This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bardy, S. L.
Right arrow Articles by Maddock, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bardy, S. L.
Right arrow Articles by Maddock, J. R.

 Previous Article  |  Next Article 

Journal of Bacteriology, November 2005, p. 7840-7844, Vol. 187, No. 22
0021-9193/05/$08.00+0     doi:10.1128/JB.187.22.7840-7844.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Polar Localization of a Soluble Methyl-Accepting Protein of Pseudomonas aeruginosa

Sonia L. Bardy and Janine R. Maddock*

Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, Michigan 48109

Received 13 July 2005/ Accepted 31 August 2005


arrow
ABSTRACT
 
A soluble methyl-accepting chemotaxis protein (MCP) of Pseudomonas aeruginosa, McpS, showed polar localization by immunofluorescence microscopy. Overexpression of McpS resulted in a dominant-negative effect on chemotaxis and caused a loss of polar clustering of the general MCP population. The polar localization of a soluble MCP defines a third, and unexpected, paradigm for cellular MCP localization.


arrow
TEXT
 
Specific cellular localization of proteins is often critical for proper function and interaction with required partners (15). One striking example in bacteria is the localization of proteins involved in chemotaxis. To date, two different paradigms for the spatial organization of chemotaxis proteins have been reported: polar localization (14, 17) and both polar and cytosolic localization (7, 29). Escherichia coli exemplifies a relatively simple system, wherein the four different membrane-localized methyl-accepting chemotaxis proteins (MCPs), together with the soluble CheA and CheW proteins, cluster predominantly at the cell poles (17). In E. coli it appears that the chemotaxis proteins work cooperatively to generate a unified signal that coordinates the direction of flagellar rotation. Many other bacteria, however, possess numerous MCPs, including both membrane-bound and soluble species. In the case of Rhodobacter sphaeroides the membrane MCPs are found in clusters at the cell poles, whereas the MCPs that lack transmembrane domains are found in internal clusters (7, 27, 29). Interestingly, R. sphaeroides possesses multiple CheA and CheW proteins, and these are also spatially distinct; they are found either in polar or cytoplasmic clusters (18, 29). Thus, in R. sphaeroides the MCPs appear to be sequestered to spatially, and perhaps functionally, distinct cellular locations (29). Regardless of the type of localization, however, in all cases examined thus far, both CheA and CheW are required for optimal clustering of the MCPs (17, 24, 25). Interestingly, clustering of the chemoreceptors is not necessary for polarity of membrane-bound MCP (16), although it is thought to play a role in signal amplification and gain (3).

Pseudomonas aeruginosa is an opportunistic pathogen that is motile either through the use of a single polar flagellum (5) or by twitching via type IV pili (20). In the genome of P. aeruginosa, there are five loci containing clusters of chemotaxis-like genes (Cluster I to Cluster V) (6). Cluster I and Cluster V are involved in chemotaxis (19, 26), Cluster III is involved in the regulation and function of type IV pili and twitching motility (30), and Cluster IV is involved in autoaggregation (4). The function of Cluster II remains unclear, although one of the encoded MCPs (Pa0176; McpB [6], also referred to as Aer-2 [8, 10] or TlpG [9]) is involved in aerotaxis (9). The P. aeruginosa genome encodes 26 MCPs. Three of these (Pa0176, Pa1423, and Pa1930) appear to lack transmembrane domains (http://www.Pseudomonas.com) and, therefore, are predicted to be soluble. In this study, we examined the localization of Pa1930, hereafter known as McpS. Contrary to our expectations, McpS was not found in internal clusters but was at the cell poles, indicating that the spatial distribution of chemotaxis proteins in P. aeruginosa represents a third type of localization pattern.

McpS plays a role in chemotaxis. As is typical for most bacteria with numerous mcp genes, the majority of the P. aeruginosa mcp genes (22 out of 26), including mcpS, are not found in chemotaxis operons, and the majority of these are monocistronic. McpS is a 431-amino-acid protein with a conserved signaling domain and predicted methylation sites. It lacks a CheR binding motif at its C terminus.

The N terminus of McpS encodes two putative PAS domains. PAS domains are found in a wide range of proteins, including numerous MCPs, that are involved in light, oxygen, and redox sensing (31). There are three additional P. aeruginosa MCPs with PAS domains: Pa1561, Pa1423, and Pa0176. Pa1561 is the homologue of the E. coli Aer protein (9). Both Pa1561 and the predicted soluble MCP Pa0176 have previously been shown to be involved in aerotaxis (9). Pa1423 is also predicted to be soluble, but no function has been identified for this putative MCP.

