Previous Article | Next Article ![]()
Journal of Bacteriology, December 2005, p. 8081-8087, Vol. 187, No. 23
0021-9193/05/$08.00+0 doi:10.1128/JB.187.23.8081-8087.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Department of Biology, Indiana University, Bloomington, Indiana 47405
Received 23 May 2005/ Accepted 13 September 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Although there are undoubtedly multiple proteins required for proper assembly and function of cytochrome c oxidases, few have been well defined. Directly downstream from the cbb3 oxidase structural genes is the ccoGHIS operon that encodes for various components required proper assembly of a functional cytochrome c oxidase (14). Specifically CcoI is believed to be required for acquisition of copper and CcoS for acquisition of prosthetic groups.
An additional oxidase assembly factor that is involved in both mitochondrial and bacterial respiration is ScoI. Disruption of ScoI in yeast and human cells leads to rapid degradation of the CoxI subunit of cytochrome c oxidase that contains the CuA site (15, 20, 23). Since ScoI binds copper, it has been proposed that ScoI may be functioning as a copper chaperone that is responsible for delivering copper to the CuA site in the CoxI subunit (9). In support of this hypothesis is the presence of a 100% conserved copper-binding motif CXXXC in all ScoI homologs. Alternatively, it has also been proposed that ScoI may instead be functioning as a thiol-disulfide oxidoreductase with a role in keeping cysteines of CoxI in a reduced state so that it is capable of forming ligands with copper (7). However, direct biochemical evidence for or against these models is lacking.
R. capsulatus contains a ScoI homolog named SenC. Interestingly, it has been demonstrated that SenC is required for activity of the cbb3 cytochrome oxidase despite the fact that this oxidase does not have a CuA site (4). Specifically, initial investigation of SenC showed that it affected both aerobic respiration and photosynthesis gene expression (4). A proposed role for a SenC homolog in R. sphaeroides is to act as a signal mediator between cytochrome cbb3 oxidase and the sensor kinase RegB that is involved in controlling expression of a number of processes such as photosynthesis and respiration (19). This theory predicts that SenC is directly involved in the redox sensing mechanism of RegB, which in turn regulates multiple operons in response to environmental oxygen levels. In the present study, we further define the role of SenC in R. capsulatus by constructing an in-frame deletion of senC, as well as point mutations in the putative CXXXC copper-binding site of SenC. Our results indicate that SenC does indeed have a role in promoting optimal activity of the cytochrome cbb3 oxidase and that the cysteines within the copper binding motif in SenC (specifically Cys87) are necessary for this function. We also show that the effect SenC has on transcription is an indirect effect caused by a decrease in cytochrome c oxidase enzymatic activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
pir was utilized for conjugation with R. capsulatus, and the gentamicin concentrations in E. coli and R. capsulatus were 10 and 1.25 µg/ml, respectively.
Cloning and generation of SenC in-frame deletion.
To create the in-frame deletion of SenC, 500 bp upstream of SenC were PCR amplified with the primers XbaIUp (5'-TTTCTAGAATCGTCACTGGCACCAGG) and EcoRVUp (5'-TCGATATCTTGCTCGAAACGTTCATC). Also, 500 bp downstream of SenC were also PCR amplified with the primers SacIDown (5'-ATGAGCTCTCGTAAACCCGCTGGATATG) and EcoRVDown (5'-TTGATATCCAACGGAAATTGACCAGC). The upstream PCR product was enzymatically digested with XbaI and EcoRV, while the downstream product was digested with SacI and EcoRV. These restriction endonuclease sites were constructed into the primers used for PCR amplification and do not exist elsewhere in the PCR product. The two digested PCR products were then ligated in the presence of the gentamicin resistant suicide vector pZJD29a (J. Jiang and C. E. Bauer, unpublished plasmid construction), which was predigested with the restriction endonucleases XbaI and SacI. This ligation created a 1-kb insert that contained 500 bp upstream and downstream of senC. The only amino acid sequence remaining of the SenC protein is MNVSSKISNGN, which consists of the first six amino acids and the last three amino acids of SenC. The centrally located Ile and Ser residues shown above are created by the EcoRV restriction site, which placed the two PCR products in-frame. The pZJD29a plasmid also contains the sacB gene encoding levansucrase, which inhibits cells from growth on sucrose media. pZJD29a constructs containing the correct insert were sequenced to confirm the deletion was in frame and then transformed into mating strain S17-1
pir and ultimately conjugated with the R. capsulatus parent strain, SB1003. Colonies representing a single recombination have gentamicin resistance and were therefore selected for, isolated, and grown photosynthetically in PY medium without antibiotics to allow derivatives in which the second recombination event can propagate. After 4 days of growth, cultures were plated on PY 5% sucrose media with colonies being restreaked onto PY and on PY plus gentamicin to confirm the loss of the plasmid. Colonies with the proper phenotype were then confirmed for deletion of senC by PCR amplification of the senC region. The PCR product was cloned for sequencing to confirm the in-frame deletion of senC. The final senC deletion mutant was named LS01.
