JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Otsuka, M.
Right arrow Articles by Moriyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Otsuka, M.
Right arrow Articles by Moriyama, Y.
Journal of Bacteriology, March 2005, p. 1552-1558, Vol. 187, No. 5
0021-9193/05/$08.00+0     doi:10.1128/JB.187.5.1552-1558.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Identification of Essential Amino Acid Residues of the NorM Na+/Multidrug Antiporter in Vibrio parahaemolyticus

Masato Otsuka,1,2 Makoto Yasuda,2 Yuji Morita,3 Chie Otsuka,1 Tomofusa Tsuchiya,3 Hiroshi Omote,2 and Yoshinori Moriyama1,2*

Department of Genomics and Proteomics, Advanced Science Research Center,1 Departments of Biochemistry,2 Microbiology, Faculty of Pharmaceutical Sciences, Okayama University, Okayama, Japan3

Received 9 August 2004/ Accepted 1 December 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NorM is a member of the multidrug and toxic compound extrusion (MATE) family and functions as a Na+/multidrug antiporter in Vibrio parahaemolyticus, although the underlying mechanism of the Na+/multidrug antiport is unknown. Acidic amino acid residues Asp32, Glu251, and Asp367 in the transmembrane region of NorM are conserved in one of the clusters of the MATE family. In this study, we investigated the role(s) of acidic amino acid residues Asp32, Glu251, and Asp367 in the transmembrane region of NorM by site-directed mutagenesis. Wild-type NorM and mutant proteins with amino acid replacements D32E (D32 to E), D32N, D32K, E251D, E251Q, D367A, D367E, D367N, and D367K were expressed and localized in the inner membrane of Escherichia coli KAM32 cells, while the mutant proteins with D32A, E251A, and E251K were not. Compared to cells with wild-type NorM, cells with the mutant NorM protein exhibited reduced resistance to kanamycin, norfloxacin, and ethidium bromide, but the NorM D367E mutant was more resistant to ethidium bromide. The NorM mutant D32E, D32N, D32K, D367A, and D367K cells lost the ability to extrude ethidium ions, which was Na+ dependent, and the ability to move Na+, which was evoked by ethidium bromide. Both E251D and D367N mutants decreased Na+-dependent extrusion of ethidium ions, but ethidium bromide-evoked movement of Na+ was retained. In contrast, D367E caused increased transport of ethidium ions and Na+. These results suggest that Asp32, Glu251, and Asp367 are involved in the Na+-dependent drug transport process.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Multidrug transporters extrude antibiotics and toxic compounds from cells and are responsible for multidrug resistance (MDR) in both prokaryotes and eukaryotes. So far, multidrug transporters have been identified and classified into several groups. These groups include the major facilitator superfamily (MFS) (proteins containing 12 to 14 transmembrane helices), the small multidrug resistance (SMR) family (membrane proteins of low molecular weight and usually with four transmembrane helices), the resistance nodulation cell division (RND) family (which requires multiple components for activity), and the ATP binding cassette (ABC) family (reviewed in references 10 and 17). MFS, SMR, and RND transporters use an electrochemical potential of H+ across membranes established by the respiratory chain as a driving force for the transport of drugs and therefore act as proton/drug antiporters or drug uniporters (10, 16, 17). In contrast, ABC transporters are membrane ATPases and directly transport drugs upon hydrolysis of ATP (10, 16, 17).

In 1998, Morita and colleagues found that Vibrio parahaemolyticus possesses NorM, an energy-dependent efflux system for norfloxacin, a hydrophilic fluoroquinolone (13). Although NorM contains 12 putative transmembrane helices, one of the characteristics of MFS transporters, there is no sequence similarity with any member of the MFS family or other multidrug transporters (13). Significantly, NorM extrudes norfloxacin and other toxic compounds using an electrochemical gradient of Na+ established by a respiratory Na+ pump and therefore acts as a Na+/drug antiporter (14). NorM homologues have been identified in various organisms and classified into three distinct clusters; one cluster includes bacterial Na+/multidrug antiporters (2-4, 9, 10, 12, 17, 20). Thus, NorM and homologues constitute a novel multidrug transporter family termed the multidrug and toxic compound extrusion (MATE) family (3).