The relative stoichiometries of the MCPs, CheA, and CheW are important for generation of functional chemoreceptor complexes (12). In E. coli, overexpression of either CheW (23) or an MCP (13) results in a reduction in chemotaxis due to an imbalance in the ratio of these interacting proteins. To determine whether McpS was involved in chemotaxis, we chose to examine the consequences of its overexpression. mcpS was amplified by PCR using primers Pa1930For (5'GGAATTCCATATGCTCTTCGGCAGAAAAAGC3') and Pa1930 Rev (5'CCCAAGCTTCTTGAACAGGCTCGACACC3') and cloned into an NdeI/HindIII-digested derivative of pJN105 (21) modified to contain the ribosome binding site and His tag from pET28 (Novagen). The resulting plasmid (pSB46) has an N-terminal His-tagged mcpS under control of the pBAD promoter. pSB46 was transformed into wild-type P. aeruginosa PAO1 (Iglewski strain [11]) and induced with various concentrations of arabinose (Fig. 1A), resulting in expression of a product that migrated near the predicted molecular mass of McpS (47.8 kDa). The expression of McpS was titratable with arabinose concentration. PAO1(pSB46) transformants were tested for chemotactic ability by migration in soft agar in the presence or absence of arabinose. PAO1 cells harboring the control vector (pJN105) (Fig. 1B) migrated in soft-agar plates similar to wild-type cells (data not shown), regardless of whether the medium contained arabinose. In contrast, PAO1 cells expressing His-McpS showed a decrease in swarm size that correlated with the concentration of arabinose (hence, His-McpS expression) in the medium (Fig. 1B). Growth in liquid broth was identical for PAO1 cells alone or those harboring control vector (pJN105) or pSB46 with or without arabinose (data not shown), demonstrating that the differences observed on swarm plates are not due to differences in overall growth rate. Thus, overexpression of McpS inhibits chemotaxis.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. Overexpression of His-McpS in P. aeruginosa. (A) Immunoblot showing induction of His-McpS with arabinose. Whole-cell lysates of PAO1(pJN105) or PAO1(pSB46) (His-McpS) grown in the presence of increasing amounts of arabinose. Following 1 h of induction with the indicated arabinose concentration, cells were grown in Luria-Bertani medium at 30°C and harvested at an approximate optical density at 600 nm of 0.4. His-McpS was detected using a 1/2,000 dilution of anti-His antibody (Sigma) followed by rabbit anti-mouse secondary antibody (Pierce). Relevant molecular masses are shown (in kilodaltons). (B) Overexpression of His-McpS inhibits motility on swarm agar plates. The migration of PAO1 harboring an empty vector (pJN105; black) and two clones of PAO1(pSB46) (white and gray) on soft-agar tryptone broth plates supplemented with 50 µg · ml–1 gentamicin and indicated levels of arabinose were measured after 18 h at 30°C. The average diameters (in centimeters) from five independent measurements (± standard errors of the means) are shown. (C) Overexpression of His-McpS does not inhibit twitching motility. The migration of PAO1 harboring an empty vector (pJN105; black) and two clones of PAO1 harboring pSB46 (His-McpS) (white and gray) were measured. Cells were inoculated with toothpicks into LB plates containing 1% (wt/vol) agar supplemented with 50 µg · ml–1 gentamicin and indicated levels of arabinose and incubated for 24 h at 37°C. The average diameters of migration (in centimeters) from five independent measurements (± standard errors of the means) are shown.

To determine if the motility defect that resulted from overexpression of His-McpS was specific to swimming motility, twitching assays were performed using the subsurface agar stab method (1). After 24 h of incubation at 37°C, the size of the twitching zone was measured. The overexpression of His-McpS did not have an effect on twitching motility relative to the PAO1 cells harboring a vector control (Fig. 1C). Thus, McpS appears to specifically affect swimming motility. These results are in agreement with previous studies that indicate that cross-talk does not occur between the different motility systems. For example, a transposon mutation in Pa0411 (located within cluster III) inhibits twitching but not swimming motility, consistent with a role of Pa0411 in twitching motility only (30). We predict that in P. aeruginosa, cross-talk does not occur between the chemoreceptors from different motility systems, a conclusion also reached by studies with R. sphaeroides (18).