A Flag-tagged senC construct was constructed by amplifying the promoter and entire senC gene with the Flag tag at the C terminus using the primers SflagUpNcoI (5'-ATCCATGGACTACAAGGACGACGACGACAAGAACGTTTCGAGCAAGACC) and SflagDownXbaI (5'-ATTCTAGATCACTTGTCGTCGTCGTCCTTGTAGTCATTTC CGTTGCCCG). The PCR product was cloned into pBBR1mcs-2 (1) to construct pSenCFlagC and transformed into the mating strain S17-1
pir. Conjugation between this construct and LS01 (
senC) was performed as described previously (2).
Generation of SenC point mutant (C87A).
The SenC point mutation was generated by PCR mutagenesis with Turbo Pfu DNA polymerase as described by the Stratagene QuikChange kit (catalog no. 200518). A fragment of DNA composed of the senC open reading frame and 500 bp on either side was cloned into pBluescript SK(+) (Stratagene). This was used as the template for point mutant generation. The plasmid containing the potential point mutation was confirmed by sequence analysis. The mutated senC DNA fragment was then subcloned into the suicide vector, pZJD29a, and transformed into S17-1
pir for conjugation with LS01 (
senC). Selection for mutants was done the same as that for LS01 with the final constructs being confirmed by PCR amplification of the mutant senC gene and sequencing the area of interest.
Spectroscopy on SB1003 and LS01. SB1003, LS01, and LS01 pSenCFlagC were grown aerobically to 50 Klett units in PY medium. Cells were harvested by centrifugation, resuspended in 10 mM Tris-HCl (pH 8)-50 mM NaCl, and then lysed by sonication. The crude cell extracts were then clarified by centrifugation at 10,000 x g in a microcentrifuge before the supernatant was removed and scanned spectrally from 400 to 900 nm. A DU640 Beckman spectrophotometer was used to analyze the sample.
Cytochrome c oxidase activity.
Visual analysis of cytochrome c oxidase activity was done by using the Nadi test. Nadi reactions were carried out as described by Marrs and Gest (16) by the addition of
-naphthol (Sigma) and dimethyl-p-phenylenediamine (Sigma) on PY medium plates such that all cells were covered and then excess reagent was removed. Colonies were timed for formation of the indophenol blue. Quantitative analysis of cytochrome c oxidase activity was carried out by measuring the reduction of cytochrome c (Sigma) by cytochrome c oxidase as a function of the decrease in absorbance at 550 nm. Specifically, aerobic cultures were grown to 50 Klett units, 10 ml of cell culture was centrifuged at 5,000 x g for 10 min, and the media was decanted. Pellets were stored at 80°C until the assay was performed. Cell pellets were resuspended in 1x assay buffer (10 mM Tris-HCl [pH 7.0], 120 mM KCl), lysed via sonication, and centrifuged at 10,000 x g for 10 min. Then, 10 µl of supernatant was combined with 940 µl of assay buffer. The reaction was initiated by the addition of 50 µl of reduced cytochrome c, and the decrease in absorbance at 550 nm was measured continuously for 1 min by using a spectrophotometer. Reduced cytochrome c was prepared by making a solution at 218 µM in water and adding dithiothreitol to a final concentration of 0.5 mM. The sample was mixed gently and incubated at room temperature for 10 min. To assure the level of reduction is adequate, the absorbance of a 20-fold-diluted stock was measured at both 550 and 565 nm. A ratio of absorbance at 550 to 565 nm should be between 10 and 20 and indicates that the substrate is sufficiently reduced. Activity was quantified by the following calculation: U/ml = (Abs/min) x dilution factor x reaction volume (ml)/volume of sample (ml) x 21.84, where 21.84 =
mM between ferrocytochrome c and ferricytochrome c at 550 nm (Sigma protocol in reference to product code CYTOC-OX1). Samples were normalized by determining the protein concentration of the cell extract by using Advanced Assay Reagent (Cytoskeleton, catalog no. ADV01).