No structural or functional information on the molecular mechanism underlying the Na+/multidrug antiport by the MATE family is available so far. As the first step in elucidating the molecular mechanism underlying the exchange of Na+ and multiple drugs, we focused on three negatively charged amino acid residues in the predicted transmembrane region conserved in the NorM-containing cluster of the MATE family, which correspond to Asp32, Glu251, and Asp367 in NorM. In this study, we introduced a series of point mutations at these positions by site-directed mutagenesis and analyzed the transport activities for norfloxacin, ethidium ions, and Na+.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strain and plasmids. Escherichia coli KAM32, a derivative of K-12 lacking the AcrAB multidrug efflux pump and YdhE, a E. coli NorM homologue (5), was used. Plasmid pMVP36 is a derivative of pBR322 that carries the norM gene (13, 14). E. coli KAM32 cells expressing either wild-type NorM or a mutant NorM were grown to the exponential phase of growth in L broth containing ampicillin (50 µg/ml) at 37°C under aerobic conditions.

Site-directed mutagenesis. Point mutations were introduced into the wild-type NorM protein by means of the overlap extension method, as illustrated in Fig. 2, according to the published procedure (11). The following oligonucleotides encoding the corresponding mutations were used: D32A, TGCCATTACGGTCGCGACAA; D32E, TGCCATTACGGTTTCGACAA; D32N, TTACGGTGTTGACAAAACCC; D32K, TGCCATTACGGTTTTGACAA; E251A, GTGTCACTGCAAAGAACAGTGC; E251D, GTGTCACGTCAAAGAACAGTGC; E251Q, GTGTCACTTGAAAGAACAGTGC; E251K, GTGTCACTTTAAAGAACAGTGC; D367A, GAACGGCCGCTGTGCATTGG; D367E, GAACGGCTTCTGTGCATT; D367N, GAACGGCGTTTGTGCATT; and D367K, GAACGGCTTTTGTGCATT.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 2. Construction of mutant NorM proteins and their expression. (Top) Construction of mutants. (Bottom) Expression of the wild-type and mutant NorM proteins, which was analyzed by immunoblotting and visualized by ECL amplification.

 
Western blotting. Cells were washed once with buffer containing 50 mM Tris-HCl (pH 8.0), 0.1 M NaCl, 1 mM EDTA, 1 mM dithiothreitol, 5 µg of leupeptin per ml, and 5 µg of pepstatin A per ml and then suspended in the same buffer. Membrane vesicles were prepared after disruption of the cells by sonication with a TOMY UD-200 sonic disruptor at a output of 4. The cells were sonicated 10 times for 10 s each time and then centrifuged at 9,000 x g for 10 min. An inner membrane fraction was prepared by sucrose density gradient centrifugation (15). The inner membrane fraction was then dissociated with sodium dodecyl sulfate (SDS) sample buffer containing 10% SDS and 10% ß-mercaptoethanol. The proteins were subjected to electrophoresis on 10% polyacrylamide gels in the presence of SDS. Western blotting was performed as described previously, and immunoreactivity was visualized by enhanced chemiluminescence (ECL) amplification according to the manufacturer's manual (Amersham) (6). Recombinant glutathione S-transferase (GST) fusion protein with LMLGVRLRWMHRQEPDVQLNFSLQ (L433 to Q456), the carboxyl-terminal region of NorM (13), was prepared and injected into a rabbit with an adjuvant. After successive injections, sera were obtained and passed through a GST-Sepharose column to remove antibodies against GST. The resultant eluate was used as NorM antibodies.

Drug susceptibility tests. The MICs of antimicrobial agents were determined using Mueller-Hinton broth (Difco) by the twofold liquid microdilution method after incubation of cells (5 x 105 cells) at 37°C for 1 day as described previously (13).