His-McpS localizes to the cell poles. Because it lacks transmembrane domains, we expected to find McpS localized in cytosolic clusters, as we and others have previously demonstrated for the soluble MCPs in R. sphaeroides (7, 28). To provide evidence for the existence of internal clusters, we examined the location of all MCPs that cross-reacted with an antibody raised to the highly conserved domain of the E. coli Tsr protein (2). This antibody cross-reacts with all four E. coli MCPs (14) and with both soluble and polar MCPs from R. sphaeroides (7). In P. aeruginosa, the anti-Tsr antibody reveals multiple cross-reacting bands by an immunoblotting that migrated to larger than 50 kDa, suggesting that anti-Tsr does not recognize McpS (data not shown). We used this antibody to localize the cross-reacting receptors in PAO1 by immunofluorescence, as previously described (17), scoring 160 cells for the cellular location of the fluorescent foci. The majority of the bright fluorescent signal was in one or more foci that were predominantly located at the cell poles (Fig. 2), a distribution markedly similar to that seen in E. coli (17). We monitored the position of the foci in cells with nonoverlapping foci and found that 100% were associated with the membrane, and 97% of these were at a cell pole. All of the polar signal was found in tight foci (100%), a characteristic of clustered E. coli MCPs, as monitored by immunoelectron microscopy (17). Similar results were seen in PAO1 cells harboring the pJN105 vector (data not shown). Therefore, we conclude that the receptors visualized with the anti-Tsr antibody are clustered at the cell poles.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 2. Cellular localization of His-McpS through fractionation. PAO1 cells expressing His-McpS were lysed by three passages through a French press. Centrifugation at 8,000 x g removed debris, and membranes were pelleted by centrifugation at 180,000 x g for 1 h. Lane markings are as follows: D, debris; S, soluble fraction; M, membrane fraction. Similar results were seen for cells induced under low- and high-induction conditions (0.01% and 0.1% arabinose, respectively); only higher induction conditions are shown here. Relevant molecular masses are shown (in kilodaltons).

To specifically determine the cellular location of McpS, we used two distinct approaches. Cells expressing His-McpS were fractionated, and the fractions were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and probed with anti-His antibody. His-McpS was found in the soluble fraction (Fig. 2). This parallels the cellular fractionation studies done on CheA and CheW, soluble components of the polar chemotaxis protein complex in E. coli (22). We also monitored the intracellular position of His-McpS using a polyclonal antibody that recognizes the polyhistidine sequence (a gift from K. Datta). The anti-His antibody did not reveal significant fluorescence in PAO1 (Fig. 2) or PAO1 harboring pJN105 (data not shown). In contrast, PAO1 cells expressing His-McpS induced with 0.01% arabinose showed distinct fluorescence. We noted both bright and dim foci in these cells. In general, the brighter foci were polar, whereas the dimmer foci appeared to be randomly localized to both the lateral membrane and cytosol. The dim foci, however, are masked when merged with the 4',6'-diamidino-2-phenylindole stain images as shown in Fig. 3. We monitored the distribution of all foci in these cells (bright and dim) and found that 62% were polar, and 98% of these polar foci had the appearance of clustered MCPs. The majority of the nonpolar foci were dim and associated with the lateral membrane. Thus, in contrast to our expectations, the soluble MCP, McpS, is found predominately in clusters at the cell pole. Because the majority of the receptor signal is also at the cell poles, one possibility is that McpS is in clusters with membrane-bound MCPs. To confirm that the polar localization of His-McpS was not due to the formation of inclusion bodies, cells expressing His-McpS were embedded and thin sectioned, and 100 cell ends were examined by electron microscopy. No inclusion bodies were found (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3. Localization of general MCPs and His-McpS by immunofluorescence in PAO1 and PAO1 harboring His-McpS. The general population of MCPs (as detected with anti-Tsr antibodies) localize to the poles of wild-type and vector control cells. Increasing expression of His-McpS in PAO1 results in a decrease in the clustering the general MCP population while having a minimal effect on the polar localization or clustering of His-McpS.