ß-Galactosidase assays.
Transcriptional analysis of the puf operon was done by using the lacZ based reporter vector, pCB532
(3). Transcriptional analysis of the ccoNOPQ and cydAB operons was done by utilizing the pDSccoN2 and pLS04Qo lacZ-based reporter vectors, respectively (25). ß-Galactosidase activity was measured as described by Young et al. (28) with the protein concentration determined by using Advanced Protein Reagent (Cytoskeleton) (28). Copper suppression assays were performed identically to those without copper, with the exception of 0.02 mM CuCl2 added to the growth medium.
Diamide sensitivity study. SB1003 and LS01 were both grown overnight to stationary phase and then diluted 1:50 and allowed to recover to exponential phase (50 Klett units). Cultures were then divided into aliquots and either allowed to grow for additional 2 h with no alterations or with the addition of diamide (N,N,N',N'-tetramethylazodicarboxamide) to a final concentration of 6 mM. After the 2-h growth period serial dilutions were done, and cultures were plated on PY in triplicate. Plates were incubated at 34°C for 3 days before the colonies were counted, and the total number of viable cells was quantitated.
| RESULTS |
|---|
|
|
|---|
To alleviate the possibility of polarity effects, we constructed a deletion of the senC gene in R. capsulatus by fusing the first six senC codons in-frame to the last four codons of senC resulting in the strain LS01. In contrast to the reduced synthesis of the photosystem in strain JB-1 (4), spectral scans of LS01 exhibited a marked increase in photosystem production in the presence of oxygen relative to the parent strain SB1003 (Fig. 1). Introduction of a wild-type copy of senC (containing a Flag tag that was utilized in other studies, LS01 pSenCFlagC) was provided in trans in LS01 and completely restored wild-type photo-pigment production, thereby indicating that the senC deletion does not have a polar effect on regA (Fig. 1).
|
senC) affected the enzymatic activity of cbb3 oxidase. A visual observation of cbb3 oxidase activity in growing cells can be performed with the Nadi assay, a method that has been extensively utilized to observe cytochrome c-dependent biological respiration since 1884 (16). During the Nadi reaction, a strain containing a functional cytochrome c oxidase catalyzes rapid (<1 min) formation of blue colored indophenol from colorless
-naphthol using dimethyl-p-phenylenediamine as an exogenous electron donor. However, strains containing a nonfunctional cytochrome c oxidase will not catalyze this reaction resulting in a substantial delay (>30 min) in spontaneous indophenol formation. After subjecting wild-type R. capsulatus (SB1003) colonies grown on PY media to Nadi reagents, the colonies turn visibly blue in approximately 5 s and reach maximum coloration (entire colony blue) within 20 s (Fig. S1 in the supplemental material). In contrast, strain LS01 takes considerably longer, with initial blue color occurring at about 1 min with maximal color not achieved until
10 min (Fig. S1 in the supplemental material). As a control, we also assayed the Nadi reaction in the R. capsulatus cbb3 oxidase deletion mutant strain GK32 that lacks cbb3 oxidase activity (13). Colonies of strain GK32 do not form blue coloration until