Extrusion of norfloxacin. For the incorporation of norfloxacin into E. coli cells, cells containing wild-type NorM or a mutated NorM were suspended in minimal medium at a concentration of 10 mg (wet weight) per ml in the presence of 100 µM norfloxacin and then incubated at 25°C for 10 min. The cells were washed with the same buffer to remove extracellular norfloxacin and suspended in the same buffer at 25°C for 15 min. In some experiments, sodium salts in the medium were replaced with potassium salts to reduce the Na+ gradient. Then, 1-ml samples of cell suspension were taken, and the cells were collected by centrifugation at 7,000 x g for 1 min at 4°C. After the cells were washed, they were suspended in 1 ml of 0.1 M glycine-HCl (pH 3.0), vigorously shaken for 1 h, and then centrifuged at 7,000 x g for 5 min at room temperature. The amount of norfloxacin in the supernatant was determined fluorometrically using light with excitation and emission wavelengths of 277 and 448 nm, respectively (13, 14).

Efflux of ethidium ions. Cells containing wild-type NorM or a mutated NorM were grown and washed three times with minimal medium (the sodium salts in the medium were replaced with potassium salts) and then suspended in the same buffer at 50 µg/ml of protein. The cells were incubated for 5 min at 37°C, and then 25 µM ethidium bromide was added. Since intracellular ethidium ions can bind to nucleic acid and form a fluorescent complex, the efflux of ethidium ions can be monitored fluorometrically with light at excitation and emission wavelengths of 500 and 580 nm, respectively (13, 14). When necessary, 25 mM NaCl was included in the assay mixture to impose an inwardly directed artificial Na+ gradient.

Efflux of Na+ through downhill transport of drugs. Cells containing wild-type NorM or a mutated NorM were grown and washed twice with 100 mM morpholinopropanesulfonic acid (MOPS)-tetramethylammonium hydroxide (TMAH), (pH 7.0) containing 2 mM MgSO4 and then suspended in the same buffer in the presence of 100 µM NaCl. Cells at a concentration of approximately 25 mg of protein per ml were incubated in the same buffer at 25°C in a plastic vessel with rapid stirring under a continuous flow of water-saturated N2 gas to maintain anaerobic conditions. The Na+ concentration in the extracellular space was monitored with a Na+ electrode as described previously (19). When indicated, an anaerobic solution of ethidium bromide (50 µM) was added to the assay mixture to trigger Na+ movement and the downhill transport of drugs (14).

Other procedures. DNA sequencing and other DNA manipulations were performed by standard procedures as described previously (18). Protein quantitation was determined by the Bradford method (Bio-Rad).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Alignment of the predicted amino acid sequences of the 62 known members of the MATE family indicates the presence of three distinct clusters, and one cluster contains bacterial Na+/multidrug antiporters that exhibit overall identity and similarity of 26 and 47%, respectively. In particular, charged acidic amino acid residues Asp32, Glu251, and Asp367 of NorM located in the putative transmembrane region are well conserved (Fig. 1). To identify the amino acid residues that are important for the activity, we focused on these three amino acid residues and introduced a series of site-specific mutations according to the established procedure (Fig. 2). Western blotting with anti-NorM antibodies indicated that the following mutated NorM proteins are actually expressed and localized in the inner membranes of E. coli KAM32 cells like the wild-type NorM: NorM proteins with D32E, D32N, D32K, E251D, E251Q, D367A, D367E, D367N, and D367K (Fig. 2). No immunoreactivity was seen for the mutant proteins with D32A, E251A, and E251K, indicating that these mutant proteins were not expressed or that the amounts of these proteins were low and thus under the detection limit of our assay (Fig. 2).



View larger version (102K):
[in this window]
[in a new window]
 
FIG. 1. Alignment of amino acid sequences of cluster 1 of the MATE family. Black bars above the sequences indicate putative transmembrane domains. The charged amino acid residues conserved in the transmembrane domain are boxed.