Overexpression of McpS disrupts the polar clustering of cellular receptors. As described above, overexpression of McpS results in a dose-dependent negative effect on chemotaxis. Given that a significant amount of His-McpS was found at the cell poles, one possibility is that overexpression of McpS interferes with chemotaxis by increasing the total levels of MCPs in the cell such that the relative intracellular levels of the MCPs, CheA, and CheW are unbalanced. Since, in E. coli, MCPs form clusters with CheW and CheA in a consistent ratio (12), we expect the same principal to apply to MCP clustering in P. aeruginosa. Therefore, we predict that if McpS exists in polar clusters with membrane-bound MCPs, CheA, and CheW, there would be a reduction in the level of general MCP clustering in cells overexpressing His-McpS. To test this prediction we examined the localization of the MCPs in PAO1 expressing His-McpS at increasing levels. When His-McpS is modestly expressed (0.01% arabinose) at a level that slightly affects chemotaxis (Fig. 1B), localization of cross-reacting MCPs is slightly affected (88% polar, compared to 97% without induction) and the foci are less bright and slightly more diffuse (Fig. 3). A further increase in His-McpS, however, resulted in a significant delocalization of the cellular MCPs (Fig. 3). In the presence of 0.1% arabinose, although many cells showed a polar bias the MCP signal was very diffuse, often distributed over the entire cell pole (Fig. 3). Thus, overexpression of the soluble McpS protein disrupted the polar receptor clusters, consistent with a model whereby McpS is in the same macromolecular complex as the membrane-bound MCPs.

Interestingly, it appears that His-McpS retained significant polar clustering under the same induction conditions that resulted in the dissociation of the general MCP clusters. In the presence of 0.1% arabinose, many cells possessed McpS clusters, as visualized by the presence of discreet fluorescent foci. Multiple dim nonpolar foci are also observed. Curiously, under these overexpression conditions, McpS clustered to a greater extent (either polar or nonpolar) than the general MCP population in the cell, as detected by the anti-Tsr antibody.

Conclusions. We present here an unexpected third paradigm for the localization of methyl-accepting chemotaxis proteins. Unlike the cytosolic localization of soluble MCPs in R. sphaeroides, at least one soluble MCP in P. aeruginosa, McpS, localizes to the cell poles. We predict that McpS is anchored to the cell pole membrane through intimate contact with classical transmembrane MCPs in a higher order structure. Overexpression of this soluble MCP had a dose-dependent negative effect on both chemotaxis and clustering of the polar MCPs, providing compelling evidence that McpS is a component of the polar macromolecular structure with the transmembrane MCPs, CheW, and CheA. Additionally, it appears that the His-McpS MCP remains in clusters under conditions that result in the loss of general MCP clustering. One possible explanation is that His-McpS has a strong affinity for CheA and CheW and remains in higher order complexes under conditions of MCP excess. These models are currently under investigation.


arrow
ACKNOWLEDGMENTS
 
We are grateful to C. Harwood for strains and plasmids and to Sandy Parkinson and K. Datta for the anti-Tsr and anti-His antibodies, respectively. Thanks go to A. Chang for use of the fluorescent microscope. Warm thanks go to S. M. Sullivan for critical reading of the manuscript.

This research was supported by a grant (RSG-01-090-MBC) from the American Cancer Society to J.R.M.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Molecular, Cellular and Developmental Biology, University of Michigan, 830 N. University Ave., Ann Arbor, MI 48109. Phone: (734) 936-8068. Fax: (734) 647-0884. E-mail: maddock{at}umich.edu. Back


arrow
REFERENCES
 
    1
  1. Alm, R. A., and J. S. Mattick. 1995. Identification of a gene, pilV, required for type 4 fimbrial biogenesis in Pseudomonas aeruginosa, whose product possesses a pre-pilin-like leader sequence. Mol. Microbiol. 16:485-496.[CrossRef][Medline]
  2. 2
  3. Ames, P., and J. S. Parkinson. 1994. Constitutively signaling fragments of Tsr, the Escherichia coli serine chemoreceptor. J. Bacteriol. 176:6340-6348.[Abstract/Free Full Text]
  4. 3
  5. Bray, D. F., M. D. Levin, and C. J. Morton-Firth. 1998. Receptor clustering as a cellular mechanism to control sensitivity. Nature 393:85-88.[CrossRef][Medline]
  6. 4
  7. D'Argenio, D. A., M. W. Calfee, P. B. Rainey, and E. C. Pesci. 2002. Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J. Bacteriol. 184:6481-6489.[Abstract/Free Full Text]
  8. 5
  9. Doyle, T. B., A. C. Hawkins, and L. L. McCarter. 2004. The complex flagellar torque generator of Pseudomonas aeruginosa. J. Bacteriol. 186:6341-6350.[Abstract/Free Full Text]
  10. 6
  11. Ferrandez, A. C., A. C. Hawkins, D. T. Summerfield, and C. S. Harwood. 2002. Cluster II che genes from Pseudomonas aeruginosa are required for an optimal chemotactic response. J. Bacteriol. 184:4373-4383.
  12. 7
  13. Harrison, D. M., J. Skidmore, J. P. Armitage, and J. R. Maddock. 1999. Localization and environmental regulation of MCP-like proteins in Rhodobacter sphaeroides. Mol. Microbiol. 31:885-892.[CrossRef][Medline]
  14. 8
  15. Hong, C. S., A. Kuroda, T. Ikeda, N. Takiguchi, H. Ohtake, and J. Kato. 2004. The aerotaxis transducer gene aer, but not aer-2, is transcriptionally regulated by the anaerobic regulator ANR in Pseudomonas aeruginosa. J. Biosci. Bioeng. 97:184-190.[Medline]
  16. 9
  17. Hong, C. S., M. Shitashiro, A. Kuroda, T. Ikeda, N. Takiguchi, H. Ohtake, and J. Kato. 2004. Chemotaxis proteins and transducers for aerotaxis in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 231:247-252.[CrossRef][Medline]
  18. 10
  19. Hong, C. S., M. Shitashiro, A. Kuroda, T. Ikeda, N. Takiguchi, H. Ohtake, and J. Kato. 2005. Expression of Pseudomonas aeruginosa aer-2, one of two aerotaxis transducer genes, is controlled by RpoS. J. Bacteriol. 187:1533-1535.[Abstract/Free Full Text]
  20. 11
  21. Jacobs, M. A., A. Alwood, I. Thaipisuttikul, D. Spencer, E. Haugen, S. Ernst, O. Will, R. Kaul, C. Raymond, R. Levy, L. Chun-Rong, D. Guenthner, D. Bovee, M. V. Olson, and C. Manoil. 2003. Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 100:14339-14344.[Abstract/Free Full Text]
  22. 12
  23. Li, M., and G. L. Hazelbauer. 2004. Cellular stoichiometry of the components of the chemotaxis signaling complex. J. Bacteriol. 186:3687-3694.[Abstract/Free Full Text]
  24. 13
  25. Liu, J., and J. S. Parkinson. 1989. Role of CheW protein in coupling membrane receptors to the intracellular signaling system of bacterial chemotaxis. Proc. Natl. Acad. Sci. USA 86:8703-8707.[Abstract/Free Full Text]
  26. 14
  27. Lybarger, S. R., and J. R. Maddock. 2000. Differences in the polar clustering of the high- and low-abundance chemoreceptors of Escherichia coli. Proc. Natl. Acad. Sci. USA 97:8057-8062.[Abstract/Free Full Text]
  28. 15
  29. Lybarger, S. R., and J. R. Maddock. 2001. Polarity in action: asymmetrical protein localization in bacteria. J. Bacteriol. 183:3261-3267.[Free Full Text]
  30. 16
  31. Lybarger, S. R., U. Nair, A. A. Lilly, G. L. Hazelbauer, and J. R. Maddock. 2005. Clustering requires modified methyl-accepting sites in low abundance but not high abundance chemoreceptors of Escherichia coli. Mol. Microbiol. 56:1078-1086.[CrossRef][Medline]
  32. 17
  33. Maddock, J. R., and L. Shapiro. 1993. Polar location of the chemoreceptor complex in the Escherichia coli cell. Science 259:1717-1723.[Abstract/Free Full Text]
  34. 18
  35. Martin, A. C., G. H. Wadhams, and J. P. Armitage. 2001. The roles of multiple CheW and CheA homologues in chemotaxis and in chemoreceptor localization in Rhodobacter sphaeroides. Mol. Microbiol. 40:1261-1272.[CrossRef][Medline]
  36. 19
  37. Masduki, A., J. Nakamura, T. Ohga, R. Umezaki, J. Kato, and H. Ohtake. 1995. Isolation and characterization of chemotaxis mutants and genes of Pseudomonas aeruginosa. J. Bacteriol. 177:948-952.[Abstract/Free Full Text]
  38. 20
  39. Mattick, J. S. 2002. Type IV pili and twitching motility. Annu. Rev. Microbiol. 56:289-314.[CrossRef][Medline]
  40. 21
  41. Newman, J. R., and C. Fuqua. 1999. Broad host range expression vectors that carry the L-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227:197-203.[CrossRef][Medline]
  42. 22
  43. Ridgway, H. F., M. Silverman, and M. I. Simon. 1977. Localization of proteins controlling motility and chemotaxis in Escherichia coli. J. Bacteriol. 132:657-665.[Abstract/Free Full Text]
  44. 23
  45. Sanders, D. A., B. Mendez, and D. E. Koshland, Jr. 1989. Role of the CheW protein in bacterial chemotaxis: overexpression is equivalent to absence. J. Bacteriol. 171:6271-6278.[Abstract/Free Full Text]
  46. 24
  47. Skidmore, J. M., D. D. Ellefson, B. P. McNamara, M. M. Couto, A. J. Wolfe, and J. R. Maddock. 2000. Polar clustering of the chemoreceptor complex in Escherichia coli occurs in the absence of complete CheA function. J. Bacteriol. 182:967-973.[Abstract/Free Full Text]
  48. 25
  49. Sourjik, V., and H. C. Berg. 2000. Localization of components of the chemotaxis machinery of Escherichia coli using fluorescent protein fusions. Mol. Microbiol. 37:740-751.[CrossRef][Medline]
  50. 26
  51. Stover, C. K., X. Q. Pham, E. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, and I. T. Paulson. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959-964.[CrossRef][Medline]
  52. 27
  53. Wadhams, G. H., A. C. Martin, and J. P. Armitage. 2000. Identification and localization of a methyl-accepting chemotaxis protein in Rhodobacter sphaeroides. Mol. Microbiol. 36:1222-1233.[CrossRef][Medline]
  54. 28
  55. Wadhams, G. H., A. C. Martin, S. L. Porter, J. R. Maddock, J. C. Mantotta, H. M. King, and J. P. Armitage. 2002. TlpC, a novel chemotaxis protein in Rhodobacter sphaeroides, localizes to a discreet region in the cytoplasm. Mol. Microbiol. 46:1211-1221.[CrossRef][Medline]
  56. 29
  57. Wadhams, G. H., A. V. Warren, A. C. Martin, and J. P. Armitage. 2003. Targeting of two signal transduction pathways to different regions of the bacterial cell. Mol. Microbiol. 50:763-770.[CrossRef][Medline]
  58. 30
  59. Whitchurch, C. B., A. J. Leech, M. D. Young, D. Kennedy, J. L. Sargent, J. J. Bertrand, A. B. T. Semmler, A. S. Mellick, P. R. Martin, R. A. Alm, M. Hobbs, S. A. Beatson, B. Huang, L. Nguyen, J. C. Commollii, J. N. Engel, A. Darzins, and J. S. Mattick. 2004. Characterization of a complex chemosensory signal transduction system which controls twitching motility in Pseudomonas aeruginosa. Mol. Microbiol. 52:873-893.[CrossRef][Medline]
  60. 31
  61. Zhulin, I. B., B. L. Taylor, and R. Dixon. 1997. PAS domain S-boxes in Archaea, Bacteria and sensors for oxygen and redox. Trends Biochem. Sci. 22:331-333.[CrossRef][Medline]


Journal of Bacteriology, November 2005, p. 7840-7844, Vol. 187, No. 22
0021-9193/05/$08.00+0     doi:10.1128/JB.187.22.7840-7844.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Endoh, T., Engel, J. N. (2009). CbpA: a Polarly Localized Novel Cyclic AMP-Binding Protein in Pseudomonas aeruginosa. J. Bacteriol. 191: 7193-7205 [Abstract] [Full Text]  
  • Meier, V. M., Scharf, B. E. (2009). Cellular Localization of Predicted Transmembrane and Soluble Chemoreceptors in Sinorhizobium meliloti. J. Bacteriol. 191: 5724-5733 [Abstract] [Full Text]  
  • Mauriello, E. M. F., Astling, D. P., Sliusarenko, O., Zusman, D. R. (2009). Localization of a bacterial cytoplasmic receptor is dynamic and changes with cell-cell contacts. Proc. Natl. Acad. Sci. USA 106: 4852-4857 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bardy, S. L.
Right arrow Articles by Maddock, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bardy, S. L.
Right arrow Articles by Maddock, J. R.