This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jackson, R. W.
Right arrow Articles by Rainey, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jackson, R. W.
Right arrow Articles by Rainey, P. B.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2005, p. 8477-8488, Vol. 187, No. 24
0021-9193/05/$08.00+0     doi:10.1128/JB.187.24.8477-8488.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Genetic Characterization of Pseudomonas fluorescens SBW25 rsp Gene Expression in the Phytosphere and In Vitro

Robert W. Jackson,1* Gail M. Preston,1 and Paul B. Rainey1,2

Department of Plant Sciences, University of Oxford, South Parks Road, Oxford, OX1 3RB, United Kingdom,1 School of Biological Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand2

Received 5 August 2005/ Accepted 16 September 2005


arrow
ABSTRACT
 
The plant-colonizing Pseudomonas fluorescens strain SBW25 harbors a gene cluster (rsp) whose products show similarity to type III protein secretion systems found in plant and animal pathogens. Here we report a detailed analysis of the expression and regulation of the P. fluorescens rsp pathway, both in the phytosphere and in vitro. A combination of chromosomally integrated transcriptional reporter fusions, overexpressed regulatory genes, and specific mutants reveal that promoters controlling expression of rsp are actively transcribed in the plant rhizosphere but not (with the exception of the rspC promoter) in the phyllosphere. In synthetic medium, regulatory (rspL and rspR) and structural (rspU, plus the putative effector ropE) genes are poorly expressed; the rspC promoter is subject to an additional level of regulatory control. Ectopic expression of regulatory genes in wild-type and mutant backgrounds showed that RspR controls transcription of the alternate sigma factor, rspL, and that RspL controls expression of gene clusters encoding structural genes. Mutation of rspV did not affect RspR-mediated expression of rspU. A search for additional regulators revealed two candidates—one with a role in the conversion of alanine to pyruvate—suggesting that expression of rsp is partly dependent upon the metabolic status of the cell. Mutations in rsp regulators resulted in a significant reduction in competitive colonization of the root tips of sugar beet seedlings but also caused a marked increase in the lag phase of laboratory-grown cultures, indicating that rsp regulatory genes play a more significant general role in the function of P. fluorescens SBW25 than previously appreciated.


arrow
INTRODUCTION
 
The plant rhizosphere is a complex environment comprising organic matter and a plethora of microbes, some of which can affect plant health. Pathogens, such as Pythium ultimum, can hinder plant growth, whereas strains of Pseudomonas fluorescens, including P. fluorescens SBW25, can promote plant growth. The mechanism of plant growth promotion involves a combination of competition, antagonism of pathogens via the production of antimicrobial compounds, and induction of systemic resistance (15, 16, 31, 34).

To understand the interaction between P. fluorescens SBW25 and plants, SBW25 genes specifically activated in the plant environment were identified via a promoter trapping strategy (11, 36). Approximately 100 rhizosphere-induced (rhi) genes have been identified and categorized into six groups: nutrient acquisition, stress response, attachment and surface colonization, antibiotic production, secretion, and unknown. One rhi gene (rhi-18) is hrcC (redesignated rscC), whose product is a component of a type III protein secretion system (TTSS) termed Rsp (33, 36) (Fig. 1).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 1. The P. fluorescens SBW25 rsp gene cluster. In silico analysis of the P. fluorescens SBW25 rsp gene cluster (A) identified six potential transcriptional units: rspR, rspL, ropE, rspU gene cluster, rspC gene cluster, and rspJ gene cluster. (B) ropE promoter region, highlighting three rspL binding site (promoter)-like sequences (bold), the probable rspL promoter sequence (bold, underlined), start codon (bold italics), and potential Shine-Dalgarno sequence (double underlined). (C) Putative RspL promoters, which show homology to P. syringae hrp promoters, were identified upstream of the three structural gene clusters and ropE. Divergent nucleotides are indicated in bold; the ropE promoter has a shorter 15N spacer region between the –10 and –35 sites. Two potential promoters were identified upstream of the rspU gene cluster, one with an imperfect promoter and 18-nucleotide spacer region (GGGAACCCCTTTTGCACTGGCTGTGCCAAAGA), which overlaps the RpoN promoter of rspL (conserved nucleotides are shown in bold and reverse complement RpoN sites underlined).

The P. fluorescens SBW25 rsp cluster exhibits a high level of synteny to the group I TTSS clusters of Pseudomonas syringae pv. tomato DC3000 and Erwinia amylovora and is genetically most similar to the P. syringae cluster. The cluster is organized into three putative transcriptional units (the rspU, rspC, and rspJ gene clusters) and contains at least two genes encoding regulatory proteins: a putative enhancer binding protein (EBP) gene, rspR, and a putative alternate sigma factor gene, rspL. However, the SBW25 cluster lacks the P. syringae enhancer binding protein gene hrpS, the harpin gene hrpZ, and four genes of the hrpJ gene cluster (hrpJ, hrcV, hrpQ, and hrcN). Despite this, Preston et al. (33) demonstrated that at high inoculum levels, SBW25 expressing RspL and AvrB (from P. syringae pv. glycinea) could elicit a Rsp-dependent gene-for-gene resistance reaction in Arabidopsis thaliana Col-O.

Adjacent to the rsp cluster is ropE, a homologue of avrE (23, 28) and dspA (also called dspE) (3, 12). This region is similar to the minimal exchangeable effector loci and conserved effector loci of some P. syringae TTSS pathogenicity islands (PAIs) (1, 5, 9), although the gene arrangement is inverted, since a tRNA gene resides between the rsp cluster and ropE; in P. syringae the tRNA gene lies beyond the effector locus. Unlike its counterparts in pathogens, there is no chaperone gene, avrF or dspB/F, next to ropE, and ropE is located on the opposite side of the rsp cluster from avrE, i.e., ropE is located next to rspL, whereas avrE is adjacent to hrpRS.

In P. syringae, the "downstream" section of the regulatory cascade leading to TTSS gene expression is known (13, 14, 18, 19, 27, 35, 41). In P. syringae, a pair of enhancer binding proteins, HrpR and HrpS, control expression of the hrp/hrc cluster. Expression of the hrpRS operon is constitutive in P. syringae pv. syringae 61 (41) but inducible in P. syringae pv. phaseolicola NPS3121 (35). In P. syringae pv. syringae and P. syringae pv. tomato, HrpR and HrpS interact to form a heterodimer that activates the alternative sigma factor gene, hrpL (19), in an RpoN-dependent manner (17). HrpL controls a regulon consisting of hrp/hrc structural genes and effector genes by recognition of a specific promoter sequence upstream of the regulated genes (10, 21, 42, 43). The hrpV gene, within the hrcC operon, encodes a negative regulator of hrp gene expression that is predicted to act above the level of hrpL expression, possibly binding to and affecting HrpS activity (20, 32). Recently, Lon protease has been shown to negatively regulate hrp gene expression (4) by affecting the level of HrpR in bacterial cells and thus imposing stringent negative regulation. It was found that hrp-inducing medium diminished Lon-dependent repression of HrpR, allowing HrpR levels to increase along with expression of the TTSS structural genes. In Pseudomonas aeruginosa, new research has shown that metabolic imbalance appears to be an underlying cause of TTSS gene expression (38).

The TTSS of P. syringae has an important role both in pathogenesis and in the induction of plant defense responses. In contrast, P. fluorescens SBW25 does not naturally elicit a rsp-dependent resistance reaction in plants, as observed with pathogens on resistant hosts or nonhosts, and no change in this phenotype is observed when P. fluorescens SBW25 rsp mutants are inoculated into plant leaves (33). Moreover, in P. fluorescens SBW25, mutations in rsp structural genes and ropE do not affect ability to colonize or grow in the rhizosphere of sugar beet plants, at least over a 2-week period (33).

The fact that the rsp cluster of P. fluorescens SBW25 does not have a clear phenotype in standard assays for plant-bacterium interactions suggests several possibilities: that it does not normally use the secretion system; that it does not use rsp for plant interactions; that it does not secrete proteins that are recognized by plants; that rsp has a subtle or conditional phenotype; or that the system has an as yet unidentified role in the interaction with plants or even with other soil organisms. Central to defining the role of these genes is an understanding of the expression of the gene cluster in the plant environment, the regulatory processes controlling expression, and the importance of the regulators. Here we report an analysis of the expression and regulation of the P. fluorescens rsp pathway, both in the rhizosphere and in vitro. We use a combination of reporter fusions, mutants, and strains carrying overexpressed regulatory genes to test the hypothesis that the P. fluorescens SBW25 rsp gene cluster is expressed in the plant environment, that the P. fluorescens SBW25 rsp gene cluster is regulated in a manner analogous to that found in the TTSS of P. syringae, and that the gene cluster is functional. Our data show that the cluster is expressed specifically in the plant root environment, that regulation differs from that found in P. syringae, and that rsp mutants are impaired in growth in both laboratory and plant environments.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids. Bacterial strains and plasmids are listed in Table 1. Escherichia coli strains were grown at 37°C overnight on Luria-Bertani (LB); (Difco) (39) agar or broth. P. fluorescens SBW25 and P. syringae pv. tomato strain DC3000 were grown at 28°C on LB agar or King's medium B (KB) (22) agar or in LB broth. M9 and hrp-inducing media (HIM) were used for testing gene expression (30, 39). P. fluorescens SBW25{Delta}dapB was grown on medium supplemented with diaminopimelate (DAP) and lysine to final concentrations of 800 µg ml–1 and 80 µg ml–1, respectively (11). Antibiotics and supplements were used to the following final concentrations: ampicillin, 50 µg ml–1; gentamicin, 10 µg ml–1; kanamycin, 25 µg ml–1; tetracycline, 10 µg ml–1; 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside, 5-bromo-4-chloro-3-indolyl-ß-D-glucuronide (XGlcA), and isopropyl ß-D-1-thiogalactopyranoside, 40 µg ml–1 (each). All plasmids were maintained in E. coli strains DH5{alpha}{lambda}pir or S17-1{lambda}pir. Biparental matings between P. fluorescens strain SBW25 or SBW25{Delta}dapB and plasmid-bearing strains of S17-1{lambda}pir were conducted using broth cultures grown overnight by mixing 500 µl of E. coli cells with 1 ml of heat-shocked (45°C for 20 min) P. fluorescens cells. The cells were pelleted, and the pellet was placed on a KB plate (supplemented with DAP and lysine, where appropriate) and incubated at 28°C for 16 h. Transconjugants were obtained by plating on selective media with 0.5x CFC (cetrimide, fucidin, cephalosporin; Oxoid) or nitrofurantoin (100 µg ml–1; Sigma) to counterselect E. coli. The transposon IS-Omegon-Km/hah was developed by replacing the chloramphenicol gene of IS-phoA/hah (29) with a kanamycin gene (S. R. Giddens, C. D. Moon, R. W. Jackson, and P. B. Rainey, unpublished). Transposon mutants of chromosomal rspR, rspL, ropE, and rspV were generated by marker exchange using pGMP2 cosmids carrying GPS1 transposon insertions in the genes (33) and confirmed by PCR analysis. Assessment of bacterial growth in vitro was done by measuring the optical density at 600 nm (OD600) of overnight cultures and inoculating three fresh 10-ml LB broths (containing kanamycin for mutants) to a final optical density of 0.01. Broth samples were removed, and the OD600 was measured over 24 h.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Principal bacterial strains and plasmids

Molecular biology techniques. Plasmid DNA was extracted using either a midiprep or a miniprep extraction kit (QIAGEN) and DNA cleaned up from agarose gels or enzymatic reactions using QIAGEN's QIAquick purification kits. Restriction endonucleases and buffers (New England Biolabs), shrimp alkaline phosphatase (USB), and DNA ligase (Invitrogen) were used according to the manufacturer's instructions. Standard PCR and arbitrary primed PCRs were performed with Taq polymerase and buffer (QIAGEN), and high-fidelity PCR was performed with SuperTaq Plus (HT Biotechnology) using either a PTC-100 thermal cycler (MJ Research, Inc.) or a GeneAmp 2400 (Perkin-Elmer) instrument. All PCR-amplified DNA fragments were sequenced to confirm fidelity. Arbitrarily primed PCR protocol followed that of Manoil (29), and primer sequences are available on request. PCR products were examined on agarose (Melford) gels and cloned into pCR2.1 with an Original TA cloning kit (Invitrogen)for sequencing and subcloning. DNA sequencing was done using BigDye v3.1 (ABI) according to the manufacturer's instructions, and sequencing reactions were run on an ABI Prism 310 genetic analyzer automated sequencer. Sequence traces were analyzed using Chromas 1.45 (Technelysium Pty. Ltd.), and database comparisons of the sequences were made via the BLASTN, BLASTP, and BLASTX algorithms (2).

Assessment of gene expression. Putative RspL-binding sites (promoters) were identified in the P. fluorescens SBW25 rsp gene cluster (Fig. 1A to C). Promoter activity was measured by transcriptionally fusing PCR-amplified promoter fragments from P. fluorescens SBW25 to either 'dapB-'lacZ or 'uidA. This was achieved using the integration vector pIVETD and derivates thereof (11), which contain promoterless copies of dapB-lacZ and uidA. Both are R6K-based plasmids and do not replicate in P. fluorescens SBW25, so transconjugants arise by integration of the constructs into the chromosome by homologous recombination (Campbell integration) between promoters on the chromosome and the plasmid. DNA fragments were amplified using either pGMP2 DNA or total DNA as a template with primers (primer sequences available on request) designed from the P. fluorescens SBW25 genome or rsp gene sequence deposit (GenBank accession number AF292566). The DC3000 hrpA promoter was amplified using primers (primer sequences available on request) designed from sequence AF232004. Correct integration was confirmed by PCR, using a reverse primer from the vector dapB or gfp genes (primer sequences available on request) and a forward primer from the P. fluorescens SBW25 chromosome 200 to 500 bp upstream of the insert site (primers available on request). Promoter expression in the plant rhizosphere was tested using the pIVETD plasmid in P. fluorescens SBW25{Delta}dapB, using the same principle as that described by Rainey (36). In vitro expression was tested using strains containing uidA fusions and measuring the activity of ß-glucuronidase produced by uidA, except for testing of the pIVETD-rspU fusion suppressor mutants, when lacZ activity was tested.

For in vitro experiments testing expression in LB or HIM broth, single colonies of P. fluorescens transconjugants containing the fusions were initially grown overnight at 25°C in LB broth supplemented with tetracycline (LB+Tet). A 50-µl aliquot of cell suspension was used to inoculate fresh LB+Tet broths (three replicates), while a 200-µl aliquot was used for HIM broths (three replicates). For DC3000 pGFPGUS-hrpA, the strain was grown overnight in LB broth and a 50-µl aliquot used to inoculate fresh LB+Tet broths. The remaining cells were harvested by centrifugation, washed once with sterile distilled water, and then resuspended in HIM to the initial volume. For experiments involving ectopic expression of regulatory genes, single colonies (three independent replicates) of each test strain were inoculated into LB broths, supplemented with the appropriate antibiotics, and incubated at 28°C for 16 h (or 40 h for experiments including strains overexpressing rspL due to slow growth of these strains).

The culture optical density at 600 nm was determined, and a 100-µl aliquot of cells was harvested and resuspended in 800 µl of sonication buffer (50 mM Tris-HCl, pH 7.6, 1 mM EDTA, 100 mM NaCl, pH 8, plus 1 Complete proteinase inhibitor tablet [Roche] per 50 ml). Cells were sonicated (Soniprep 150; MSE) at an amplitude of 5 for 4 min and cell debris pelleted. The supernatant was aspirated and mixed with 200 µl of protein dye (Bio-Rad) and total protein estimated by comparison to bovine serum albumin standards (1 to 15 µg ml–1). One microliter of each of the overnight cell suspensions was mixed in 40 µl extraction buffer (50 mM NaHPO4, pH 7.0, 10 mM 2-mercaptoethanol, 10 mM Na2EDTA, 0.1% sodium lauryl sarcosine, 0.1% Triton X-100) and 50 µl of GUS assay buffer (2 mM 4-methylumbelliferone-ß-D-glucoronide [4MUG] dissolved in extraction buffer) in individual wells of a 96-well microtiter plate (Falcon 3072). The plate was incubated in the dark at 37°C for 60 min, and 10 µl of each reaction was stopped by addition to 190 µl of stop buffer (0.2 M sodium carbonate). ß-Glucuronidase activity (as a measure of promoter activity) was measured by assessing the amount of fluorescent 4-methylumbelliferone released from hydrolysis of 4MUG (nonfluorescent). Fluorescence was measured using a Polarstar plate reader (BMG Laboratories) with an excitation wavelength of 370 nm, emission wavelength of 460 nm, and gain of 10. Enzyme activity was calculated using the Fluostar computer program (BMG Laboratories) and expressed as units of 7-hydroxy-4-methylcoumarin (4MU) min–1 µg–1 protein, except where protein samples were not obtained and expression was calculated relative to optical density of the culture medium. This ensured there were no differences due to cell growth variation and allowed direct comparison between strains.

Measurement of lacZ activity was done as described by Rainey (36) except that 4-methylumbelliferyl-ß-D-galactoside was used as the substrate, and the product, 4MU, was detected using a fluorometer as described above.

Statistical analyses of the data including analysis of variance (ANOVA) and comparison of means were carried out using JMP software, version 5 (SAS Institute). All gene expression data represent observations from at least two independent experiments. Where possible, details of statistical analyses are presented in the figure legends.

Arabidopsis thaliana seedlings inoculated with reporter gene strains were visualized by using a light microscope.

Plant growth conditions and experiments. For experiments testing expression of in vivo expression technology (IVET) fusions, sugar beet seedlings were grown in vermiculite, as described by Rainey (36). Vermiculite was sieved (2-mm aperture) through a brass laboratory test sieve (Gallenkamp) and used to fill scintillation vials (three-quarter fill); the vermiculite was moistened with distilled water. Bacterial suspensions from overnight broth cultures were washed in sterile distilled water and adjusted to an optical density (600 nm) of 0.05. Beta vulgaris (sugar beet) var. Amethyst seeds were soaked in the bacterial suspension for 5 min and laid on top of vermiculite in the vials; the seeds were covered with 1 to 2 cm of vermiculite. The vials were incubated in a LEEC plant growth chamber (16:8 h, day:night; 21°C) for 16 days and bacteria recovered from roots and shoot as described previously (36). For root tip fitness experiments, sugar beet seeds were sterilized by soaking in 70% ethanol (3 min), sterile water (twice rinsed), 5% sodium hypochlorite, and 0.025% Triton X-100 (20 min), with eight washes in sterile water. Seeds were aseptically placed on 1% water agar plates, which were stood vertically in the dark for 2 to 3 days to allow seed germination and development of the seedling. A hole was melted in the lid of sterile 1.5-ml Eppendorf tubes and filled with a 1:1 bacterial suspension (P. fluorescens SBW25 wild type and an SBW25 rsp mutant; each suspension was made by dilution of an overnight broth in sterile water to an OD600 of 0.1). The roots of germinated seeds were placed into the cell suspension such that the hypocotyls sat on the Eppendorf lid, and the tubes were incubated for 24 h at 25°C. A 5-mm section of root from the root tip upwards was removed and placed in an Eppendorf tube containing sterile glass balls, and bacteria were washed from the root tip by vortexing. Serial dilutions were plated on selective media, and cell counts were done to determine the selection rate constant (26). Arabidopsis thaliana plants were grown from seed; seed was sterilized by soaking in 70% ethanol (7 min), ethanol drained, and soaking in a 30% sodium hypochlorite, 0.025% Triton X-100 solution for 15 min. Seeds were washed five times in sterile distilled water and suspended in sterile 0.1% agar. Seeds were placed onto 0.5x Murashige and Skoog agar plates and germinated in a LEEC plant growth chamber (8:16 h, day:night; 20°C). Ten-day-old seedlings were used for uidA expression experiments by transplanting seedlings onto M9 agar plates (containing XGlcA and appropriate antibiotics) with a lawn of test bacterium (spread at an OD600 of 0.3, dried for 30 min).


arrow
RESULTS
 
Rsp promoters are expressed in the rhizosphere. Previous work has shown that the rspC gene cluster is plant inducible (36; P. Rainey, unpublished work); however, the responsiveness of the other rsp promoters was (at the start of this work) unknown. We took advantage of a dapB-based promoter trap (IVET [11]) to study the activity of the promoters controlling expression of the putative structural gene clusters (rspU, rspC, and rspJ), the alternative sigma factor (rspL), and a putative effector (ropE) in situ, that is, in the complex sugar beet phytosphere environment within which the bacterium is found naturally. To do this, the promoter region of each gene/gene cluster (hereafter referred to collectively as rsp promoters) was transcriptionally fused to an otherwise promoterless copy of dapB (which was itself transcriptionally fused to a promoterless lacZ reporter gene) and integrated into the genome of SBW25{Delta}dapB by homologous recombination. Because SBW25{Delta}dapB is unable to grow in the absence of an exogenous source of DAP (and there is no DAP in the phytosphere), growth of each {Delta}dapB rsp-'dapB fusion strain reflects the activity of the specific promoter fused to'dapB (11).

Each rsp-'dapB fusion strain was inoculated onto replicate sugar beet seeds, and population densities (harvested from seedlings) were determined after 16 days. A negative control (strain PBR393) was included in which the DNA fragment fused to 'dapB did not contain a rhizosphere-active promoter (Fig. 2) (44). The density of the negative control strain after 16 days was typically below the level of detection (see Fig. 2). A positive control (strain PBR391) was also included that contained a fusion between a constitutively active promoter and 'dapB and typically reached population densities of ~107 CFU per rhizosphere.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of SBW25 rsp gene expression in the rhizosphere. Rhizosphere growth of P. fluorescens SBW25{Delta}dapB strains containing chromosomally integrated fusions between various rsp promoters and a promoterless copy of dapB (growth reports the activity of each promoter; see the text). Figure shows growth of rspU-'dapB, ropE-'dapB, rspL-'dapB, rspJ-'dapB, and rspC-'dapB fusion strains in the rhizosphere of sugar beet seedlings. The figure also shows growth of the P. fluorescens SBW25{Delta}dapB rspC-'dapB fusion strain in the presence and absence of rspL (rspL:Tn#10). 391 is a positive control strain (PBR391) that contains a fusion between a constitutive promoter and 'dapB; the solid line at 103 CFU indicates the maximum population density of the negative control (strain PBR393), which contains a fusion between a DNA fragment with no promoter activity and 'dapB. Data are means and standard errors from triplicate plants, and population densities were determined after 16 days. Bacterial recovery was significantly different by one-way ANOVA (P < 0.0001; df = 6), with a specific effect due to the rspL mutation (P = 0.0025; df = 1). Significantly different values determined by comparison of means by Tukey-Kramer honestly significant difference (HSD) (P = 0.05) are indicated by letters above the columns.

The number of CFU recovered with the rspC-'dapB fusion was approximately 100-fold higher than that from the other rsp-'dapB fusion strains although significantly lower than that from the constitutive positive control strain, PBR391 (Fig. 2). The rspJ-'dapB, rspU-'dapB, rspL-'dapB, and ropE-'dapB strains were statistically comparable. These data demonstrate that all the rsp promoters are expressed in the rhizosphere.

We next examined the activities of the rsp promoters in the phyllosphere: with the exception of the rspC-'dapB fusion strain, which reached 1.7 x 104 cells per phyllosphere, no bacteria were recovered from the rspU-'dapB, rspJ-'dapB, rspL-'dapB, or ropE-'dapB fusion strains, indicating that these promoters are essentially inactive in this environment.

The high population densities achieved by the rspC-'dapB fusion strain, particularly in the rhizosphere, suggest that a second promoter or an additional transcription factor might control the activity of rspC. To test this, a P. fluorescens SBW25{Delta}dapB strain was made with a mutation in rspL (SBW25{Delta}dapB rspL:Tn#10), and the rspC-'dapB fusion was integrated into the genome of this strain. The population densities of the rspC-'dapB fusion strain (with and without the rspL mutation) from sugar beet seedlings were then determined in an experiment that included both the positive control strain PBR391 and the ropE-'dapB fusion strain. The rspL mutant rspC-'dapB fusion strain was significantly impaired in its ability to colonize the rhizosphere (Fig. 2), indicating a regulatory role for RspL in rspC expression in the rhizosphere. However, the observation that it did colonize the rhizosphere to a limited extent suggests that RspL-independent expression of rspC did occur.

We next asked whether there is a basal level of rspC expression in vitro and, if so, whether this was rspL dependent. To this end, promoterless uidA fusions to rspC, rspU, ropE, and rspJ were constructed (producing rspC-'uidA, rspU-'uidA, ropE-'uidA, and rspJ-'uidA, respectively) in a manner analogous to—and with identical fusion joint-points—the fusions described above. The activity of each promoter was then determined in vitro (LB broth) by assaying ß-glucuronidase. All four promoters showed a low level of activity; however, the basal level of expression of rspC was significantly greater than that of the other rsp promoters (Fig. 3). Inactivation of rspL in the rspC-'dapB fusion strain had no significant effect on expression of rspC (by one-tailed Student's t test). These data were further corroborated by examining the growth of SBW25{Delta}dapB rspL:Tn#10 rspC-'dapB and SBW25{Delta}dapB rspL-'dapB, rspU-'dapB, rspC-'dapB, and ropE-'dapB fusion strains on minimal agar lacking DAP and lysine. After 2 days of incubation, only the two rspC-'dapB fusion strains and the positive control strain, PBR391, grew: growth of the rspC-'dapB fusion strain was rspL independent. Together these data confirm a basal level of expression of rspC and show that this basal level of expression is independent of rspL.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. Expression of the rspC gene cluster is controlled by an rspL-independent regulator. Strains of P. fluorescens SBW25, carrying integrated uidA reporter gene fusions to rspU-'uidA, rspC-'uidA, ropE-'uidA, or rspJ-'uidA, were grown in LB broth for 16 h at 28°C. One-way ANOVA revealed a significant difference (P = 0.0003; df = 3); significant differences among means were revealed by Tukey-Kramer HSD (P = 0.05) and are indicated by letters above the columns. The concentration of 4MU product generated from 4MUG substrate by 1 µl of cells was measured relative to optical density of the cell suspension, and values shown are the means and standard error of three replicates.

Visualization of rsp expression in the plant hypocotyl and root environment. P. fluorescens SBW25 rsp genes appear to be expressed in the rhizosphere but poorly or not at all in the phyllosphere, the exception being the rspC gene cluster. To obtain further evidence of rhizosphere induction, we took advantage of the range of promoterless uidA reporter fusion strains and asked whether, when grown alongside seedlings on agar plates containing the substrate (XGlcA) for ß-glucuronidase, there was direct visual evidence of gene activation and, if so, whether activation was specific to different regions of the seedling. Each fusion strain was inoculated onto minimal M9 agar plates (containing XGlcA) alongside sterile Arabidopsisthaliana seedlings. P. syringae strain DC3000 containing a hrpA-'uidA reporter fusion was included as a control. After 4 days, ß-glucuronidase activity was clearly evident from the rspU-'uidA, rspC-'uidA, and ropE-'uidA fusion strains but not from the rspL-'uidA reporter strain (Fig. 4). Little growth or ß-glucuronidase activity was seen for bacteria growing on the shoots or leaves of seedlings. Each 'uidA fusion strain was also created in a rspL-mutant background: activity of the ropE-uidA and rspU-'uidA fusions was completely dependent upon rspL, and as expected, expression of rspC-'uidA showed rspL-independent expression, particularly in the hypocotyl region. DC3000 harboring the hrpA-uidA fusion showed strong gene expression on both the root and the shoot.



View larger version (106K):
[in this window]
[in a new window]
 
FIG. 4. RspL-dependent expression of P. fluorescens SBW25 rsp genes in the hypocotyl and root environments of Arabidopsis seedlings. Strains of SBW25 and SBW25 rspL:Tn#10 carrying a transcriptional fusion of uidA to rspU, rspC, ropE, or rspL were grown alongside 10-day-old seedlings of Arabidopsis thaliana. P. syringae pv. tomato DC3000 with a hrpA-'uidA fusion was a positive control. Bacteria were inoculated onto agar plates, and 10-day Arabidopsis thaliana ecotype Col-0 seedlings were then transferred and placed over the dried bacterial suspension. Plates were incubated at 22°C in the dark. Images were taken after 6 days and modified using Adobe Photoshop 7.0 to increase resolution and improve contrast. Arrows indicate the areas of blue color, indicative of rsp gene expression; note the lack of blue color in the plate surrounding the seedling. Asterisks indicate bacterial biofilm surrounding the plant.

Low expression of the P. fluorescens rsp genes in hrp-inducing medium. The TTSS genes of P. syringae are induced in HIM (30), a medium which mimics the nutrient environment of the plant apoplast. Since the P. syringae hrpA promoter was induced by both plant leaves and plant roots in the seedling assay described above, we tested whether HIM would induce expression of rsp genes in P. fluorescens. P. fluorescens SBW25 strains carrying the rspR-'uidA, rspL-'uidA, ropE-'uidA, or rspU-'uidA promoter fusion were grown in HIM, and the level of promoter activity was determined by assaying for ß-glucuronidase: DC3000 carrying a hrpA-'uidA fusion was employed as a positive control. In LB medium all genes exhibited a basal level of expression, but there was an approximately two- to fivefold increase in expression of the SBW25 rsp genes, including rspR-'uidA, in HIM (Fig. 5) and M9 (data not shown). In contrast, we observed a 23-fold increase of hrpA-'uidA expression in DC3000 when grown in HIM compared to LB broth. ANOVA revealed significant effects of both medium (HIM versus LB) and strain (P. fluorescens versus P. syringae), which demonstrates that the P. fluorescens SBW25 rsp cluster is HIM responsive, although the magnitude of induction was less than that observed with P. syringae.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. Expression of P. fluorescens SBW25 rsp genes in synthetic media. Strains of P. fluorescens SBW25 carrying a transcriptional fusion of uidA to rspU, ropE, rspL, or rspR were grown in LB broth (white columns) or hrp-inducing medium (gray columns) at 28°C for 16 h. P. syringae pv. tomato DC3000 with the hrpA-'uidA fusion was a positive control. One-way ANOVA revealed significant effects of both medium (HIM versus LB) and strain (P. fluorescens versus P. syringae; P < 0.0001 and df = 1 in both instances). The concentration of 4MU product generated from 4MUG substrate by 1 µl of cells was measured relative to cellular protein, and values shown are the means and standard error for three replicates.

We considered the possibility that expression may have been limited because the medium or growth conditions used did not provide the appropriate signal(s) required for full activation, and therefore, we examined the responsiveness of rsp genes to a range of additional stimuli. No significant change in rsp expression was elicited by changes in alternative carbon source (0.2% glycerol), osmolarity (sorbitol, 150 mM), iron availability (0.45 mM FeSO4 [high iron]; 100 µM 2,2-dipyridyl [low iron]), pH (10 mM citrate), calcium (none or 0.1 mM), sodium nitrite (2.5 mM), sodium nitrate (20 mM), or histidine (15 mM)(data not shown).

Elevated expression of rsp genes occurs in strains expressing RspR and RspL. Given that SBW25 contains only a single putative enhancer binding protein, that the rspC gene cluster displays constitutive expression, and that the P. syringae TTSS induction medium is a poor inducer of the SBW25 rsp genes, we reasoned that the regulatory pathway controlling rsp expression might either be defective or function differently from that found in P. syringae.

When either rspL or rspR was expressed ectopically on plasmid pML122 under control of the nptII promoter, we observed a pronounced increase in transcription of ropE and rspU (assayed using uidA reporter fusions to both genes) (Fig. 6). ANOVA indicated a significant difference in promoter activity between ropE-'uidA and rspU-'uidA. We also observed a highly significant difference in expression of the individual promoters in strains carrying rspL or rspR from that of controls (Fig. 6). A comparison of means indicated that rspU-'uidA expression was significantly higher than that of ropE-'uidA in both experiments. In separate experiments, we observed that RspL activated both the rspJ-'uidA (mean expression levels in nM 4MU min–1 µg protein–1 ± standard errors, 161.1 ± 44.6 units of 4MU µg protein–1 min–1) and rspC-'uidA (587.7 ± 20.5 units of 4MU µg protein–1 min–1) fusions relative to strains carrying vector alone (rspJ-'uidA, 9.5 ± 1.0 units of 4MU µg protein–1 min–1; rspC-'uidA, 7.9 ± 1.4 units of 4MU µg protein–1 min–1). These data demonstrate that the rsp regulators RspR and RspL positively regulate both P. fluorescens structural rsp genes and the putative effector gene ropE.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 6. The P. fluorescens SBW25 rsp gene regulators, RspL and RspR, activate expression of structural and effector genes. Strains of P. fluorescens SBW25 carrying a transcriptional fusion of 'uidA to ropE (gray bars) or rspU (white bars) were grown in LB broth at 28°C with or without the addition of plasmids expressing (A) RspL and (B) RspR. The concentration of 4MU product generated from 4MUG substrate by 1 µl of cells was measured relative to cellular protein, and values shown are the means and standard error for three replicates. One-way ANOVA indicated there was a significant difference in promoter activities between ropE-'uidA and rspU-'uidA for both experiments (RspL experiment, P = 0.0002 and DF = 1; RspR experiment, P = 0.0014 and DF = 1) and in expression of the individual promoters in strains carrying rspL or rspR, compared to controls (P < 0.0001; DF = 2).

RspR, the putative enhancer binding protein, activates the alternative sigma factor gene, rspL, leading to activation of the structural genes. In P. syringae, the enhancer binding proteins HrpR and HrpS are thought to bind to a cis-acting enhancer sequence as a heterodimer, allowing RpoN-dependent expression of the alternative sigma factor gene hrpL, which subsequently activates transcription of hrp genes (14, 19). To determine whether the same hierarchy exists in SBW25, we examined expression of the SBW25 rspL promoter using the rspL-'uidA reporter strain in which RspR was overexpressed on plasmid pML122. Expression of RspR resulted in a threefold increase in expression of the rspL-'uidA promoter compared to that for the control strain (Fig. 7A). We tested the effect of ectopic expression of RspL from pML122 on expression of the rspL-'uidA gene to determine if RspL plays any autoregulatory role but observed no significant difference in expression (Fig. 7A). Since we knew that overexpression of RspR leads to increased expression of the structural rsp gene fusion rspU-'uidA and the alternative sigma factor gene fusion rspL-'uidA, it was logical to assume, based on the P. syringae model, that RspR activates rspL and that RspL activates rspU. Consistent with this hypothesis, no expression of rspU-'uidA was detected in a strain overexpressing RspR but carrying a mutation in rspL (Fig. 7B). Ectopic expression of RspL from pML122 in the rspL mutant strain complemented the rspL mutation. These data confirm that genes controlling expression of structural genes are regulated by RspR acting via rspL.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 7. The regulatory hierarchy of rsp gene expression in P. fluorescens SBW25. (A) The effect of ectopic expression of Rsp regulators RspR and RspL in P. fluorescens SBW25 carrying an rspL-'uidA reporter gene fusion. One-way ANOVA (P < 0.0001; DF = 2) and subsequent comparison of means by Tukey-Kramer HSD (P = 0.05; different letters above the columns specify significant differences) indicated a significant effect of RspR expression on rspL. (B) The effect of ectopic expression of Rsp regulators RspR in P. fluorescens SBW25 (white bars) and RspR and RspL in P. fluorescens SBW25 rspL:Tn#10 (gray bars) carrying a rspU-'uidA fusion. One-way ANOVA confirmed that the rspL mutation had a significant negative effect on expression of rspU-'uidA by RspR (P < 0.0001; df = 1). Strains were grown in LB broth at 28°C with or without expression plasmids for 40 h. The concentration of 4MU product generated from 4MUG substrate by 1 µl of cells was measured relative to cellular protein, and values shown are the means and standard error for three replicates.

RspV mutation does not affect rspU expression. HrpV negatively regulates TTSS gene expression in P. syringae, possibly by negatively regulating HrpS (20). In rich growth medium, mutation of hrpV in P. syringae pv. syringae leads to an increase in expression of the HrcJ protein (provided that HrpR and HrpS are ectopically expressed) (32). To test whether RspV acts to negatively regulate expression of rspR or rspL or their protein products, rspV was mutated and its effect on rspU transcription determined using a 'uidA reporter. As observed previously, overexpression of RspR significantly increased rspU-uidA expression in the wild-type strain (mean expression levels in nM 4MU min–1 OD600–1 with standard errors: 148.41 ± 18.45 4MU min–1 OD–1 compared to basal level 2.83 ± 1.21 4MU min–1 OD–1). In the rspV mutant strain (SBW25 rspV:Tn#1112), overexpression of RspR did not result in a further increase in rspU-uidA expression (69.83 ± 26.32 4MU min–1 OD–1 compared to basal level, 2.50 ± 0.28 4MU min–1 OD–1) compared to the wild type overexpressing RspR. ANOVA indicated that the rspV mutation did not have a significant effect on the basal level of rspU-uidA expression (P= 0.1074; df = 1) or RspR-mediated expression of this (rspU) gene cluster (P = 0.1180; df = 1).

Searching for additional regulators of rsp. Low transcriptional activity of the SBW25 rsp gene cluster could have numerous causes: one possibility is that additional regulators exist but that high expression requires either activation of a positive activator or inactivation of a negative regulator. To identify such components, SBW25{Delta}dapB rspU-'dapB was mutagenized using (separately) two transposons: one a modified ISphoA/hah transposon, IS-Omegon-Km/hah, which contains an outward-facing npt promoter (to identify potential positive regulators), and the other mini-Tn5-Km (to identify repressors). Transconjugants were screened for ability to grow on minimal M9 medium (activation of a positive regulator or inactivation of a repressor would allow transcription of 'dapB, thus restoring SBW25{Delta}dapB rspU-'dapB to prototrophy).

Seven IS-Omegon-Km/hah mutants and two mini-Tn5-Kmmutants were identified from a screen of ~105 mutants (~16-fold coverage) for each transposon (assuming 6,130 genes and insertions distributed according to a Poisson distribution, then a screen of 105 mutants means that the probability of sampling every gene at least once is marginally less than 1.0; the probability of not sampling a gene is less than 0.000008), and all nine mutants grew on minimal M9 plates. No spontaneous prototrophic mutants were detected. Quantitative analysis of promoter activity using thepromoterless lacZ reporter (which is fused to rspU: rspU-'dapB-'lacZ) showed that rspU expression in all mutants increased significantly compared to that of the control strain (P = 0.0033 and df= 2 by one-way ANOVA), with the seven IS-Omegon-Km/hah mutants showing ~10-fold-greater expression than the other two.

Arbitrarily primed PCR was used to identify the genomic location of the transposon in each mutant. Interrogation of the SBW25 genome sequence showed that the seven IS-Omegon-Km/hah insertions were located immediately upstream of the rspL gene in the predicted promoter region between rspL and the rspU gene cluster (leading to greatly enhanced expression of rspU or rspL). Of the two mini-Tn5-Km insertions, one was located in a putative beta-alanine pyruvate aminotransferase gene (PFLU0675) and the second in a hypothetical gene (PFLU2224) whose protein product is predicted to have an alpha/beta hydrolase fold. The protein product of this gene showed greatest similarity (33% identity, 47% similarity) to animal proteins and is the last of a five-gene cluster with characteristics of an ABC transporter locus.

Fitness effects associated with rsp mutations indicate a general effect on bacterial growth. Previous work showed that over a 2-week period, rscR and rscT mutants of SBW25 were uncompromised in their ability to colonize the rhizosphere of the sugar beet (33). During the course of this study, several more mutants were generated (including rspR and rspL regulatory mutants), which provided additional opportunity to examine the contribution of specific rsp genes to ecological performance.

Strains containing (separately) mutations in rspR, rspL, rscR, rscT, rspV, and ropE were mixed 1:1 with wild-type SBW25 and introduced into sterile buffer contained within a 1.5-ml culture vial. The fitness of each mutant was then determined (relative to that of the wild type) by a simple 24-h colonization assay in which the ability of the mutant to competitively colonize the root tip (5 mm) of a 3-day-old sugar beet seedling was determined.

All the mutants, except the rscR and rscT mutants, showed a drop in fitness relative to the wild type (Fig. 8A). One-way ANOVA confirmed that there was significant variation in the experiment, with the rspL and rspV mutants being significantly less fit than the positive control strain, SG116.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 8. Mutations in rsp genes cause changes in bacterial fitness in the rhizosphere and growth in vitro. Competitive colonization of sugar beet root tips (A) by marker exchange mutants containing transposon insertions in ropE, rspL, rspR, rscR, rscT, or rspV. Data are means and 95% confidence intervals for three replicates and indicate the fitness of each mutant relative to the wild type, P. fluorescens SBW25, after 24 h. Values less than 0 indicate that the mutant is competitively inferior to the wild type. One-way ANOVA (P = 0.0005; df = 6) reveals a significant difference among means; significantly different values are indicated by different letters above the columns. (B) Growth dynamics of ropE, rspL, rspR, rscR, rscT, and rspV mutants in LB broth over 24 h. Broth media were seeded from starter cultures to a starting OD600 of 0.01 and the OD600 of each broth measured over time. Values are the means for three replicates and standard errors. Solid lines are P. fluorescens SBW25 (filled diamond) and SG116 (positive control; open triangle), dotted lines are structural mutants rscT (open square), rscR (filled circle), and ropE (filled square), and dashed lines are regulator mutants rspL (filled triangle), rspR (open diamond), and rspV (open circle). Note that the rspR and rscT mutant growth curves are extremely similar on this graph.

To check whether the decrease in fitness of the regulator mutants in the rhizosphere was also evident in vitro, we analyzed growth of the mutants in LB broth over 24 h. All mutants, including the rscT and rscR mutants, displayed altered growth in the initial 15 to 20 h compared to wild-type SBW25, although all strains reached equivalent cell densities after 24 h (Fig. 8B). Growth of the rspL mutant was the least impaired in vitro, but it was one of the worst-affected strains in the rhizosphere.


arrow
DISCUSSION
 
The challenges associated with understanding the functions of bacteria in complex environments are considerable—and all the more so when phenotypes associated with genes of interest do not manifest in vitro. The P. fluorescens SBW25 rsp cluster, while showing many similarities to TTSS gene clusters of pathogenic bacteria, lacks genes that encode components of the pathway essential for functionality as a type III secretion system (33). Despite this, Preston et al. (33) were able to demonstrate an Rsp-dependent hypersensitive reaction in Arabidopsis thaliana; however, such a response was dependent upon infiltration of high numbers of bacteria into leaves (33). The requirement for nonphysiological levels of bacteria, plus defects in the rspJ gene cluster, calls into question the role of rsp in a dedicated protein secretion pathway. If rsp has no role in protein secretion, then what purpose might it serve? A range of possibilities exist: it may have no biological role—it may be an "evolutionary relic" and a reflection of a previous eukaryote interaction-based lifestyle; alternatively, it may have a new function as a consequence of cooption, for example, it is possible to envisage a role for the pilus (RspA) in cell adhesion or cell-cell interactions.

If an evolutionary relic, then evidence of mutational decay ought to be apparent and evident at the level of regulation: selection will favor regulatory mutants because such mutants no longer pay the cost of expressing components that are surplus to requirement. We found little evidence of mutational decay. For a start, putative (but clearly defined) rspL (hrpL) promoter sequences are present upstream of each structural operon and upstream of the gene encoding the putative secreted ropE protein (Fig. 1). Second, all components of the rsp cluster show increased levels of expression in the rhizosphere environment (and are induced, albeit poorly, in HIM). Third, components predicted to be involved in the regulation of rsp are operable. Fourth, rsp mutants (particularly regulatory mutants) are compromised in their ability to grow in vitro and in their ability to colonize the plant rhizosphere. Together, these findings suggest that the rsp cluster has functional significance, although its function remains obscure.

In terms of regulation, the rsp pathway of P. fluorescens SBW25 shows both similarities and differences from the model of regulation developed for TTSS in P. syringae. The most significant difference is the responsiveness to environmental stimuli: the rsp pathway responds primarily to signals present in the rhizosphere and with the exception of the rspC promoter (which has a basal level of expression independent of RspL) is insensitive to phyllosphere-derived signals. In contrast, the TTSS of P. syringae is induced in the leaf apoplast; interestingly, the hrpA-uidA fusion of DC3000 used here was induced by both the root and the shoot of Arabidopsis thaliana seedlings, thus showing little evidence of plant tissue-specific expression. The most striking evidence of difference in inducing signals came from the analysis of gene expression in Hrp-inducing medium (HIM), a medium that mimics the plant apoplast environment. In DC3000, HIM caused an approximately 28-fold increase in expression, whereas in P. fluorescens SBW25, the increase in rsp expression was, while statistically significant, modest (two- to fivefold). Despite poor induction in HIM, ectopic expression of the alternate sigma factor (RspL) showed that rsp gene expression has the potential to increase ~100-fold. A further distinction concerns RspV: our studies here failed (under the conditions tested) to provide evidence of a negative regulatory role; in fact, a slight decrease in rspU expression was observed following inactivation of rspV.

Similarities in regulation were also noted. For example, the regulatory cascade controlling expression of rsp in P. fluorescens mirrors that found in P. syringae. In P. fluorescens the HrpRS homolog, RspR, controls expression of the rspL gene, and RspL activates transcription of the structural genes and putative effector, ropE. This indicates that RspR sits higher in the regulatory hierarchy than RspL. It also indicates that in the absence of a HrpS homologue, the single regulatory component (RspR) is sufficient to activate rspL. This suggests that RspR functions as a homodimer: in P. syringae, there is a heterodimeric association between HrpR and HrpS (19).

Motivated by the need to understand further the reasons for low induction of rsp in laboratory media, we considered the possibility of additional regulators and sought their existence (and identity) using a mutagenesis strategy. Following an intensive mutant screen (16-fold coverage of the genome) based upon conversion to prototrophy, nine "regulator" mutants were found. Seven were caused by IS-Omegon-Km/hah: in each instance the transposon was located immediately upstream of rspL. Given that IS-Omegon-Km/hah carries an internal kanamycin promoter capable of activating downstream genes, this set of mutants implicates RspL as a positive activator of rsp transcription—a fact already established (see above) but one that nicely demonstrates the utility of this approach. No additional positive regulators were found, and no insertions were found upstream of rspR (failure to detect rspR-activating insertions may reflect the complexity of EBP-dependent transcription). Mutagenesis with mini-Tn5-Km, a transposon with strong polar effects (8), resulted in two prototrophic mutants but none with obvious regulatory ties to rspR or rspL. However, one mutation was located in a beta-alanine pyruvate aminotransferase gene (PFLU0675), whose protein product is predicted to be involved in the conversion of alanine to pyruvate. Previously, Dacheux et al. (7) showed that mutation of the P. aeruginosa aceAB genes (which encode pyruvate dehydrogenase and convert pyruvate to acetyl-coenzyme A) leads to a decrease of TTSS-dependent cytotoxicity in human polymorphonuclear cells. Furthermore, transcription of the exsCBA (TTSS) operon is not inducible in the aceAB mutants. It is possible that our discovery mirrors that described for P. aeruginosa, where it appears that pyruvate metabolism plays a role in TTSS gene expression; it is also consistent with the more general suggestion that the metabolic status of the cell is a "sensor" for induction of TTSS—at least in P. aeruginosa (38)—and of rsp in P. fluorescens.

In previous work (33), using a 2-week rhizosphere colonization assay, we failed to detect a fitness effect due to mutations in rsp structural genes. Armed with a new set of mutants, we devised a root colonization assay where colonization was dependent upon bacteria actively adhering to and spreading along the root surface from a liquid reservoir. To our surprise we found significant differences in fitness due to mutations in rsp, primarily in the regulators of rsp. Such pronounced defects prompted an examination of the growth of mutants in laboratory medium. Contrary to expectation, some mutants displayed significantly altered growth dynamics (e.g., the rspR, rspV, rscT, and rscR mutants).

While the rhizosphere colonization data support a role for rsp in colonization, the discovery of more general effects in laboratory medium suggests otherwise. These data are difficult to reconcile: on one hand we found low to negligible expression of all rsp components (except rspC) in vitro, and yet mutants show significant growth defects in laboratory medium. This suggests that defects in the rsp pathway and in rsp regulators impair growth of laboratory-grown cells. It is particularly puzzling that the rspV and rspR regulatory mutants show strong defects in vitro, but mutations in the more specific regulator rspL do not. Without additional work we can but speculate, but these data strongly suggest a more significant and general effect of rsp mutations on the cellular functioning of SBW25 than is currently appreciated. Most analyses of TTSS mutants have focused on host interactions rather than fitness in vitro, and it may be that this finding is not unique to mutants of the rsp pathway of SBW25. Research into this phenomenon is further complicated by the fact that plasmids and cosmids expressing rsp structural genes and rsp regulators also impair growth of P. fluorescens SBW25 and rsp mutants (33; R. Jackson,G. Preston, and P. Rainey, unpublished), indicating that the stoichiometry and expression levels of rsp-encoded proteins are tightly regulated in SBW25. This effect has also been noted for Erwinia carotovora (25).

Elucidation of the biological function and ecological significance of the P. fluorescens SBW25 rsp pathway remains a significant challenge. Here we have shown that rsp is an integral component of the SBW25 cell, that its expression is controlled by an intact regulatory network, and that the network is responsive to signals from the plant rhizosphere. Despite the challenges ahead, the analysis of pathways such as that of rsp that do not conform to the expected paradigms offers, in the long term, potentially new insights into the biology of bacteria and, importantly, insights into the biology of bacteria in their natural environment.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the BBSRC (United Kingdom) and carried out under Department for Environment, Food and Rural Affairs license PHL225/4534. G.M.P. is a Royal Society University Research Fellow.

We thank Nicolas Bertrand and Alan Collmer for providing constructs and John Mansfield and Darby Brown for access to prepublished experimental data, and we are grateful to Chris Knight for help with statistical analyses and John Baker for photography.


arrow
FOOTNOTES
 
* Corresponding author. Present address: Dept. of Biology & Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY, United Kingdom. Phone: (01225) 385916. Fax: (01225) 386779. E-mail: RJ218{at}bath.ac.uk. Back


arrow
REFERENCES
 
    1
  1. Alfano, J. R., A. O. Charkowski, W.-L. Deng, J. L. Badel, T. Petnicki-Ocwieja, K. van Dijk, and A. Collmer. 2000. The Pseudomonas syringae Hrp pathogenicity island has a tripartite mosaic structure composed of a cluster of type III secretion genes bound by exchangeable effector and conserved effector loci that contribute to parasitic fitness and pathogenicity in plants. Proc. Natl. Acad. Sci. USA 97:4856-4861.[Abstract/Free Full Text]
  2. 2
  3. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  4. 3
  5. Bogdanove, A. J., J. F. Kim, Z. Wei, P. Kolchinsky, A. O. Charkowski, A. K. Conlin, A. Collmer, and S. V. Beer. 1998. Homology and functional similarity of an hrp-linked pathogenicity locus, dspEF, of Erwinia amylovora and the avirulence locus avrE of Pseudomonas syringae pathovar tomato. Proc. Natl. Acad. Sci. USA 95:1325-1330.[Abstract/Free Full Text]
  6. 4
  7. Bretz, J., L. Losada, K. Lisboa, N. Thareja, and S. W. Hutcheson. 2002. Lon protease functions as a negative regulator of type III protein secretion in Pseudomonas syringae. Mol. Microbiol. 45:397-409.[CrossRef][Medline]
  8. 5
  9. Charity, J., K. Pak, and S. Hutcheson. 2003. Novel exchangeable effector loci associated with the hrp pathogenicity island of P. syringae: evidence for integron-like assembly from transposed gene cassettes. Mol. Plant-Microbe. Interact. 16:495-507.[Medline]
  10. 6
  11. Cuppels, D. A., and T. Ainsworth. 1995. Molecular and physiological characterization of Pseudomonas syringae pv. tomato and Pseudomonas syringae pv. maculicola strains that produce the phytotoxin coronatine. Appl. Environ. Microbiol. 61:3530-3536.[Abstract]
  12. 7
  13. Dacheux, D., O. Epaulard, A. de Groot, B. Guery, R. Leberre, I. Attree, B. Polack, and B. Toussaint. 2002. Activation of the Pseudomonas aeruginosa type III secretion system requires an intact pyruvate dehydrogenase aceAB operon. Infect. Immun. 70:3973-3977.[Abstract/Free Full Text]
  14. 8
  15. de Lorenzo, V., M. Herrero, U. Jakubzik, and K. N. Timmis. 1990. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J. Bacteriol. 172:6568-6572.[Abstract/Free Full Text]
  16. 9
  17. Deng, W. L., A. Rehm, A. Charkowski, C. Rojas, and A. Collmer. 2003. Pseudomonas syringae exchangeable effector loci: sequence diversity in representative pathovars and virulence function in P. syringae pv. syringae B728a. J. Bacteriol. 185:2592-2602.[Abstract/Free Full Text]
  18. 10
  19. Fouts, D. E., R. B. Abramovitch, J. R. Alfano, A. M. Baldo, C. R. Buell, S. Cartinhour, A. K. Chatterjee, M. D'Ascenzo, M. L. Gwinn, S. G. Lazarowitz, N. C. Lin, G. B. Martin, A. H. Rehm, D. J. Schneider, K. van Dijk, X. Tang, and A. Collmer. 2002. Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters controlled by the HrpL alternative sigma factor. Proc. Natl. Acad. Sci. USA 99:2275-2280.[Abstract/Free Full Text]
  20. 11
  21. Gal, M., G. M. Preston, R. C. Massey, A. J. Spiers, and P. B. Rainey. 2003. Genes encoding a cellulosic polymer contribute toward the ecological success of Pseudomonas fluorescens SBW25 on plant surfaces. Mol. Ecol. 43:159-171.
  22. 12
  23. Gaudriault, S., L. Malandrin, J. P. Paulin, and M. A. Barny. 1997. DspA, an essential pathogenicity factor of Erwinia amylovora showing homology with AvrE of Pseudomonas syringae, is secreted via the Hrp secretion pathway in a DspB-dependent way. Mol. Microbiol. 26:1057-1069.[CrossRef][Medline]
  24. 13
  25. Grimm, C., and N. J. Panopoulos. 1989. The predicted protein product of a pathogenicity locus from Pseudomonas syringae pv. phaseolicola is homologous to a highly conserved domain of several prokaryotic regulatory proteins. J. Bacteriol. 171:5031-5038.[Abstract/Free Full Text]
  26. 14
  27. Grimm, C., W. Aufsatz, and N. J. Panopoulos. 1995. The hrpRS locus of Pseudomonas syringae pv. phaseolicola constitutes a complex regulatory unit. Mol. Microbiol. 15:155-165.[CrossRef][Medline]
  28. 15
  29. Haas, D., and C. Keel. 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. and relevance for biological control of plant disease. Annu. Rev. Phytopathol. 41:117-153.[CrossRef][Medline]
  30. 16
  31. Heil, M., and R. M. Bostock. 2002. Induced systemic resistance (ISR) against pathogens in the context of induced plant defences. Ann. Bot. (London) 89:503-512.[Abstract/Free Full Text]
  32. 17
  33. Hendrickson, E. L., P. Guevera, and F. M. Ausubel. 2000. The alternative sigma factor RpoN is required for hrp activity in Pseudomonas syringae pv. maculicola and acts at the level of hrpL transcription. J. Bacteriol. 182:3508-3516.[Abstract/Free Full Text]
  34. 18
  35. Huang, H.-C., S. W. Hutcheson, and A. Collmer. 1991. Characterization of the hrp cluster from Pseudomonas syringae pv. syringae 61 and TnphoA tagging of genes encoding exported or membrane-spanning Hrp proteins. Mol. Plant-Microbe Interact. 4:469-476.
  36. 19
  37. Hutcheson, S. W., J. Bretz, T. Sussan, S. Jin, and K. Pak. 2001. The enhancer binding protein HrpR and HrpS interact to regulate hrp-encoded type III protein secretion in Pseudomonas syringae strains. J. Bacteriol. 183:5589-5598.[Abstract/Free Full Text]
  38. 20
  39. Hutcheson, S. W., J. R. Bretz, J. C. Charity, L. Losada, and T. Sussan. 2003. Regulation and detection of effectors translocated by Pseudomonas syringae, p. 147-156. In N. S. Iacobellis et al. (ed.), Pseudomonas syringae and related pathogens. Kluwer Academic Publishers, Dordrecht, The Netherlands.
  40. 21
  41. Innes, R. W., A. F. Bent, B. N. Kunkel, S. R. Bisgrove, and B. J. Staskawicz. 1993. Molecular analysis of avirulence gene avrRpt2 and identification of a putative regulatory sequence common to all known Pseudomonas syringae avirulence genes. J. Bacteriol. 175:4859-4869.[Abstract/Free Full Text]
  42. 22
  43. King, E. O., M. K. Ward, and D. E. Raney. 1954. Two simple media for the demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med. 44:301-307.[Medline]
  44. 23
  45. Kobayashi, D., S. J. Tamaki, and N. T. Keen. 1989. Cloned avirulence genes from the tomato pathogen Pseudomonas syringae pv. tomato confer cultivar specificity on soybean. Proc. Natl. Acad. Sci. USA 8:157-161.
  46. 24
  47. Labes, M., A. Pühler, and R. Simon. 1990. A new family of RSF1010-derived and lac-fusion broad-host-range vectors for Gram-negative bacteria. Gene 89:37-46.[CrossRef][Medline]
  48. 25
  49. Lehtimahki, S., A. Rantakari, J. Routtu, A. Tuikkala, J. Li, O. Virtaharju, E. T. Palva, M. Romantschuk, and H. T. Saarilahti. 2003. Characterization of the hrp pathogenicity cluster of Erwinia carotovora subsp. carotovora: high basal level expression in a mutant is associated with reduced virulence. Mol. Gen. Genomics 270:263-272.[CrossRef][Medline]
  50. 26
  51. Lenski, R. E., M. R. Rose, S. C. Simpson, and S. C. Tadler. 1991. Long-term experimental evolution in Escherichia coli. I. Adaptation and divergence during 2,000 generations. Am. Nat. 138:1315-1341.[CrossRef]
  52. 27
  53. Lindgren, P. B., R. Frederick, A. G. Govindarajan, N. J. Panopoulos, B. J. Staskawicz, and S. E. Lindow. 1989. An ice nucleation reporter gene system: identification of inducible pathogenicity genes in Pseudomonas syringae pv. phaseolicola. EMBO J. 8:1291-1301.[Medline]
  54. 28
  55. Lorang, J. M., and N. T. Keen. 1995. Characterization of avrE from Pseudomonas syringae pv. tomato: a hrp-linked avirulence locus consisting of at least two transcriptional units. Mol. Plant-Microbe Interact. 8:49-57.[Medline]
  56. 29
  57. Manoil, C. 2000. Tagging exported proteins using Escherichia coli alkaline phosphatase gene fusions. Methods Enzymol. 326:35-47.[CrossRef][Medline]
  58. 30
  59. Mudgett, M. B., and B. J. Staskawicz. 1999. Characterization of the Pseudomonas syringae pv. tomato AvrRpt2 protein: demonstration of secretion and processing during bacterial pathogenesis. Mol. Microbiol. 32:927-941.[CrossRef][Medline]
  60. 31
  61. Naseby, D. C., J. A. Way, N. J. Bainton, and J. M. Lynch. 2001. Biocontrol of Pythium in the pea rhizosphere by antifungal metabolite producing and non-producing Pseudomonas strains. J. Appl. Microbiol. 90:421-429.[CrossRef][Medline]
  62. 32
  63. Preston, G., W. L. Deng, H. C. Huang, and A. Collmer. 1998. Negative regulation of hrp genes in Pseudomonas syringae by HrpV. J. Bacteriol. 180:4532-4537.[Abstract/Free Full Text]
  64. 33
  65. Preston, G. M., N. Bertrand, and P. B. Rainey. 2001. Type III secretion in plant growth-promoting Pseudomonas fluorescens SBW25. Mol. Microbiol. 41:999-1014.[CrossRef][Medline]
  66. 34
  67. Preston, G. M. 2004. Plant perceptions of plant growth-promoting Pseudomonas. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359:907-918.[Abstract/Free Full Text]
  68. 35
  69. Rahme, L. G., M. N. Mindrinos, and N. J. Panopoulos. 1992. Plant and environmental sensory signals control the expression of hrp genes in Pseudomonas syringae pv. phaseolicola. J. Bacteriol. 174:3499-3507.[Abstract/Free Full Text]
  70. 36
  71. Rainey, P. B. 1999. Adaptation of Pseudomonas fluorescens to the plant rhizosphere. Environ. Microbiol. 1:243-257.[CrossRef][Medline]
  72. 37
  73. Rainey, P. B., and M. J. Bailey. 1996. Physical and genetic map of the Pseudomonas fluorescens SBW25 chromosome. Mol. Microbiol. 19:521-533.[CrossRef][Medline]
  74. 38
  75. Rietsch, A., M. C. Wolfgang, and J. J. Mekalanos. 2004. Effect of metabolic imbalance on expression of type III secretion genes in Pseudomonas aeruginosa. Infect. Immun. 72:1383-1390.[Abstract/Free Full Text]
  76. 39
  77. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning—a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  78. 40
  79. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Biotechnology. 1:784-791.[CrossRef]
  80. 41
  81. Xiao, Y., Y. Lu, S. Heu, and S. W. Hutcheson. 1992. Organization and environmental regulation of the Pseudomonas syringae pv. syringae 61 hrp cluster. J. Bacteriol. 174:1734-1741.[Abstract/Free Full Text]
  82. 42
  83. Xiao, Y., and S. W. Hutcheson. 1994. A single promoter sequence recognized by a newly identified alternate sigma factor directs expression of pathogenicity and host range determinants in Pseudomonas syringae. J. Bacteriol. 176:3089-3091.[Abstract/Free Full Text]
  84. 43
  85. Xiao, Y., S. Heu, J. Yi, Y. Lu, and S. W. Hutcheson. 1994. Identification of a putative alternate sigma factor and characterization of a multicomponent regulatory cascade controlling the expression of Pseudomonas syringae pv. syringae Pss61 hrp and hrmA genes. J. Bacteriol. 176:1025-1036.[Abstract/Free Full Text]
  86. 44
  87. Zhang, X.-X., A. K. Lilley, M. J. Bailey, and P. B. Rainey. 2004. The indigenous Pseudomonas plasmid pQBR103 encodes plant-inducible genes including three putative helicases. FEMS Microbiol. Ecol. 51:9-17.


Journal of Bacteriology, December 2005, p. 8477-8488, Vol. 187, No. 24
0021-9193/05/$08.00+0     doi:10.1128/JB.187.24.8477-8488.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Moynihan, J. A., Morrissey, J. P., Coppoolse, E. R., Stiekema, W. J., O'Gara, F., Boyd, E. F. (2009). Evolutionary History of the phl Gene Cluster in the Plant-Associated Bacterium Pseudomonas fluorescens. Appl. Environ. Microbiol. 75: 2122-2131 [Abstract] [Full Text]  
  • Giddens, S. R., Jackson, R. W., Moon, C. D., Jacobs, M. A., Zhang, X.-X., Gehrig, S. M., Rainey, P. B. (2007). Mutational activation of niche-specific genes provides insight into regulatory networks and bacterial function in a complex environment. Proc. Natl. Acad. Sci. USA 104: 18247-18252 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jackson, R. W.
Right arrow Articles by Rainey, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jackson, R. W.
Right arrow Articles by Rainey, P. B.