30 min after being incubated with the Nadi reagents (data not shown). In confirmation that the Nadi-slow phenotype observed with LS01 is a direct result of a disruption of SenC, we also observed that the regA-disrupted strain exhibited a normal (<1-min color development) Nadi reaction (Fig. S1 in the supplemental material). Furthermore, the addition of senC in trans to strain LS01 restores Nadi activity to wild-type levels (Fig. S1 in the supplemental material). Thus, strain LS01 can be characterized as exhibiting a Nadi-slow phenotype, which is not as severe as a cbb3-null mutation. These data indicates that the activity of cbb3 oxidase is not entirely dependent on SenC but that SenC does significantly enhance the activity of this enzyme. Since the Nadi reaction is not quantitative, we also measured cbb3 oxidase activity by undertaking an assay in which the activity of cytochrome c oxidase is measured as a function of the decrease in absorbance of cytochrome c at 550 nm that occurs when this cytochrome donates an electron to cbb3 oxidase. The results of this assay indicate that LS01 displays a 79% decrease in cytochrome c oxidase activity relative to that observed with wild-type cells during aerobic growth (Fig. 2A). As a control for nonrespiratory oxidation of cytochrome c, we also assayed for oxidation in the cbb3 oxidase deletion mutant GK32, which exhibited an 88% reduction in activity relative to wild-type cell extracts (Fig. 2A). This quantitative assay thus mimics observations of the Nadi reaction where strain LS01 exhibits a decrease in respiration that is not as severe as that observed with a null mutation in cbb3 oxidase.
|
regA mutant. As shown in Fig. 2A, the introduction of senC on a plasmid restored cytochrome c oxidase activity to wild-type levels. It has previously been demonstrated that RegA affects transcription on ccoNOPQ operon that encodes for cbb3 oxidase, specifically a regA mutant demonstrates a 9.2-fold decrease in transcription of this operon under aerobic conditions (25). Despite this decrease in transcription, the
regA mutant has near-wild-type levels of cytochrome c oxidase enzymatic activity (Fig. 2A).
Exogenous addition of copper suppresses the senC deletion phenotype.
As stated above in the Introduction, the SenC homolog, Sco1 is proposed to act as a copper chaperone by delivering copper to the CuA site of cytochrome c oxidase (9). To address the possibility of SenC functioning as a copper chaperone, we assayed whether the addition of copper to the growth medium of R. capsulatus can suppress the senC deletion phenotype by reconstituting a functional cbb3 oxidase. Various copper concentrations were tested to determine the highest level of copper that could be added to PY media without affecting the growth rate of R. capsulatus. When the senC deletion strain LS01 was grown on PY plates containing 20 µM CuCl2, the Nadi-slow phenotype was suppressed to a level that was indistinguishable from that observed with wild-type cells (Fig. S2 in the supplemental material). As a control, the cbb3 deletion mutant GK32 was also grown on copper-supplemented medium, where it maintained a Nadi-minus phenotype. The same copper suppression effect was observed on defined minimal growth medium where the addition of 20 µM CuCl2 also suppresses the Nadi-slow phenotype. This indicates that free copper in the growth medium does not simply react with the
-naphthol and DMPD (N,N-dimethyl-p-phenylenediamine monohydrochloride) to form the blue indophenol. Instead, copper appears to specifically suppress the senC mutation, giving rise to a functional cytochrome cbb3 oxidase that generates indophenol from the Nadi reagents.
A quantitative measurement of copper suppression was again undertaken by assaying cytochrome c oxidation at 550 nm promoted by cytochrome cbb3 oxidase in cell extracts. As shown in Fig. 2B, the addition of 20 µM exogenous copper to the growth medium resulted in complete suppression of the reduced cytochrome cbb3 oxidase activity phenotype of strain LS01. In contrast, addition of exogenous copper to the growth medium of the cbb3 cytochrome oxidase-null mutant strain GK32 had no suppressing effect on cytochrome cbb3 oxidase activity (Fig. 2B).
To further demonstrate similar functionality between SenC and ScoI, we constructed a chromosomal Cys87
Ala point mutation, which is the first cysteine in the putative CXXXC copper-binding motif. The C87A mutant displayed a Nadi-slow phenotype similar to the in frame deletion of SenC, taking
20 min to complete color formation. Quantitative analysis of cytochrome oxidase activity in C87A revealed an 82% decrease in activity relative to the wild type (Fig. 2A). Copper suppression analysis by the addition of 20 µM CuCl2 to C87A was undertaken, and again activity was resumed to near wild-type levels (Fig. 2B).
Diamide resistance.
Analysis of structural features of the SenC/Sco1 family of proteins has shown that there is a high level of similarity to a novel class of thiol-disulfide oxidoreductases (2, 7, 18, 26). Thus, in addition to being a potential copper chaperone, it is also possible that SenC/Sco1 may affect the redox state of cysteines. Because of this hypothesis, experiments were undertaken to determine the effects of a thiol oxidant, N,N,N',N'-tetramethylazodicarboxamide (diamide) on wild type, LS01, and the cbb3 mutant strain GK32. The response to diamide depends on the oxidoreductase equilibrium. Specifically, if the equilibrium is toward the formation of dithiols, then the senC mutant may be hypersensitive, and if it is toward the formation of disulfides, then it would be resistant. For this assay, cell cultures were grown semiaerobically to exponential phase and then divided with one set of cultures continuing to grow without perturbation, and the other set grown in the presence of 6 mM diamide. After two additional hours of growth, the cells were plated to determine viable cell count. The results of this assay show that wild-type (SB1003) cultures exhibit substantial sensitivity to diamide, resulting in
97% death. Surprisingly, strain LS01 demonstrated considerably less sensitivity (Fig. 3). The SenC C87A mutant also exhibited a very similar phenotype to that of LS01 (data not shown). These results suggest that if SenC is an oxidoreductase it would function in the direction of formation of disulfides. Specifically in the absence of SenC (LS01) there would be a shortage of disulfides resulting in an accumulation of reductants, hence making it resistant to diamide. Indeed, evidence supporting SenC functioning as an oxidoreductase in this matter is supported by the observation that strain GK32, which lacks cytochrome cbb3 oxidase activity and therefore may accumulate reductants, also exhibits a high level of resistance to diamide (Fig. 3). However, since both mutants display the same phenotype it is difficult to say whether the diamide resistance of LS01 is a direct or indirect effect that results from the loss of a functional cytochrome cbb3 oxidase.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In the present study we have demonstrated that exogenous copper in the form of cupric chloride can complement a senC-null mutant, resuming normal respiration. However, the argument has been made that the addition of copper may actually be rendering an oxidative stress response. However, it should be noted that the addition of other cations such as zinc and magnesium did not complement the respiration-deficient phenotype of a senC mutant (data not shown), indicating a specific necessity for copper. This observation rules out that the exogenously added copper is simply functioning as a Lewis acid that catalyzed a chemical reaction. Instead, the observed suppression of a null senC phenotype by high levels of copper suggests that SenC may indeed have a role in sequestering and delivering copper to cbb3-type cytochrome c oxidase.
A caveat to this model is that cytochrome cbb3 oxidase does not contain a CuA site, which is the site that Sco1 is thought to chaperone copper to in aa3-[r]type cytochrome oxidases. This indicates that SenC may have evolved to deliver copper to the CuB site that is present in cbb3-type cytochrome c oxidases in bacterial species. Alternatively, ScoI may be involved in delivery of copper to both the CuA and CuB sites in mitochondrial aa3-type cytochrome oxidases and, when the CuA site was lost in bacterial cbb3 oxidases, ScoI homologs were subsequently retained to continue delivery to the CuB site. Note that the presence of ScoI homolog in an organism containing only a cbb3-type cytochrome c oxidase is not unique to R. capsulatus. Campylobacter jejuni also contains a ScoI homolog and yet only has a cbb3-type cytochrome c oxidase (21).
Recently, the solution structure of Sco1 was solved from B. subtilis, as well as a crystal structure of H. sapiens Sco1 (26, 27). These structures reveal that this family of proteins has a thioredoxin-type fold, and it is proposed that Sco1 actually functions as a signaling molecule rather than a copper chaperone. The support for this hypothesis comes from the fact that the crystallization of Sco1 was only attainable without copper bound, and the proposed copper binding site was not sterically possible based on the positions of the cysteines revealed by the crystal. This observation led to a hypothesis that ScoI/SenC could also be functioning as an oxidoreductase and that the oxidation state of the copper allows the cysteines to either be available for peroxidase reactions or not. To test this hypothesis, wild-type R. capsulatus and the senC mutant were both exposed to the strong thiol oxidant, diamide, which is known to promote spurious disulfide bond formation. The senC deletion strain demonstrated a dramatic increase in resistance to diamide over the wild-type control. This result does not support or refute the possibility of an oxidoreductase model for SenC since oxidoreductases are reversible enzymes. As stated in Results, the resistance of a senC mutant to diamide only indicates that if it is an oxidoreductase its equilibrium is toward the formation of disulfides, and hence in its absence there may be an increase in reductants, therefore increasing its resistance to the spurious formation of disulfides by diamide.
SenC does not directly affect transcription. SenC was also proposed to directly affect gene expression in R. capsulatus and in R. sphaeroides. This conclusion was based on the observation that the previously described R. capsulatus senC insertional mutant, JB-1, exhibited a slight decrease in photosystem production. It was also believed that this phenotype was independent of an effect on cytochrome cbb3 oxidase since the cytochrome cbb3 oxidase mutant, M7, exhibited the opposite phenotype by having an increase in photosystem production (4). However, the data presented here reveal that an in-frame senC deletion mutant has a phenotype similar to that of a cytochrome cbb3 oxidase mutant, with both exhibiting a slight increase in photosystem production. The decrease in photosystem production observed in the previous senC mutant, JB-1, was therefore, most likely due to a polar effect on the transcriptional regulator, RegA, which directly affects the transcription of photosynthetic apparatus genes.
It has also been proposed that SenC may be an intermediate in the transfer of a signal between cytochrome c oxidase and the two-component signal transduction system, RegB/RegA (8). Recent studies on redox sensing by the sensor kinase RegB actually shed light on why a mutation that affects cbb3 oxidase activity also affects synthesis of the photosystem. The primary regulatory circuit that controls synthesis of the photosystem is the RegB/RegA two-component system, which upregulates photosystem apparatus gene expression under anoxygenic conditions. It has recently been discovered that RegB monitors the oxidation-reduction state of the ubiquinone pool as an input signal to control kinase activity. Specifically, the presence of oxidized ubiquinone inhibits RegB autophosphorylation (L. R. Swem et al., submitted for publication). In the absence of a functional cytochrome cbb3 oxidase, the ubiquinone pool becomes more reduced due to the lack of electrons flowing through cytochrome cbb3 oxidase. The reduced ubiquinone pool derepresses RegB autophosphorylation leading to induction of the photosystem even under aerobic growth conditions. In fact, this is the phenotype of both a cbb3 oxidase and a senC mutant, which both exhibit an increase in photosystem production aerobically. In both mutants, we believe this phenotype is attributed to a highly reduced ubiquinone pool, which is a consequence of a dysfunctional cytochrome cbb3 oxidase. The reduced ubiquinone pool is unable to inhibit RegB autophosphorylation and photosynthetic gene expression is ultimately increased as a consequence.
Summary. The data presented here indicates that SenC is involved in copper metabolism, which is required for synthesis of a functional cytochrome cbb3 oxidase. We also demonstrate that the multiple regulatory phenotypes previously associated with senC mutations are due solely to the decreased activity of cytochrome cbb3 oxidase. At present, there is no direct evidence that that SenC or cytochrome cbb3 oxidase directly modulate the activity of the RegB/RegA two-component regulatory system.
| ACKNOWLEDGMENTS |
|---|
This study was supported by National Institutes of Health grant GM53940.
| FOOTNOTES |
|---|
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |