Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Ueki, T. Articles by Inouye, S. Search for Related Content PubMed PubMed Citation Articles by Ueki, T. Articles by Inouye, S.

 Previous Article

Journal of Bacteriology, December 2005, p. 8537-8541, Vol. 187, No. 24
0021-9193/05/$08.00+0     doi:10.1128/JB.187.24.8537-8541.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

SigF, a New Sigma Factor Required for a Motility System of Myxococcus xanthus

Toshiyuki Ueki, Chun-Ying Xu, and Sumiko Inouye^*

Department of Biochemistry, Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, New Jersey 08854

Received 24 July 2005/ Accepted 12 September 2005

Top Abstract Text References

 
A new sigma factor, SigF, was identified from the social and developmental bacterium Myxococcus xanthus. SigF is required for fruiting body formation during development as well as social motility during vegetative growth. Analysis of gene expression indicates that it is possible that the sigF gene is involved in regulation of an unidentified gene for social motility.

Top Abstract Text References

 
The sigma factor is a subunit of RNA polymerase in bacteria and functions as a transcription activator by binding core RNA polymerase and recognizing specific promoter elements, resulting in the initiation of transcription. Thus, sigma factors play key roles in the regulation of gene expression in bacteria.

The social and developmental bacterium Myxococcus xanthus is known to possess at least eight sigma factors. SigA is the major sigma factor and is essential for vegetative growth (11). Unusually, RpoN was shown to be essential for vegetative growth (13) and is likely to regulate genes involved in fruiting body development (12, 19). SigB (1), SigC (2), and SigE (23) show high sequence similarity to heat shock sigma factors, whereas they are dispensable for the production of heat shock proteins (23). Instead, they control gene expression during fruiting body development and it appears that they have redundant roles in sporulation (23). SigD is the stationary-phase sigma factor and is necessary for adaptation to various stresses and for development (22). It is proposed that RpoE1 might be involved in regulation of motility (25). CarQ has been shown to be necessary for light-induced carotenoid synthesis (17). CarQ and RpoE1 belong to the ECF (extracytoplasmic function) sigma factor subfamily (15).

To further characterize M. xanthus development, we searched the preliminary M. xanthus genome sequence (The Institute for Genomic Research website at http://www.tigr.org) for a new sigma factor by using region 2 of SigA. Six open reading frames (ORFs) were identified, and five of them were found to be the previously identified SigA, SigB, SigC, SigD, and SigE (data not shown). The other ORF was named SigF and was found to consist of 264 amino acid residues. The third bases of codons of SigF show 90% GC content, typical of M. xanthus ORFs. The amino acid sequence of SigF was compared with those of other sigma factors of M. xanthus, except for RpoN, as shown in Fig. 1. SigF contains conserved regions 2, 3, and 4 and also shows high similarity to other bacterial sigma factors. When we conducted Southern blot analysis to identify genes encoding sigma factors from M. xanthus chromosomal DNA, only five genes, sigA, sigB, sigC, sigD, and sigE, were detected by an oligonucleotide probe encoding amino acid residues DLIQEGNIGLMKAV of SigA (23). These residues are located at the most conserved subregion, region 2.2 (Fig. 1). SigF has six different amino acid residues and 12 different nucleotides in this region, while SigB, SigC, SigD, and SigE have fewer than three different amino acid residues and fewer than 5 different nucleotides. This may be the reason why the sigF gene was not detected by Southern blot analysis. Furthermore, it appears that SigF lacks region 1.2 and that SigF is notably divergent from the others in the helix-turn-helix motif of region 4.2, which is involved in promoter –35 region recognition.

View larger version (84K): [in this window] [in a new window]

FIG. 1. Alignment of amino acid sequences of sigma factors of M. xanthus. The functions of the subregions are denoted below the sequences (7, 14). The amino acid residues conserved in more than three sigma factors are indicated by black backgrounds. Numbers on the right-hand side indicate residues from the N-terminal ends. The subregions are denoted by the dotted lines under the sequences (14). Potential helix-turn-helix motifs are underlined.

To elucidate the function of the sigF gene, the expression of the sigF gene was examined by primer extension analysis. Total RNA was prepared from vegetative cells in CYE liquid medium (4) and 12-h-developmental cells on CF agar plates (6). As shown in Fig. 2A, sigF mRNA was detected from both vegetative and developmental cells. Three different 5' ends (P1, P2, and P3) of the mRNA were detected during vegetative growth, and only one of them (P1) was detected during development. From these results, putative –35 and –10 elements of the promoters were assigned, as shown in Fig. 2B. These results suggest that SigF functions in both vegetative growth and development.

View larger version (36K): [in this window] [in a new window]

FIG. 2. Expression of the sigF gene. (A) Primer extension analysis. Total RNA was prepared from vegetative cells in CYE liquid medium (lane V) and 12-h-developmental cells on CF agar plates (lane D). Lanes G, A, T, and C represent sequence ladders generated by the same primer used in the primer extension reaction. (B) Sequences of the promoter region of the sigF gene. The 5' ends of the mRNA are indicated by arrows. The initiation codon is indicated by Met. The region corresponding to the primer (5'CAAAGGACACGTTCAGGTTGA3') used in the primer extension analysis is underlined.

To further elucidate the function of the sigF gene, an insertion mutant of the sigF gene (sigF::km) was constructed. For the construction of the mutant strain, a kanamycin resistance gene was inserted in the unique BamHI site located in the sigF gene encoding the open reading frame. The insertion mutation was introduced into M. xanthus DZF1 by the electroporation method. The insertion was confirmed by PCR amplification. Note that it appears that the next putative downstream gene is in the opposite orientation (data not shown). Therefore, the phenotype of sigF::km is very likely due to the insertion in the sigF gene, rather than a polar effect. Although sigF mRNA was detected in vegetative cells, the mutant grew in CYE liquid medium similarly to the parent strain, DZF1 (10) (data not shown). Since a heat shock sigma factor has not been identified, the response of the mutant to heat shock was examined. However, the mutant showed a growth curve similar to that of the parent after heat shock at 40°C (data not shown), suggesting that it is unlikely that SigF is the major heat shock sigma factor in M. xanthus. Then, the effect of the mutation of the sigF gene on development was examined, since the sigF gene was also expressed during development. The parent and the mutant were spotted on CF and TPM agar plates (6). As shown in Fig. 3A, the mutant appeared to aggregate but formed abnormal fruiting bodies, which were not as dark as those of the parent strain, on CF plates under the condition where the parent was able to form fruiting bodies. However, the mutant was capable of forming spores with an efficiency similar to that of the parent during development. The sporulation efficiency was measured by plating spores on CYE agar medium. The mutant spores were as viable as parental spores when they were plated on CYE agar medium after sonication treatment, as described previously (1) (data not shown). Furthermore, defective fruiting body formation of the mutant was pronounced when it was spotted on TPM agar plates. It should be noted that TPM agar plates contain less nutrition than CF agar plates. The mutant was still able to form spores on TPM agar plates with an efficiency similar to that of the parent. Surprisingly, this defect was suppressed when the mutant was spotted at a lower cell density, as shown in Fig. 3B (2 x 10⁹ cells/ml in Fig. 3B versus 1 x 10¹⁰ cells/ml in Fig. 3A). These results suggest that the sigF gene was necessary for fruiting body formation on TPM agar at high cell density and that the sigF mutant might be incapable of sensing environmental signals and/or of communicating with surrounding cells.

View larger version (44K): [in this window] [in a new window]

FIG. 3. Fruiting body development. DZF1 and sigF::km cells were spotted on CF and TPM agar plates at densities of 1 x 1010 cells/ml (A) and 2 x 109 cells/ml (B). Photographs were taken by a Polaroid camera under a dissecting microscope after a 5-day incubation at 30°C.

Motility is known to be crucial for fruiting body formation of M. xanthus, and M. xanthus utilizes two motility systems, called adventurous (A) and social (S) (8, 9). Therefore, the defective fruiting body formation of the sigF::km strain might result from defects in cellular motility. Thus, motility behavior of the mutant was examined by spotting vegetative cells on CYE agar (0.3 and 1.5%) plates. Mutants that lack A motility but retain S motility are typically able to spread well on 0.3% agar but poorly on 1.5% agar (20). In contrast, mutants that lack S motility but retain A motility are typically able to spread well on 1.5% agar but poorly on 0.3% agar (20). The colony edge of the parent appeared to be flared on 0.3% agar plates, while that of the mutant remained smooth (Fig. 4A), indicating that the mutant was nonmotile. On the contrary, the mutant showed motility behavior similar to that of the parent on 1.5% agar plates (Fig. 4B). These results suggest that the mutant was defective in S motility. It should be noted that the parent strain (DZF1) used in this study is known to be partially defective in social motility because of a leaky mutation in sglA1.

View larger version (63K): [in this window] [in a new window]

FIG. 4. Motility behavior during vegetative growth. Vegetative cells of DZF1 and sigF::km strains were spotted on CYE plates containing 0.3% (A) and 1.5% (B) agar at a density of 5 x 108 cells/ml and incubated at 30°C for 3 days. Photographs of the entire colony were taken directly by a Polaroid camera. Photographs of the colony edge were taken by a Polaroid camera under a dissecting microscope.

Since the sigF gene was involved in S motility, it is likely that SigF regulates the expression of genes involved in S motility. A number of genes involved in S motility have been identified (16, 21). Although the sigF mutant did not display the characteristic "frizzy" appearance of frz mutants and the frizzy phenotype does not depend on cell density and the medium, the sigF mutant showed developmental phenotypes similar to those of frz mutants: (i) little S motility at the colony edge, (ii) defective fruiting body formation, and (iii) ability to sporulate (27). The Frz system exhibits similarity to the chemotaxis system of enteric bacteria (27). Thus, it is possible that the sigF gene is involved in the Frz system. Expression of frz genes was examined by primer extension analysis. However, frz genes were expressed in the mutant similarly to the parent (data not shown). In addition, FrzCD methylation, which is essential in Frz signal transduction (27), was observed with the mutant (data not shown). Therefore, it is unlikely that the Frz system is regulated by SigF. Then, the expression levels of other genes involved in S motility, pilA (24), rpoE1 (25), abcA (26), frgA (5), difA (29), the grpS-sglK operon (28, 30), sasA (3), and the tgl operon (18), were examined by primer extension analysis. Surprisingly, all of them were expressed in the mutant (data not shown). Therefore, it is possible that the sigF gene is involved in regulation of an unidentified gene for social motility.

 
Preliminary sequence data were obtained from The Institute for Genomic Research website at http://www.tigr.org.

We are grateful to D. R. Zusman for the frzCD::tac1W4017 strain and the FrzCD antibody. We thank H. Nariya for helpful discussions.

This work was supported by a grant from the Foundation of University of Medicine and Dentistry of New Jersey.

 
* Corresponding author. Mailing address: Department of Biochemistry, Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, NJ 08854. Phone: (732) 235-4161. Fax: (732) 235-4559. E-mail: inouyesu{at}umdnj.edu.

Top Abstract Text References

 

1
1. Apelian, D., and S. Inouye. 1990. Development-specific sigma-factor essential for late-stage differentiation of Myxococcus xanthus. Genes Dev. 4:1396-1403.[Abstract/Free Full Text]
2
2. Apelian, D., and S. Inouye. 1993. A new putative sigma factor of Myxococcus xanthus. J. Bacteriol. 175:3335-3342.[Abstract/Free Full Text]
3
3. Bowden, M. G., and H. G. Kaplan. 1998. The Myxococcus xanthus lipopolysaccharide O-antigen is required for social motility and multicellular development. Mol. Microbiol. 30:275-284.[CrossRef][Medline]
4
4. Campos, J. M., J. Geisselsoder, and D. R. Zusman. 1978. Isolation of bacteriophage Mx-4, a generalized transducing phage for Myxococcus xanthus. J. Mol. Biol. 119:167-178.[CrossRef][Medline]
5
5. Cho, K., A. Treuner-Lange, K. A. O'Connor, and D. R. Zusman. 2000. Developmental aggregation of Myxococcus xanthus requires frgA, an frz-related gene. J. Bacteriol. 182:6614-6621.[Abstract/Free Full Text]
6
6. Hagen, D. C., A. P. Bretscher, and D. Kaiser. 1978. Synergism between morphogenetic mutants of Myxococcus xanthus. Dev. Biol. 64:284-296.[CrossRef][Medline]
7
7. Helmann, J. D., and M. J. Chamberlin. 1988. Structure and function of bacterial sigma factors. Annu. Rev. Biochem. 57:839-872.[CrossRef][Medline]
8
8. Hodgkin, J., and D. Kaiser. 1979. Genetics of gliding motility in Myxococcus xanthus (Myxobacterales): genes controlling movement of single cells. Mol. Gen. Genet. 171:167-176.[CrossRef]
9
9. Hodgkin, J., and D. Kaiser. 1979. Genetics of gliding motility in Myxococcus xanthus (Myxobacterales): two gene systems control movement. Mol. Gen. Genet. 171:177-191.[CrossRef]
10
10. Inouye, M., S. Inouye, and D. R. Zusman. 1979. Gene expression during development of Myxococcus xanthus: pattern of protein synthesis. Dev. Biol. 68:579-591.[CrossRef][Medline]
11
11. Inouye, S. 1990. Cloning and DNA sequence of the gene coding for the major sigma factor from Myxococcus xanthus. J. Bacteriol. 172:80-85.[Abstract/Free Full Text]
12
12. Keseler, I. M., and D. Kaiser. 1995. An early A-signal-dependent gene in Myxococcus xanthus has a ⁵⁴-like promoter. J. Bacteriol. 177:4638-4644.[Abstract/Free Full Text]
13
13. Keseler, I. M., and D. Kaiser. 1997. Sigma⁵⁴, a vital protein for Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 94:1979-1984.[Abstract/Free Full Text]
14
14. Lonetto, M. A., M. Gribskov, and C. A. Gross. 1992. The ⁷⁰ family: sequence conservation and evolutionary relationships. J. Bacteriol. 174:3843-3849.[Free Full Text]
15
15. Lonetto, M. A., K. L. Brown, K. E. Rudd, and M. J. Buttner. 1994. Analysis of the Streptomyces coelicolor sigE gene reveals the existence of a subfamily of bacterial RNA polymerase sigma factors involved in the regulation of extracytoplasmic functions. Proc. Natl. Acad. Sci. USA 91:7573-7577.[Abstract/Free Full Text]
16
16. McBride, M. J. 2001. Bacterial gliding motility: multiple mechanisms for cell movement. Annu. Rev. Microbiol. 55:49-75.[CrossRef][Medline]
17
17. McGowan, S. J., H. C. Gorham, and D. A. Hodgson. 1993. Light-induced carotenogenesis in Myxococcus xanthus: DNA sequence analysis of the carR region. Mol. Microbiol. 10:713-735.[CrossRef][Medline]
18
18. Rodriguez-Soto, J. P., and D. Kaiser. 1997. Identification and localization of the Tgl protein, which is required for Myxococcus xanthus social motility. J. Bacteriol. 179:4372-4381.[Abstract/Free Full Text]
19
19. Romeo, J. M., and D. R. Zusman. 1991. Transcription of the myxobacterial hemagglutinin gene is mediated by a ⁵⁴-like promoter and a cis-acting upstream regulatory region of DNA. J. Bacteriol. 173:2969-2976.[Abstract/Free Full Text]
20
20. Shi, W., and D. R. Zusman. 1993. The two motility systems of Myxococcus xanthus show different selective advantages on various surfaces. Proc. Natl. Acad. Sci. USA 90:3378-3382.[Abstract/Free Full Text]
21
21. Spormann, A. M. 1999. Gliding motility in bacteria: insights from studies of Myxococcus xanthus. Microbiol. Mol. Biol. Rev. 63:621-641.[Abstract/Free Full Text]
22
22. Ueki, T., and S. Inouye. 1998. A new sigma factor, SigD, essential for stationary phase is also required for multicellular differentiation in Myxococcus xanthus. Genes Cells 3:371-385.[Abstract]
23
23. Ueki, T., and S. Inouye. 2001. SigB, SigC, and SigE from Myxococcus xanthus homologous to sigma32 are not required for heat shock response but for multicellular differentiation. J. Mol. Microbiol. Biotechnol. 3:287-293.[Medline]
24
24. Wall, D., and D. Kaiser. 1999. Type IV pili and cell motility. Mol. Microbiol. 32:1-10.[CrossRef][Medline]
25
25. Ward, M. J., H. Lew, A. Treuner-Lange, and D. R. Zusman. 1998. Regulation of motility behavior in Myxococcus xanthus may require an extracytoplasmic-function sigma factor. J. Bacteriol. 180:5668-5675.[Abstract/Free Full Text]
26
26. Ward, M. J., K. C. Mok, D. P. Astling, H. Lew, and D. R. Zusman. 1998. An ABC transporter plays a developmental aggregation role in Myxococcus xanthus. J. Bacteriol. 180:5697-5703.[Abstract/Free Full Text]
27
27. Ward, M. J., and D. R. Zusman. 1999. Motility in Myxococcus xanthus and its role in developmental aggregation. Curr. Opin. Microbiol. 2:624-629.[CrossRef][Medline]
28
28. Weimer, R. M., C. Creighton, A. Stassinopoulos, P. Youderian, and P. L. Hartzell. 1998. A chaperone in the HSP70 family controls production of extracellular fibrils in Myxococcus xanthus. J. Bacteriol. 180:5357- 5368.[Abstract/Free Full Text]
29
29. Yang, Z., Y. Geng, D. Xu, H. B. Kaplan, and W. Shi. 1998. A new set of chemotaxis homologues is essential for Myxococcus xanthus social motility. Mol. Microbiol. 30:1123-1130.[CrossRef][Medline]
30
30. Yang, Z., Y. Geng, and W. Shi. 1998. A DnaK homolog in Myxococcus xanthus is involved in social motility and fruiting body formation. J. Bacteriol. 180:218-224.[Abstract/Free Full Text]

---

Journal of Bacteriology, December 2005, p. 8537-8541, Vol. 187, No. 24
0021-9193/05/$08.00+0     doi:10.1128/JB.187.24.8537-8541.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Ueki, T. Articles by Inouye, S. Search for Related Content PubMed PubMed Citation Articles by Ueki, T. Articles by Inouye, S.