genetic and Functional Characterization of the Escherichia coli BarA-UvrY Two-Component System: Point Mutations in the HAMP Linker of the BarA Sensor Give a Dominant-Negative Phenotype

Henrik Tomenius,^1,2 Anna-Karin Pernestig,^1,3 Claudia F. Méndez-Catalá,⁴ Dimitris Georgellis,⁴ Staffan Normark,¹ and Öjar Melefors^1,2*

Microbiology and Tumorbiology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden,¹ Swedish Institute for Infectious Disease Control, SE-17182 Solna, Sweden,² University of Skövde, SE-54128 Skövde, Sweden,³ Departamento de Genética Molecular, Instituto de Fisiologia Celular, Universidad National Autónoma de México, 04510 México D.F., Mexico⁴

Received 29 June 2005/ Accepted 23 August 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
The BarA-UvrY two-component system family is strongly associated with virulence but is poorly understood at the molecular level. During our attempts to complement a barA deletion mutant, we consistently generated various mutated BarA proteins. We reasoned that characterization of the mutants would help us to better understand the signal transduction mechanism in tripartite sensors. This was aided by the demonstrated ability to activate the UvrY regulator with acetyl phosphate independently of the BarA sensor. Many of the mutated BarA proteins had poor complementation activity but could counteract the activity of the wild-type sensor in a dominant-negative fashion. These proteins carried point mutations in or near the recently identified HAMP linker, previously implicated in signal transduction between the periplasm and cytoplasm. This created sensor proteins with an impaired kinase activity and a net dephosphorylating activity. Using further site-directed mutagenesis of a HAMP linker-mutated protein, we could demonstrate that the phosphoaccepting aspartate 718 and histidine 861 are crucial for the dephosphorylating activity. Additional analysis of the HAMP linker-mutated BarA sensors demonstrated that a dephosphorylating activity can operate via phosphotransfer within a tripartite sensor dimer in vivo. This also means that a tripartite sensor can be arranged as a dimer even in the dephosphorylating mode.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adaptation of bacteria to new environments largely relies on two-component systems (TCSs), a signal transduction pathway typically consisting of a membrane-anchored sensor protein communicating with a regulatory protein inside the bacterium via phosphotransfer reactions (12, 48). The importance of TCSs for adaptation during the different steps of infection have consequently made them potential targets for novel types of antimicrobial therapy (20, 39).

In the prototypic model, an environmental stimulus interacts with the N terminus of the membrane-anchored sensor protein, leading to autophosphorylation of a specific histidine residue using ATP. The sensor then acts as a kinase and transmits the phosphate group to a conserved aspartate residue on the response regulator protein. This normally enables the regulator to control the transcription of a certain set of genes by sequence-specific DNA binding. Sequencing of the Escherichia coli genome has identified approximately 60 sensor kinases and response regulators, most of which have been arranged in cognate pairs (24).

Most two-component sensors have a classical architecture with only one cytoplasmic transmitter domain, H1, such as the EnvZ sensor (24). In E. coli four of the sensor proteins, ArcB, EvgS, TorS, and BarA, have a more complex organization. These four sensors are termed tripartite as they have two extra domains, D1 and H2 (also called HPt domain), besides the H1 transmitter domain. Following the initial autophosphorylation of the histidine residue in the H1 domain, the phosphate group is believed to be transferred to a histidine residue in the H2 domain of the sensor protein via an aspartate residue in the D1 domain, before being relayed to the regulator protein in a His Asp His Asp fashion (9, 16, 42, 43).

It has been speculated that D1 and H2 domains in tripartite sensors allow for additional modulation of the signal transduction to the regulator protein or for the ability to regulate different pathways (33). It has also been shown in vitro that these domains are instrumental in the dephosphorylation of the cognate regulator (8).

The tripartite sensor BarA (named for bacterial adaptive response) was first identified by its ability to activate the OmpR response regulator. As this effect could be observed only with high-copy expression of BarA, it was not believed to be a physiologically relevant function (19, 27). Genetic evidence, together with results from in vitro transphosphorylation assays, later demonstrated that BarA forms a TCS with the UvrY response regulator protein (25, 30).

It was recently demonstrated that UvrY positively controls expression of the noncoding csrB and csrC RNAs (40, 41, 47). These RNAs can bind the 6.8-kDa CsrA protein and thus prevent it from interfering with ribosome loading of various target mRNAs (7). The Csr system has been shown to have a major impact on regulation on carbon metabolism pathways (34). Consequently, we could demonstrate that deletion mutations of barA or uvrY have drastic effects on the ability to successfully grow in a competition depending on the carbon source of the medium (29). Mutations in the Csr system in E. coli and Salmonella enterica also cause other phenotypic effects, including changes in motility and biofilm formation (1, 14, 41, 45, 46).

Deletions of orthologous systems in other bacteria, such as BarA-SirA in Salmonella, ExpS-ExpA in Erwinia, BarA-VarA in Vibrio, and GacS-GacA in Pseudomonas, have a clear effect on the virulence of the bacteria (11). The fact that this system is important for infections in a large spectrum of host organisms has also been corroborated by work demonstrating the necessity of the Pseudomonas GacS-GacA system for infections in either animals, nematodes, insects, or plants (32). The underlying mechanism behind this effect on virulence is far from clear. The only verified direct target genes are the functional homologues to the csrB and csrC regulatory RNAs, but several indirect effects have been reported, particularly on the formation of secreted molecules (11).

The nature of a physiological stimulus acting directly on the sensor is still elusive. Recent reports demonstrated that bile and intestinal short fatty acids have a clear effect on this two-component system in Salmonella (18, 31), although it is unclear whether these effects are mediated via the sensor or not. To better understand the tripartite sensors at the molecular level, we decided to genetically characterize the BarA-UvrY system in E. coli.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Strains. The principal E. coli strain used in this work was the MG1655 derivative KSB837 carrying a csrB-lacZ gene (10). Strains HJT144 (barA::Kan^r), HJT042 (uvrY::Cam^r), and HJT162 (barA::Kan^r uvrY::Cam^r) were constructed by P1vir transduction of the disrupted barA and uvrY genes from strains AKP014 and AKP023 (30) into the KSB837 strain. To avoid cotransduction of the relA1 allele from AKP014 (MC4100 derivative), transductants were tested for growth on M63 minimal plates (44), and to avoid cotransduction of the flhD allele from MC4100, transductants were tested for motility on swarming plates. The HJT469 strain was constructed by the one-step knockout method using primers AckAptaKOF and AckAptaKOR in strain BW25141 (6). The resulting ackA-pta::Cam^r construct was subsequently transduced by P1vir lysates into HJT144. The HJT202(uvry::Kan^r) strain was constructed by the one-step knockout method using primers UvrKOF and UvrKOR. The construct, not disrupting the P3 promoter of the uvrC gene (25), was subsequently transduced by P1vir lysates into strain KSB837. For cloning purposes, we used strains XL1-Blue and XL1-BlueMRF'Kan (Stratagene, La Jolla, CA). The bacterial strains used in this study are shown in Table 1.

View this table: [in this window] [in a new window]

TABLE 1. Bacterial strains and plasmids used in this study

Media and growth conditions. Cultures were routinely grown in Luria broth (LB) (10 g Bacto tryptone, 5 g Bacto yeast extract, 10 g NaCl per liter), using 100-ml Erlenmeyer glass flasks at 37°C in a shaker at 170 rpm. Antibiotics were added, when required, to the following concentrations: ampicillin, 100 µg/ml; chloramphenicol, 20 µg/ml; kanamycin, 50 µg/ml; and tetracycline, 10 µg/ml. The indicated carbohydrates, added to LB to an end concentration of 0.2% (wt/vol), were first dissolved in distilled water and sterile filtered through 0.2-µm filters (Pall, Ann Arbor, MI).

Plasmids. Plasmid pHTbar3 was constructed by linearizing pBarA with NcoI, followed by blunting the sticky ends using the Klenow fragment and subsequent cleavage with BamHI. The released 3.1-kb barA gene fragment (containing the endogenous promoter) was cloned in the clockwise direction into pACYC184 between the BamHI site and the blunt EcoRV site, thus disrupting the tetracycline resistance gene. Following transformation into XL1-Blue supercompetent cells, clones were selected for growth on chloramphenicol and inability to grow on tetracycline. Plasmids pHTbar4, pHTbar5, pHTbar7, pHTbar8, pHTbar9, pHTbar10, and pHTbar11 were constructed by replacing a 1.8-kb MluI-BstEII fragment of the barA gene from pHTbar3 with the same fragment derived from a PCR product amplified from MC4100 chromosomal DNA using primers Bar1F and Bar12R, followed by retransformation into XL1-Blue cells and selection for chloramphenicol resistance. Prior to ligation, the PCR product was sequenced using primers Bar1F, Bar3F, Bar5F, and Bar7F, revealing that at least the majority of the PCR products were wild type. Plasmid pHTbar3 and its derivatives all express BarA protein, using the endogenous promoter of the barA gene, to approximately 15 times the wild-type levels. To replace aspartate 54 in the UvrY protein with glutamine, plasmid pUY14 was subjected to site-directed mutagenesis using high-performance liquid chromatography-purified primers D54QF and D54QR and the QuikChange kit (Stratagene) to create plasmid pUYD54Q. To replace aspartate 718 and histidine 861 in the BarA protein with glutamine and leucine, plasmid pHTbar7 was subjected to site-directed mutagenesis using high-performance liquid chromatography-purified primers BarD718QF and BarD718QR (aspartate 718) and BarH861LF and BarH861LR (histidine 861) and the QuikChange kit creating plasmids pHT7D718Q and pHT7H861L, respectively. All constructs were sequenced to confirm the mutations. Plasmid pBR7D718Q was made by digesting the pHT7D718Q plasmid with BamHI and XbaI, relieving a 3.1-kb barA-containing fragment, followed by blunting of the sticky ends using the Klenow fragment and subsequent insertion into the unique ScaI site of pBR322, thus disrupting the ampicillin resistance gene. The plasmids used in this study are shown in Table 1.

DNA sequencing. To cover the entire barA gene, 14 different primers, Bar1F to Bar14R, at approximately 250-bp intervals alternating between the forward and reverse direction, were employed. The uvrY gene was sequenced using primers Uvr3F and Uvr4R. Sequencing reactions were made using the Big Dye kit and separated on an ABI310 capillary DNA sequencer (Applied Biosystems).

List of oligonucleotides. The oligonucleotides that were used are as follows (sequences given in the 5' to 3' direction): AckAptaKOF, ACTGCGGTAGTTCTTCACTGAAATTTGCCATCATCGATGCGTGTAGGCTGGAGCTGCTTC; AckAptaKOR, CAGCGCGATGGTGTAGACGATATCGTCAACCAGTGCGCCACATATGAATATCCTCCTTAG; Bar1F, CATACGCCAAAATGAGGACA; Bar2R, GGTGCCAGGATCAGAATCAT; Bar3F, TAACGACTTGCAGCGTCAAC; Bar4R, ATTTTTGGCATCGCTACTGG; Bar5F, AGCGTGATGATGCTGTTTTG; Bar6R, TTCAGTGGTGTACGCAGCTC; Bar7F, TCTCGAAACTGGAAGCAGGT; Bar8R, GATTGATCGCGTTCAGGAAT; Bar9F, AATCGCGGTTCAACTTTCTG; Bar10R, AGTGCCAGCATCAGGAAATC; Bar11F, AACCCCGCTAACCTGAAACT; Bar12R, GGGTTCACCACAATTTCGTT; Bar13F, CGCAACAAAGTTGAGGAACA; Bar14R, ACTCGACAAGACATCCATTACC; Uvr3F, CACCACTCAGGAAGATAAAAG; Uvr4R, GAGAAAAATCGAAATACCCAC; UvrD54QF, GACGTGGTGCTAATGCAGATGAGTATGCCGGGC; UvrD54QR, GCCCGGCATACTCATCTGCATTAGCACCACGTC; UvrKOF, TTGATCAACGTTCTACTTGTTGATGACCACGAACTGGTGCGTGTAGGCTGGAGCTGCTTC; UvrKOR, GCAATGTAACGCTGCCCTGAATAGACAGAACGAATCGCACCATATGAAT ATCCTCCTTAG; BarD718QF, CAGATGCCGTTCGATTTGATCTTAATGCAGATTCAAATGCCG; BarD718QR, CGGCATTTGAATCTGCATTAAGATCAAATCGAACGGCATCTG; BarH861LF, CCCGGAAGGCCTGGTTGATTTGATTCTAAAACTGCATGGC; and BarH861LR, GCCATGCAGTTTTAGAATCAAATCAACCAGGCCTTCCGGG.

ß-Galactosidase assay. ß-Galactosidase activity was assayed in 10-min reactions by the method of Miller (23) using a spectrophotometer. One hundred microliters of cell suspension was used for each reaction. All measurements were done 2 hours after exponential phase unless otherwise stated in the text. Error bars represent standard errors from two separate experiments unless stated otherwise.

Western blot. BarA protein was analyzed on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels by Western blotting according to standard methods. A polyclonal rabbit antiserum was raised against a BarA peptide (ERDQSRLFQAFRQADC) (Innovagen, Lund, Sweden).

Phosphorylation with acetyl phosphate. Synthesis of ³²P-labeled acetyl phosphate was done as described earlier (38). Phosphorylation assays were carried out at room temperature in the presence of [³²P]acetyl phosphate (2 µCi), 50 mM Tris-HCl (pH 7), 150 mM NaCl, 10 mM MgCl₂, and 10 µM of purified six-histidine-tagged UvrY protein (47). The reactions were initiated by the addition of [³²P]acetyl phosphate, terminated 10 min later by the addition of an equal volume of 2x SDS sample buffer and immediately separated on 15% SDS-polyacrylamide gels.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Complementation of a uvrY deletion mutation. To monitor BarA-UvrY activity, we analyzed expression of the csrB gene, using the MG1655 derivative KSB837 carrying a chromosomal csrB-lacZ transcriptional fusion. As expected, csrB expression was clearly lower in both the barA (HJT144) and uvrY (HJT042) deletion mutants and in a double mutant (HJT162) compared to the KSB837 parental strain (Table 2). This was examined 2 hours after exponential phase in Luria broth, when csrB RNA has earlier been reported to be at a maximum level in a wild-type strain (10).

View this table: [in this window] [in a new window]

TABLE 2. Complementation of uvrY deletion mutants

The uvrY deletion mutant, HJT042, could be complemented with a plasmid carrying the wild-type uvrY gene (pUY14). However, when the postulated phosphoaccepting aspartate at position 54 (30) of the UvrY protein was replaced with a glutamine residue (pUY14D54Q), we saw only a negligible complementation (Table 2).

In a previous study it was observed that a uvrY deletion mutant failed to activate transcription of csrB, whereas a barA deletion mutant retained approximately 40% of the wild-type levels of csrB RNA (40). Those experiments had been done in the glucose-containing Kornberg medium, and we reasoned that the presence of glucose (or other carbohydrates) leads to production of acetate (5), which via the AckA-Pta pathway could be converted into acetyl phosphate (22). This compound has been shown to activate some response regulators independently of their sensors both in vivo and in vitro (49). When we supplemented LB with 0.2% glucose, we observed a clear increase in csrB-lacZ activity in the HJT144 strain lacking the barA gene. No such glucose-mediated increase was seen in strains lacking the chromosomal uvrY gene. The same observation was made when glucose was replaced with arabinose or maltose. When we disrupted the ackA and pta genes, encoding enzymes necessary for the formation of acetyl phosphate, we could no longer observe any glucose-mediated increase in csrB-lacZ activity from the resulting barA and ackA-pta mutant strain HJT469. The role of acetyl phosphate was further supported when we added 100 mM HEPES buffer to the medium and partially abolished the induction by arabinose, consistent with the concept that acetate reutilization is facilitated by a low pH (49) (Table 2). Finally, we also demonstrated that acetyl phosphate was able to efficiently phosphorylate purified UvrY protein in vitro (Fig. 1).

View larger version (33K): [in this window] [in a new window]

FIG. 1. Acetyl phosphate can phosphorylate UvrY in vitro. Purified six-histidine-tagged UvrY protein (10 µM) was incubated with (+) or without (–) [32P]acetyl phosphate for 10 min, and reactions were separated on 15% SDS-polyacrylamide gels.

There was, however, no increase in csrB-lacZ expression when glucose was added to LB for the uvrY deletion strain, HJT042, where wild-type UvrY was overexpressed from the pUY14 plasmid. Our inability to observe such an increase may be explained by csrB-lacZ activity having reached a maximum level in our experimental system, considering that csrB-lacZ activity in a strain with UvrY overexpressed was roughly equal that of the parental strain with a single uvrY gene copy. On the other hand, csrB-lacZ activity did not increase when the mutated UvrY protein was overexpressed (pUY14D54Q) in the uvrY mutant strain HJT042, no matter whether glucose was added or not (Table 2).

Complementation of a barA deletion mutant. When we attempted to complement the barA deletion mutant, HJT144, with a barA gene carried on pACYC184 (pHTbar3), we could not observe complementation of csrB-lacZ activity at any stage of the growth curve despite adequate levels of a correctly sized protein (Fig. 2). Plasmid pHTbar3 expresses full-length BarA protein using the endogenous promoter of the barA gene to approximately 15 times the wild-type levels. Sequencing of the pHTbar3 plasmid, however, revealed six point mutations in the barA gene, four of which resulted in amino acid changes. Our attempts to exchange the mutated part of the barA gene with a wild-type sequence were unsuccessful, as all new plasmid clones exhibited poor complementation and harbored new mutations, suggesting that overexpression of wild-type BarA on a plasmid creates a selective pressure for plasmids expressing mutated BarA protein (Table 3 and Fig. 3).

View larger version (35K): [in this window] [in a new window]

FIG. 2. Complementation with plasmid pHTbar3. Growth in LB was monitored and csrB-lacZ activity measured for strain KSB837 harboring pACYC184 (squares and filled bars) or pHTbar3 (triangles and open bars) and HJT144 harboring pACYC184 (diamonds and striped bars) or pHTbar3 (circle and gray bars). Equal numbers of bacteria were taken in parallel for the preparation of cell lysates, and BarA protein levels were determined by Western blotting. Arrows indicate the position of full-length BarA protein. OD A600, optical density or absorbance at 600 nm.

View this table: [in this window] [in a new window]

TABLE 3. Complementation of barA deletion mutants

View larger version (28K): [in this window] [in a new window]

FIG. 3. Schematic representation of the mutated barA clones. A schematic representation of the 918-amino-acid BarA protein with the principal domains marked is shown at the top of the figure. Boxes depict motifs that are conserved in tripartite sensors. TM1 and TM2 show the putative transmembrane regions. Phosphoaccepting amino acids at positions 302, 718, and 861 are indicated. The HAMP-containing linker region is located between the TM2 and the conserved catalytic domain around His 302. Schematic representations of the individual pHTbar clones that were sequenced and their derivatives are shown. The broken line indicates the region that was exchanged from pHTbar3. Missense or nonsense mutations are marked by arrows, and neutral mutations are marked by black bars. The mutations for the plasmids follow: missense mutations for pHTbar3, Q40L, M245T, F423L, and F514S; for pHTbar4, N92D and T321A; for pHTbar5, K293E; for pHTbar7, N276S; for pHTbar8, H256R; for pHTbar9, M108V and L323I; for pHTbar10, A150T and M156V; and for pHTbar11, N426L; nonsense mutation for pHTbar4, K395STOP; neutral mutations for pHTbar3, T303C and C426T; for pHTbar7, T477C; for pHTbar8, T408C; and pHTbar11, T942C.

When the different plasmid clones were transferred to the KSB837 parental strain with an intact barA gene, some of them caused a clear decrease in csrB-lacZ activity, implying that not only is the plasmid-borne barA gene unable to adequately increase csrB expression but it also counteracts the activity of the wild-type BarA protein expressed from the chromosomal gene in a dominant-negative fashion (Table 3). This group of clones (pHTbar3, pHTbar5, pHTbar7, and pHTbar8) harbored missense mutations in the linker region between the distal transmembrane section (TM2) and the first transmitter domain (H1), and all had a poor complementation activity in the barA mutant (with the possible exception of pHTbar8). Plasmid pHTbar4 exhibited neither complementing nor dominant-negative activity, most likely due to a nonsense mutation resulting in a large C-terminal truncation at amino acid position 395. Clones pHTbar9, pHTbar10, and pHTbar11, carrying mutations in the periplasmic loop or the ATP-binding pocket, increased csrB-lacZ transcription in the barA mutant strain HJT144 to different extents, and all caused only a moderate decrease of csrB-lacZ transcription in the KSB837 parental strain.

The dominant-negative phenotype is the result of UvrY dephosphorylation. To better understand the dominant-negative effect of the mutated BarA proteins, we used the above model system where UvrY is phosphorylated in a barA mutant strain after the addition of glucose (Table 2) and tested whether introduction of the pHTbar plasmids influenced csrB-lacZ activity under those conditions. The fact that pHTbar3, pHTbar5, pHTbar7, and to a certain extent pHTbar8, caused a decrease in csrB-lacZ activity and thus suppressed the effect of glucose (Table 3), confirmed the dominant-negative activity of these plasmids. The most plausible mechanistic explanation for this effect is that the linker mutations impair the kinase activity and give the BarA proteins a net dephosphorylating activity that leads to dephosphorylation of UvrY. This led us to make additional mutations in the pHTbar7 sensor to test this point. As both the phosphoaccepting aspartate in the D1 domain and the histidine in the H2 domain have been shown to be critical for the dephosphorylating activity of the analogous E. coli tripartite sensor ArcB in vitro (8) and in vivo (28), we converted the Asp718 and His861 in pHTbar7 into a glutamine and a leucine by site-directed mutagenesis, creating pHT7D718Q and pHT7H861L, respectively. Either of these mutations inhibited the dominant-negative effect of pHTbar7 on the glucose-activated UvrY, supporting the hypothesis that the pHTbar7 product exhibits a net dephosphorylating activity. This result also indicates that Asp718 and His861 of BarA are indispensable for the dephosphorylating activity on UvrY-P (Table 4).

View this table: [in this window] [in a new window]

TABLE 4. Plasmid complementation with the barA gene mutated in Asp 718 and His 861

Phosphotransfer within a sensor dimer. To address whether the observed repression of the wild-type BarA protein (Table 3), derived from the chromosome, is also explained by a net dephosphorylating activity of the pHTbar7 plasmids, we transformed the pHT7D718Q and pHT7H861L plasmids into the KSB837 wild-type strain. The Asp718Glu mutation completely abolished the dominant-negative activity of pHTbar7, but to our surprise no such effect could be seen with the His861Leu mutation (Table 4). To be able to explain how a dephosphorylating activity would function despite a disruption of the phosphoaccepting histidine in the H2 domain, we envisioned different models where the phosphate would be allowed to jump from the histidine of one sensor to the aspartate of an adjoined sensor (Fig. 4). In agreement with our experimental results, homodimers of pHTbar7 with either the aspartate or histidine mutated allow for no Asp-His-Asp phosphorelay (Fig. 4, models A and B). A heterodimer between a wild-type BarA protein and a pHTbar7 derivative with a disrupted histidine in the H2 domain would allow the phosphate to be retrieved from UvrY by the distal histidine in the wild-type BarA protein and then relayed to the aspartate in the adjoined pHTbar7 BarA protein (Fig. 4, model C). The phosphate is subsequently released from the D1 aspartate to the cytoplasm. On the other hand, a heterodimer where the pHTbar7 BarA partner has a disrupted aspartate would have no dephosphorylating activity, as the phosphoaccepting D1 aspartate would reside in the wild-type partner (Fig. 4, model D). As the wild-type partner does not have the linker mutation that blocks kinase activity and locks it in the "dephosphorylation mode," this aspartate is unable to accept the phosphate from the distal histidine (or, alternatively, unable to release it to the cytoplasm).

View larger version (31K): [in this window] [in a new window]

FIG. 4. Models for reversed phosphorelay in the BarA-UvrY system. The dimerized tripartite BarA protein and the UvrY protein are shown with the conserved histidines (H) and aspartates (D) indicated. Mutated amino acids are shown in bold type (glutamine [Q] and leucine [L]). Encircled crosses indicate the HAMP linker mutation described in the text that block the stimulatory signal and confer the dominant-negative effect in pHTbar7. Models A and B show homodimers of the dominant-negative pHTbar7 protein with either the aspartate or distal histidine disrupted, respectively, does not allow dephosphorylating activity, as there is no His(H2)-Asp(D1) pathway available. Model C, showing a heterodimer between a wild-type BarA protein and the pHTbar7 protein with a disrupted histidine, does allow for dephosphorylating activity, as the receiving aspartate is in the dominant-negative BarA protein and thus can release the phosphate. Model D, showing a heterodimer between wild-type BarA and a dominant-negative BarA mutant with a disrupted aspartate, allows for no dephosphorylating activity, as the receiving aspartate is in the wild-type protein that is in an activated mode. Model E, showing a heterodimer between two dominant-negative BarA proteins, one having the aspartate and the other with the histidine disrupted, allows for dephosphorylating activity. These models have been tested experimentally in Table 4. Our results, taken together with other data (9, 13), indicate that BarA forms dimers regardless of whether it is in a kinase or dephosphorylating mode and that both subunits of the dimer participate in a single phosphorylation or dephosphorylation event. This is summarized in model F, showing a dimer of the HAMP linker-mutated dominant-negative sensors, and in models G and H with dimers of two wild-type sensors in the dephosphorylating and kinase mode, respectively.

To provide evidence for such a model with phosphorelay between the two subunits of a sensor dimer, we created a cell where BarA heterodimers could be formed with one partner having the aspartate and the other having the distal histidine disrupted (Fig. 4, model E). We first transferred the mutated barA gene from pHT7D718Q into pBR322 to create pBR7D718Q, followed by coexpression of pBR7D718Q and pHT7H861L in the KSB837 barA mutant, such that the "histidine"- and "aspartate"-mutated barA genes were expressed from different plasmids. Assuming that pBR322 has an approximately two times higher copy number than pACYC184, roughly half of the dimers should be such heterodimers exhibiting dephosphorylating activity and the rest inert homodimers of either kind. By treating the cells with glucose, we could clearly demonstrate that whereas the homodimers of either mutated BarA protein lack dephosphorylating activity, the heterodimer of the two mutated proteins clearly exhibited such activity (Table 4). In summary, the experiments demonstrated in vivo that phosphotransfer can occur within dimers of full-length tripartite two-component system sensors during dephosphorylation of the regulator.

Top Abstract Introduction Materials and Methods Results Discussion References

 
In this work we have genetically characterized the E. coli BarA-UvrY two-component system by complementation studies of chromosomal barA and uvrY mutations.

We found that complementation of a uvrY deletion mutant with the wild-type gene on a plasmid also worked in the absence of the BarA sensor, as has been reported for some other two-component systems, including the Salmonella UvrY homologue SirA (2). This shows that a high number of wild-type UvrY regulators can override the need for BarA-specific activation, thus indicating that regulation of UvrY protein levels may be of importance. Phosphorylation of regulators by their cognate sensors is believed to cause a conformational change that facilitates dimerization/multimerization and subsequent DNA binding. It is likely that overexpression of a regulator forces a shift in the equilibrium from a monomer to a multimer form, but it is worth noting that the phosphoaccepting aspartate 54 residue in UvrY is needed for this activation. This is in accordance with in vitro studies with the analogous ArcB-ArcA system, where unphosphorylated wild-type ArcA regulator bound to DNA when present in high concentrations but where a mutation of the phosphoaccepting residue made the ArcA protein unable to bind DNA at any concentration (15).

Growth in the presence of glucose or other carbohydrates caused an aspartate 54-dependent activation of the UvrY regulator. This was apparently mediated by acetyl phosphate accumulating after catabolism of the sugars, as we lost activation in an ackA-pta mutant and as we show that acetyl phosphate can phosphorylate purified UvrY in vitro. This is in agreement with earlier results linking acetyl phosphate with phosphorylation of some other regulators, including Salmonella SirA (18, 49).

Even if it remains to be shown that the effect of glucose on UvrY has a physiological relevance, it has provided us with a useful tool to analyze the function of the BarA sensor proteins. We also noted that the use of glucose-containing media in similar studies may have caused earlier misinterpretations (26, 40).

Expression of the barA gene on a plasmid consistently selected for mutated clones with an altered BarA activity. Overexpression of BarA and other tripartite sensors may well cause pleiotropic signaling effects that are deleterious for the cell and thus lead to selection of mutated clones. The fact that such mutations were generated even in a strain lacking the UvrY regulator (data not shown) suggests that this effect is mediated via cross talk of BarA with noncognate regulators. This would also explain why we have not detected any mutations in the reading frame of the uvrY gene when expressed from a plasmid. A similar inability to successfully complement with genes encoding tripartite sensors and effects on the chromosomal gene copy has been observed by other groups, but no molecular explanation has been provided (4, 17, 26, 40).

This is the first described example of a full-length dominant-negative clone of a tripartite sensor in vivo. Dominant-negative clones should have a selective advantage over null mutants in a plasmid population, as they will more effectively lower a deleterious activity expressed from the plasmids. An additional reason may be that dominant-negative barA clones phenotypically mimic a barA deletion mutant. Our earlier results show that a barA deletion mutant is rapidly enriched in a competition with the wild type in rich media (29).

Sequencing of the dominant-negative barA clones revealed point mutations in the linker region, situated between the membrane-anchored domain and the first transmitter domain. This implies that the mutations impede the conformational change induced by the recognition of the stimulus and thus block the kinase activity of the sensor. The linker region of BarA contains a conserved HAMP linker motif (3) in addition to what has been suggested to be a possible PAS domain (36), both of which are motifs implied in signal transduction via intramolecular conformational changes. The fact that the described point mutations in the linker region have a striking effect on the activity of the BarA sensor supports the previous suggestion made by Appleman et al. that BarA contains a functional HAMP linker that transmits a signal between the periplasmic domain (sensory input module) and the H1 transmitter domain of BarA (output module) (3).

Two-component sensors are generally thought to be capable of having both a kinase and a dephosphorylating activity on their cognate regulators. If the mutations were to inhibit the kinase activity and render the sensors a net dephosphorylating activity, it would easily explain the dominant-negative effect of the mutated sensors. This dephosphorylating activity could be verified with the glucose-mediated system, which allowed us to analyze the mutated BarA proteins in the absence of the wild-type BarA sensor in vivo. In accordance with this model, we could show that disruption of either the putative phosphoaccepting His861 or Asp718 in the BarA sensor abolished the dephosphorylating activity. We were also able to demonstrate that dephosphorylating activity was regained if we allowed heterodimers to be formed between a sensor with a disrupted His861 and a disrupted Asp718. The only molecular explanation we can envision is that the phosphate is relayed from UvrY, via the intact histidine in the H2 domain, to the intact aspartate in the D1 receiver domain of the adjoined BarA protein.

This demonstrates that a His-Asp phosphorelay between two subunits of a sensor dimer is possible with full-length tripartite sensors in vivo. Some earlier in vitro experiments may be interpreted in support of a model where the phosphate can be relayed between two tripartite sensors. Firstly, radiolabeled phosphate can be transferred from the ArcB H2 domain to the intact full-length ArcB protein (13), and secondly, radiolabeled ArcA can be dephosphorylated with a mixture of the D1 and H2 domains of ArcB (8).

The results thus argue against a model for BarA where the His-Asp dephosphorylation activity is inferred to occur within one single sensor protein. The results also strengthen a model where tripartite sensors can be organized as dimers regardless of whether they are in a kinase or dephosphorylating mode.

Mutations rendering sensors dominant negative in simple sensors have also been reported and led to the demonstration of a dephosphorylating activity in vivo (35). The concept of a dephosphorylating activity of simple sensors is disputed, however, as recent data suggest that direct dephosphorylation of OmpR-P by EnvZ might occur only in vitro and that an additional factor is required for dephosphorylation in vivo (21). The difficulty of faithfully reproducing these processes in vitro has also been exemplified by the fact that the HAMP linker-containing EnvZ sensors, which are dominant negative in vivo, seem to lose this feature when solubilized from the membrane and analyzed in vitro (35). It is likely that the linker domains mediate conformational changes of the sensor protein and that such changes are dependent on a correct interaction with the membrane.

One key to a better understanding of the BarA-UvrY system is the identification of the physiological stimulus of the BarA sensor. We hope that our isolation of mutants with a trapped signal transduction will be useful tools in this search.

 
This work was supported by grants from the Swedish Research Council and, in part, by grants from DGAPA-PAPIIT, UNAM (IN218902), and CONACyT (37342-N).

 
* Corresponding author. Mailing address: Microbiology and Tumorbiology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden. Phone: 46-84572414. Fax: 46-8302566. E-mail: ojar.melefors{at}mtc.ki.se.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Agladze, K., D. Jackson, and T. Romeo. 2003. Periodicity of cell attachment patterns during Escherichia coli biofilm development. J. Bacteriol. 185:5632-5638.[Abstract/Free Full Text]
2
2. Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham, and R. Maurer. 2000. Characterization of two novel regulatory genes affecting Salmonella invasion gene expression. Mol. Microbiol. 35:635-646.[CrossRef][Medline]
3
3. Appleman, J. A., and V. Stewart. 2003. Mutational analysis of a conserved signal-transducing element: the HAMP linker of the Escherichia coli nitrate sensor NarX. J. Bacteriol. 185:89-97.[Abstract/Free Full Text]
4
4. Castaneda, M., J. Guzman, S. Moreno, and G. Espin. 2000. The GacS sensor kinase regulates alginate and poly-ß-hydroxybutyrate production in Azotobacter vinelandii. J. Bacteriol. 182:2624-2628.[Abstract/Free Full Text]
5
5. Chang, D. E., S. Shin, J. S. Rhee, and J. G. Pan. 1999. Acetate metabolism in a pta mutant of Escherichia coli W3110: importance of maintaining acetyl coenzyme A flux for growth and survival. J. Bacteriol. 181:6656-6663.[Abstract/Free Full Text]
6
6. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
7
7. Dubey, A. K., C. S. Baker, K. Suzuki, A. D. Jones, P. Pandit, T. Romeo, and P. Babitzke. 2003. CsrA regulates translation of the Escherichia coli carbon starvation gene, cstA, by blocking ribosome access to the cstA transcript. J. Bacteriol. 185:4450-4460.[Abstract/Free Full Text]
8
8. Georgellis, D., O. Kwon, P. De Wulf, and E. C. Lin. 1998. Signal decay through a reverse phosphorelay in the Arc two-component signal transduction system. J. Biol. Chem. 273:32864-32869.[Abstract/Free Full Text]
9
9. Georgellis, D., A. S. Lynch, and E. C. C. Lin. 1997. In vitro phosphorylation study of the Arc two-component signal transduction system of Escherichia coli. J. Bacteriol. 179:5429-5435.[Abstract/Free Full Text]
10
10. Gudapaty, S., K. Suzuki, X. Wang, P. Babitzke, and T. Romeo. 2001. Regulatory interactions of Csr components: the RNA binding protein CsrA activates csrB transcription in Escherichia coli. J. Bacteriol. 183:6017-6027.[Abstract/Free Full Text]
11
11. Heeb, S., and D. Haas. 2001. Regulatory roles of the GacS/GacA two-component system in plant-associated and other gram-negative bacteria. Mol. Plant-Microbe Interact. 14:1351-1363.[Medline]
12
12. Hoch, J. A. 2000. Two-component and phosphorelay signal transduction. Curr. Opin. Microbiol. 3:165-170.[CrossRef][Medline]
13
13. Ishige, K., S. Nagasawa, S. Tokishita, and T. Mizuno. 1994. A novel device of bacterial signal transducers. EMBO J. 13:5195-5202.[Medline]
14
14. Jackson, D. W., J. W. Simecka, and T. Romeo. 2002. Catabolite repression of Escherichia coli biofilm formation. J. Bacteriol. 184:3406-3410.[Abstract/Free Full Text]
15
15. Jeon, Y., Y. S. Lee, J. S. Han, J. B. Kim, and D. S. Hwang. 2001. Multimerization of phosphorylated and non-phosphorylated ArcA is necessary for the response regulator function of the Arc two-component signal transduction system. J. Biol. Chem. 276:40873-40879.[Abstract/Free Full Text]
16
16. Jourlin, C., M. Ansaldi, and V. Mejean. 1997. Transphosphorylation of the TorR response regulator requires the three phosphorylation sites of the TorS unorthodox sensor in Escherichia coli. J. Mol. Biol. 267:770-777.[CrossRef][Medline]
17
17. Jourlin, C., A. Bengrine, M. Chippaux, and V. Mejean. 1996. An unorthodox sensor protein (TorS) mediates the induction of the tor structural genes in response to trimethylamine N-oxide in Escherichia coli. Mol. Microbiol. 20:1297-1306.[CrossRef][Medline]
18
18. Lawhon, S. D., R. Maurer, M. Suyemoto, and C. Altier. 2002. Intestinal short-chain fatty acids alter Salmonella typhimurium invasion gene expression and virulence through BarA/SirA. Mol. Microbiol. 46:1451-1464.[CrossRef][Medline]
19
19. Matsubara, M., and T. Mizuno. 1999. EnvZ-independent phosphotransfer signaling pathway of the OmpR-mediated osmoregulatory expression of OmpC and OmpF in Escherichia coli. Biosci. Biotechnol. Biochem. 63:408-414.[CrossRef][Medline]
20
20. Matsushita, M., and K. D. Janda. 2002. Histidine kinases as targets for new antimicrobial agents. Bioorg. Med. Chem. 10:855-867.[CrossRef][Medline]
21
21. Mattison, K., and L. J. Kenney. 2002. Phosphorylation alters the interaction of the response regulator OmpR with its sensor kinase EnvZ. J. Biol. Chem. 277:11143-11148.[Abstract/Free Full Text]
22
22. McCleary, W. R., and J. B. Stock. 1994. Acetyl phosphate and the activation of two-component response regulators. J. Biol. Chem. 269:31567-31572.[Abstract/Free Full Text]
23
23. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
24
24. Mizuno, T. 1997. Compilation of all genes encoding two-component phosphotransfer signal transducers in the genome of Escherichia coli. DNA Res. 4:161-168.[Abstract]
25
25. Moolenaar, G. F., C. A. van Sluis, C. Backendorf, and P. van de Putte. 1987. Regulation of the Escherichia coli excision repair gene uvrC. Overlap between the uvrC structural gene and the region coding for a 24 kD protein. Nucleic Acids Res. 15:4273-4289.[Abstract/Free Full Text]
26
26. Mukhopadhyay, S., J. P. Audia, R. N. Roy, and H. E. Schellhorn. 2000. Transcriptional induction of the conserved alternative sigma factor RpoS in Escherichia coli is dependent on BarA, a probable two-component regulator. Mol. Microbiol. 37:371-381.[CrossRef][Medline]
27
27. Nagasawa, S., S. Tokishita, H. Aiba, and T. Mizuno. 1992. A novel sensor-regulator protein that belongs to the homologous family of signal-transduction proteins involved in adaptive responses in Escherichia coli. Mol. Microbiol. 6:799-807.[Medline]
28
28. Pena-Sandoval, G. R., O. Kwon, and D. Georgellis. 2005. Requirement of the receiver and phosphotransfer domains of ArcB for efficient dephosphorylation of phosphorylated ArcA in vivo. J. Bacteriol. 187:3267-3272.[Abstract/Free Full Text]
29
29. Pernestig, A. K., D. Georgellis, T. Romeo, K. Suzuki, H. Tomenius, S. Normark, and O. Melefors. 2003. The Escherichia coli BarA-UvrY two-component system is needed for efficient switching between glycolytic and gluconeogenic carbon sources. J. Bacteriol. 185:843-853.[Abstract/Free Full Text]
30
30. Pernestig, A. K., O. Melefors, and D. Georgellis. 2001. Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichia coli. J. Biol. Chem. 276:225-231.[Abstract/Free Full Text]
31
31. Prouty, A. M., and J. S. Gunn. 2000. Salmonella enterica serovar Typhimurium invasion is repressed in the presence of bile. Infect. Immun. 68:6763-6769.[Abstract/Free Full Text]
32
32. Rahme, L. G., F. M. Ausubel, H. Cao, E. Drenkard, B. C. Goumnerov, G. W. Lau, S. Mahajan-Miklos, J. Plotnikova, M. W. Tan, J. Tsongalis, C. L. Walendziewicz, and R. G. Tompkins. 2000. Plants and animals share functionally common bacterial virulence factors. Proc. Natl. Acad. Sci. USA 97:8815-8821.[Abstract/Free Full Text]
33
33. Rodriguez, C., O. Kwon, and D. Georgellis. 2004. Effect of D-lactate on the physiological activity of the ArcB sensor kinase in Escherichia coli. J. Bacteriol. 186:2085-2090.[Abstract/Free Full Text]
34
34. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol. Microbiol. 29:1321-1330.[CrossRef][Medline]
35
35. Russo, F. D., and T. J. Silhavy. 1991. EnvZ controls the concentration of phosphorylated OmpR to mediate osmoregulation of the porin genes. J. Mol. Biol. 222:567-580.[CrossRef][Medline]
36
36. Sahu, S. N., S. Acharya, H. Tuminaro, I. Patel, K. Dudley, J. E. LeClerc, T. A. Cebula, and S. Mukhopadhyay. 2003. The bacterial adaptive response gene, barA, encodes a novel conserved histidine kinase regulatory switch for adaptation and modulation of metabolism in Escherichia coli. Mol. Cell. Biochem. 253:167-177.[CrossRef][Medline]
37
37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
38
38. Stadtman, E. R. 1957. Preparation and assay of acetyl P. Methods Enzymol. 3:228-231.
39
39. Stephenson, K., and J. A. Hoch. 2002. Two-component and phosphorelay signal-transduction systems as therapeutic targets. Curr. Opin. Pharmacol. 2:507-512.[CrossRef][Medline]
40
40. Suzuki, K., X. Wang, T. Weilbacher, A. K. Pernestig, O. Melefors, D. Georgellis, P. Babitzke, and T. Romeo. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. J. Bacteriol. 184:5130-5140.[Abstract/Free Full Text]
41
41. Teplitski, M., R. I. Goodier, and B. M. Ahmer. 2003. Pathways leading from BarA/SirA to motility and virulence gene expression in Salmonella. J. Bacteriol. 185:7257-7265.[Abstract/Free Full Text]
42
42. Tsuzuki, M., K. Ishige, and T. Mizuno. 1995. Phosphotransfer circuitry of the putative multi-signal transducer, ArcB, of Escherichia coli: in vitro studies with mutants. Mol. Microbiol. 18:953-962.[CrossRef][Medline]
43
43. Uhl, M. A., and J. F. Miller. 1996. Integration of multiple domains in a two-component sensor protein: the Bordetella pertussis BvgAS phosphorelay. EMBO J. 15:1028-1036.[Medline]
44
44. Uzan, M., and A. Danchin. 1976. A rapid test for the relA mutation in E. coli. Biochem. Biophys. Res. Commun. 69:751-758.[CrossRef][Medline]
45
45. Wang, X., A. K. Dubey, K. Suzuki, C. S. Baker, P. Babitzke, and T. Romeo. 2005. CsrA post-transcriptionally represses pgaABCD, responsible for synthesis of a biofilm polysaccharide adhesin of Escherichia coli. Mol. Microbiol. 56:1648-1663.[Medline]
46
46. Wei, B. L., A. M. Brun-Zinkernagel, J. W. Simecka, B. M. Pruss, P. Babitzke, and T. Romeo. 2001. Positive regulation of motility and flhDC expression by the RNA-binding protein CsrA of Escherichia coli. Mol. Microbiol. 40:245-256.[CrossRef][Medline]
47
47. Weilbacher, T., K. Suzuki, A. K. Dubey, X. Wang, S. Gudapaty, I. Morozov, C. S. Baker, D. Georgellis, P. Babitzke, and T. Romeo. 2003. A novel sRNA component of the carbon storage regulatory system of Escherichia coli. Mol. Microbiol. 48:657-670.[CrossRef][Medline]
48
48. Wolanin, P. M., P. A. Thomason, and J. B. Stock. 25 September 2002, posting date. Histidine protein kinases: key signal transducers outside the animal kingdom. Genome Biol. 3:REVIEWS3013. [Online.] http://genomebiology.com/2002/3/10/REVIEWS/3013.
49
49. Wolfe, A. J. 2005. The acetate switch. Microbiol. Mol. Biol. Rev. 69:12-50.[Abstract/Free Full Text]

---

Journal of Bacteriology, November 2005, p. 7317-7324, Vol. 187, No. 21
0021-9193/05/$08.00+0     doi:10.1128/JB.187.21.7317-7324.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Busch, A., Guazzaroni, M.-E., Lacal, J., Ramos, J. L., Krell, T. (2009). The Sensor Kinase TodS Operates by a Multiple Step Phosphorelay Mechanism Involving Two Autokinase Domains. J. Biol. Chem. 284: 10353-10360 [Abstract] [Full Text]  
• Kishii, R., Falzon, L., Yoshida, T., Kobayashi, H., Inouye, M. (2007). Structural and Functional Studies of the HAMP Domain of EnvZ, an Osmosensing Transmembrane Histidine Kinase in Escherichia coli. J. Biol. Chem. 282: 26401-26408 [Abstract] [Full Text]  
• Mondragon, V., Franco, B., Jonas, K., Suzuki, K., Romeo, T., Melefors, O., Georgellis, D. (2006). pH-Dependent Activation of the BarA-UvrY Two-Component System in Escherichia coli. J. Bacteriol. 188: 8303-8306 [Abstract] [Full Text]  
• Teplitski, M., Al-Agely, A., Ahmer, B. M. M. (2006). Contribution of the SirA regulon to biofilm formation in Salmonella enterica serovar Typhimurium.. Microbiology 152: 3411-3424 [Abstract] [Full Text]  
• Herren, C. D., Mitra, A., Palaniyandi, S. K., Coleman, A., Elankumaran, S., Mukhopadhyay, S. (2006). The BarA-UvrY Two-Component System Regulates Virulence in Avian Pathogenic Escherichia coli O78:K80:H9.. Infect. Immun. 74: 4900-4909 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tomenius, H. Articles by Melefors, O. Search for Related Content PubMed PubMed Citation Articles by Tomenius, H. Articles by Melefors, O.