 
In separate experiments, we measured the drug sensitivity of E. coli KAM32 cells expressing wild-type NorM or NorM mutant proteins (Table 1). KAM32 cells containing mutant NorM proteins with D32A, E251A, and E251K exhibited the same drug sensitivity, which is consistent with the absence of expression of the corresponding NorM mutant proteins detected in the cells as described above (data not shown). Cells with all the other mutant proteins exhibited greatly changed sensitivities to kanamycin, norfloxacin, and ethidium bromide, known transport substrates of NorM (13, 14, 17). Cells with most mutant proteins became significantly sensitive to these compounds compared with cells with wild-type NorM, indicating a decreased ability to extrude antimicrobial agents by these mutants. On the other hand, cells with the NorM D367E mutant were more resistant to ethidium bromide than cells with the wild-type NorM (Table 1). These results strongly suggest that D32, E251, and D367 are somehow involved in the transport of these antimicrobials through the NorM protein.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Drug susceptibility testsa

 
Therefore, we decided to determine the transport properties of these NorM mutants. Norfloxacin is accumulated in E. coli KAM32 cells and is extruded from NorM-expressing cells under aerobic conditions (Fig. 3). All the cells containing NorM mutants showed an increased level of accumulation of norfloxacin in the presence of Na+ (Fig. 3). These results are consistent with the drug susceptibility data shown in Table 1 and suggest that these negatively charged amino acid residues contribute to the efflux of norfloxacin directly or indirectly. The cells with NorM D367E and D367N mutants exhibited about 50% of the activity of the wild type, while little activity was observed for cells with the NorM D367K mutant.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. Norfloxacin extrusion by cells with wild-type and mutant NorM proteins. The amount of intracellular norfloxacin was determined as described in Materials and Methods. The amount of norfloxacin extruded was obtained by subtracting norfloxacin in the KAM32 cells with the vector alone from that with the wild-type NorM protein or a mutant NorM protein. Extrusion is shown relative to cells with wild-type NorM. The amounts of intracellular norfloxacin in KAM32 cells with the vector alone and with wild-type NorM were 1.5 and 8.3 nmol/mg of protein, respectively. Values are means ± standard deviations (error bars) from three experiments.

 
Subsequently, we measured the extrusion of ethidium ions accumulated in E. coli KAM32 cells expressing wild-type NorM or a mutant NorM. After the steady-state level of incorporation of ethidium ions had been reached, we initiated extrusion of ethidium ions from the cells by the addition of NaCl. Cells with the wild-type NorM protein showed an acute decrease in fluorescence intensity, indicating Na+-dependent extrusion of ethidium ions. Cells with mutant NorM proteins with D32E, D32N, D32K, E251D, D367A, D367K, and D367N mutations almost completely lost or exhibited a significant reduction in the Na+-dependent extrusion of ethidium ions. In contrast, cells with the mutant NorM E251Q protein retained Na+-dependent efflux activity, and cells with mutant NorM D367E showed a considerable increase in the Na+-dependent efflux activity (Fig. 4). However, the fluorescence intensity of cells with mutant NorM E251Q was significantly higher. This suggests that the intracellular ethidium concentration of cells with mutant NorM E251Q is higher those of cells with the wild-type NorM and mutant NorM D367E.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Na+-dependent efflux of ethidium ions. Cells with wild-type and mutant NorM proteins (10 mg [wet weight]/ml) were incubated in minimal essential medium containing ethidium bromide, and their fluorescence was monitored. When indicated, 25 mM NaCl was added to the assay mixture to impose an inwardly directed artificial Na+ gradient.

 
Under anaerobic conditions, downhill movement of drugs through NorM causes the efflux of intracellular Na+, which can be monitored with a Na+-specific electrode (13, 14). Cells with the wild-type NorM protein showed significant Na+ efflux when ethidium bromide was added to the cell suspension (Fig. 5). In cells with mutant NorM D32E, D32N, D32K, D367A, and D367K proteins, the ethidium bromide-evoked Na+ efflux disappeared, indicating no or little downhill movement of Na+. In contrast, in cells with mutant NorM E251Q, E251D, and D367N proteins, Na+ efflux comparable to or slightly lower than that by the wild type was observed. It is interesting that mutant D367E showed higher Na+ efflux activity, although the initial velocity of the efflux was lower (Fig. 5). Thus, for these mutants, except for NorM proteins with E251D and D367N, Na+-dependent efflux of ethidium ions and ethidium bromide-dependent efflux of Na+ roughly coincided. Similar results were obtained with norfloxacin and kanamycin.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. Na+ efflux evoked by drugs. Cells with wild-type and mutant NorM proteins were incubated at 25°C in a plastic vessel with rapid stirring, and water-saturated N2 gas was introduced continuously to maintain anaerobic conditions. The external Na+ concentration was monitored with a Na+ electrode. Na+ flow was initiated by the addition of a drug at the time point indicated by the arrows. The Na+ concentration before the addition of a drug was set at zero. Ethidium bromide (A), B, norfloxacin (B), and kanamycin (C) were added. Note that the drug flow in this experiment is downhill.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The MATE family is a large family of membrane proteins that are present in organisms from microorganisms to humans and has been subdivided in three distinct clusters due to the predicted amino acid sequences (4). Proteins in cluster 1 are of bacterial origin and include almost all Na+/multidrug antiporters, including NorM. Major proteins in cluster 2 are of eukaryotic origin and exhibit about 23% identity to cluster 1. Proteins in cluster 3 come from members of the Bacteria and Archaea domains and exhibit far less homology to cluster 1 and 2. Although the molecular nature and the physiological function of the MATE family in eukaryotes and Archaea are totally unknown, NorM homologues in cluster 1 are known to mediate Na+/multidrug antiport (2-4, 9, 10, 12-14, 17, 20).

To elucidate the molecular mechanism underlying the Na+/multidrug antiport by cluster 1 of the MATE family, we investigated the role(s) of charged amino acid residues in Na+/drug antiport in the transmembrane region of NorM. We focused on Asp32, Glu261, and Asp367, since these amino acid residues are conserved in cluster 1 of the MATE family (Fig. 1). Although extensive biochemical analysis with membrane preparations is necessary, our findings suggested that these amino acid residues are somehow involved in the transport process.

The most critical mutation effect was found for residue Asp32. Mutations at Asp32 completely abolished the drug resistance activities examined, except for the low norfloxacin resistance with D32N. Such a deleterious effect on drug resistance was confirmed by the lack of drug extrusion activity of mutant cells, showing the importance of this residue in the transport mechanism. Interestingly, these Asp32 mutants were hypersensitive to kanamycin, suggesting increased kanamycin permeability into the cells (Table 1). These mutant enzymes probably act as a kanamycin channel through perturbed coupling. Although mutant cells exhibited high kanamycin permeability, an inwardly directed kanamycin gradient failed to cause Na+ efflux. This supports the defective energy coupling. The D32N mutant retained significant resistance to norfloxacin but lost resistance to other drugs, suggesting that this residue might be involved in drug recognition. It should be pointed out that the expression levels of D32E, D32N, and D32K enzymes were the same or higher than that of the wild type. Thus, such deleterious effects reflect the internal functionality of mutant enzymes rather than the amounts of the enzymes.

Glu251 located in the seventh transmembrane helix also contributes to drug transport. Although the E251Q mutant exhibited considerable drug extrusion activity, it did not confer sufficient ethidium bromide resistance. As shown in Fig. 4, the intracellular ethidium concentration would be too high for survival of this mutant. However, the loss of resistance suggests the importance of this residue for the transport of these drugs. E251D, a more conserved Asp mutation than E251Q, had severe effects on transport and drug sensitivity. This mutant had lost resistance to all three drugs, exhibited decreased efflux of norfloxacin, and showed a low level of ethidium bromide-evoked Na+ efflux with no Na+-dependent efflux of ethidium ions. The complete loss of Na+-driven uphill ethidium efflux without the loss of ethidium evoked by Na+ flow suggests that this mutant enzyme cannot transport ethidium against a concentration gradient using Na+ flow but can carry out downhill ethidium transport into the cells. Similar results were obtained with NorM with D367N. It is also noteworthy that the D32A and E251A mutations caused no expression or an undetectable level of expression. This finding suggests that both amino acid residues are also involved in the folding of the NorM protein during translation and maturation.

Replacement of D367 with Glu did not affect the transport phenotype of NorM, but replacement with other amino acids led to defects. This suggests the importance of the carboxyl moiety at this position. However, cells with the NorM D367N mutant showed considerable kanamycin resistance, suggesting that the carboxyl group at this residue may not be essential for kanamycin transport. Similar to the NorM E251D mutant, the NorM D367N mutant was sensitive to ethidium bromide and exhibited appreciable ethidium bromide-evoked efflux of Na+ without showing uphill ethidium transport through an artificial Na+ gradient. This result could be explained by partial uncoupling of the transport of Na+ and ethidium ions. An artificial gradient of ethidium ions drove Na+ flow out of the cells, but the Na+ gradient could not drive uphill ethidium efflux. This mutant failed to grow in the medium including norfloxacin, even though it exhibits higher norfloxacin extrusion activity than the NorM D32N mutant. The uncoupled phenotype of this mutant may change the physiology of the cells, such as the membrane potentials, resulting in lower resistance to norfloxacin.

Recent developments in membrane protein crystallography together with extensive mutagenesis and kinetic analyses have revealed the roles of the charged residues in the transmembrane helix in substrate recognition and energy coupling at the atomic level. In the case of lactose permease, the exchange of hydrogen bonds or a salt bridge between charged residues drives a conformation change and net transport against the gradient (1). Similar mechanisms are postulated for the glycerol-3-phosphate transporter and tetracycline transporter (8, 21). Our data illustrate the importance of three acidic residues in transmembrane helices for drug transport by NorM, and possibly other members of the cluster 1 MATE family. We assume that a transport mechanism similar to these transporters is involved in Na+/multidrug antiport by NorM and its homologues. In this respect, it is noteworthy that Glu251 and Asp367 are not conserved in cluster 3 of the MATE family (3, 17) and that VmrA of V. parahaemolyticus, a member of cluster 3, also acts as a Na+/multidrug antiporter (5). Furthermore, PmpM of Pseudomonas aeruginosa, a member of cluster 1 of the MATE family, uses proton motive force as a driving force and acts as a H+/multidrug antiporter (7). These results suggest that the mechanics underlying Na+/multidrug antiport in the MATE family are complex. More refined studies focusing on the roles of individual amino acid residues as well as the structure of the transporter moiety will be necessary to elucidate the molecular mechanism of this fascinating Na+/multidrug antiporter.

In conclusion, this study provides the first direct evidence as to the functional amino acid residues of NorM and provides the molecular basis of further analysis of the transport mechanism of the MATE family.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, Faculty of Pharmaceutical Sciences, Okayama University, Okayama 700-8530, Japan. Phone: 81-86-251-7933. Fax: 81-86-251-7935. E-mail: moriyama{at}pheasant.pharm.okayama-u.ac.jp. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abramson, J., I. Smirnova, V. Kasho, G. Verner, R. Kaback, and S. Iwata. 2003. Structure and mechanism of the lactose permease of Escherichia coli. Science 301:610-615.[Abstract/Free Full Text]
  2. Braibant, M., L. Guilloteau, and M. S. Zygmunt. 2002. Functional characterization of Brucella melitensis NorMI, an efflux pump belonging to the multidrug and toxic compound extrusion family. Antimicrob. Agents Chemother. 46:3050-3053.[Abstract/Free Full Text]
  3. Brown, M. H., I. T. Paulsen, and R. A. Skurray. 1999. The multidrug efflux protein NorM is a prototype of a new family of transporters. Mol. Microbiol. 31:394-395.[CrossRef][Medline]
  4. Burse, M., H. Weingart, and M. S. Ullrich. 2004. NorM, an Erwinia amylovora multidrug efflux pump involved in in vitro competition with other epiphytic bacteria. Appl. Environ. Microbiol. 70:693-703.[Abstract/Free Full Text]
  5. Chen, J., Y. Morita, M. N. Huda, T. Kuroda, T. Mizushima, and T. Tsuchiya. 2002. VmrA, a member of a novel class of Na+-coupled multidrug efflux pumps from Vibrio parahaemolyticus. J. Bacteriol. 184:572-576.[Abstract/Free Full Text]
  6. Hayashi, M., M. Otsuka, R. Morimoto, A. Muroyama, S. Uehara, A. Yamamoto, and Y. Moriyama. 2003. Vesicular inhibitory amino acid transporter is present in glucagon-containing secretory granules in {alpha}TC6 cells, mouse clonal {alpha} cells, and {alpha} cells of islets of Langerhans. Diabetes 52:2066-2074.[Abstract/Free Full Text]
  7. He, G.-H., T. Kuroda, T. Miwa, Y. Morita, T. Mizushima, and T. Tsuchiya. 2004. An H+-coupled multidrug efflux pump, PmpM, a member of the MATE family of transporters, from Pseudomonas aeruginosa. J. Bacteriol. 186:262-265.[Abstract/Free Full Text]
  8. Huang, Y., M. J. Lemieux, J. Song, M. Auer, and D. Wang. 2003. Structure and mechanism of the glycerol-3-phosphate transporter from Escherichia coli. Science 301:616-620.[Abstract/Free Full Text]
  9. Huda, M. N., J. Chen, Y. Morita, T. Kuroda, T. Mizushima, and T. Tsuchiya. 2003. Gene cloning and characterization of VcrM, a Na+-coupled multidrug efflux pump, from Vibrio cholerae non-O1. Microbiol. Immunol. 47:419-427.[Medline]
  10. Hvorup, R. N., B. Winnen, A. B. Chang, Y. Jiang, X.-F. Zhou, and M. H. Saier, Jr. 2003. The multidrug/oligosaccharidyl-lipid/polysaccharide (MOP) exporter superfamily. Eur. J. Biochem. 270:799-813.[Medline]
  11. Ito, W., H. Ishiguro, and Y. Kurosawa. 1991. A general method for introducing a series of mutations into cloned DNA using the polymerase chain reaction. Gene 102:67-70.[CrossRef][Medline]
  12. Miyamae, S., O. Ueda, F. Yoshimura, J. Wang, Y. Tanaka, and H. Nikaido. 2001. A MATE family multidrug efflux transporter pumps out fluoroquinolones in Bacterioides thetaiotaomicron. Antimicrob. Agents Chemother. 45:3341-3346.[Abstract/Free Full Text]
  13. Morita, Y., K. Kodama, S. Shiota, T. Mine, A. Kataoka, T. Mizushima, and T. Tsuchiya. 1998. NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homologue in Escherichia coli. Antimicrob. Agents Chemother. 42:1778-1782.[Abstract/Free Full Text]
  14. Morita, Y., A. Kataoka, S. Shiota, T. Mizushima, and T. Tsuchiya. 2000. NorM of Vibrio parahaemolyticus is an Na+-driven multidrug efflux pump. J. Bacteriol. 182:6694-6697.[Abstract/Free Full Text]
  15. Moriyama, Y., A. Iwamoto, H. Hanada, M. Maeda, and M. Futai. 1991. One-step purification of Escherichia coli H+-ATPase (F0F1) and its reconstitution into liposomes with neurotransmitter transporters. J. Biol. Chem. 266:22141-22146.[Abstract/Free Full Text]
  16. Nikaido, H. 1998. Antibiotic resistance caused by gram-negative multidrug efflux pump. Clin. Infect. Dis. 27:S32-S41.
  17. Putman, M., H. W. Van Veen, and W. N. Konings. 2000. Molecular properties of bacterial multidrug transporters. Microbiol. Mol. Biol. Rev. 64:672-693.[Abstract/Free Full Text]
  18. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  19. Tsuchiya, T., and K. Takeda. 1979. Extrusion of sodium ions energized by respiration and glycolysis in Escherichia coli. J. Biochem. 86:225-230.[Abstract/Free Full Text]
  20. Xu, X.-J., X.-Z. Su, Y. Morita, T. Kuroda, T. Mizushima, and T. Tsuchiya. 2003. Molecular cloning and characterization of the HmrM multidrug efflux pump from Haemophilus influenzae Rd. Microbiol. Immunol. 47:937-943.[Medline]
  21. Yamaguchi, A., T. Akasaka, N. Ono, Y. Someya, M. Nakanishi, and T. Sawai. 1993. Metal-tetracycline/H+ antiporter of Escherichia coli encoded by transposon Tn10. J. Biol. Chem. 267:7490-7498.


Journal of Bacteriology, March 2005, p. 1552-1558, Vol. 187, No. 5
0021-9193/05/$08.00+0     doi:10.1128/JB.187.5.1552-1558.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Otsuka, M.
Right arrow Articles by Moriyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Otsuka, M.
Right arrow Articles by Moriyama, Y.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS