Gloria M. Conover,2,
Jennifer L. Miller,1
Sinae A. Vogel,1
Stacey N. Meyers,1
Ralph R. Isberg,2,3 and
Joseph P. Vogel1*
Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110,1 Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111,2 Howard Hughes Medical Institute, Tufts University School of Medicine, Boston, Massachusetts 021113
Received 6 July 2004/ Accepted 20 January 2005
| ABSTRACT |
|---|
|
|
|---|
dotL
lethality and found that many contained mutations in other components
of the Dot/Icm secretion system. A systematic analysis of
dot/icm deletion mutants revealed that the majority of them
(20 of 26) suppressed the lethality phenotype, indicating a partially
assembled secretion system may be the source of
dotL
toxicity in the wild-type strain. These results are consistent with a
model in which the DotL protein plays a role in regulating the activity
of the L. pneumophila type IV secretion
apparatus. | INTRODUCTION |
|---|
|
|
|---|
The key to L. pneumophila's virulence is its ability to form a replicative phagosome, since mutants defective in this trait cannot replicate inside host cells and are thus unable to cause disease (24, 26). One large class of proteins that allow L. pneumophila to alter the endocytic pathway is encoded by the dot/icm genes (3, 5, 37). To date, over two dozen dot/icm genes have been identified and are clustered in two areas of the L. pneumophila chromosome (region I and region II) (63). Based on the similarity of the Dot/Icm proteins to proteins involved in conjugative DNA transfer, and the fact that the Dot/Icm system can transfer the mobilizeable plasmid RSF1010, it was proposed that the dot/icm genes of L. pneumophila encode a type IV secretion system (31, 50, 63).
Type IV secretion systems are able to export DNA and/or proteins out of the bacterial cell and include plasmid transfer systems (e.g., the tra and trb genes of the plasmid RP4), as well as systems involved in the delivery of virulence factors (10, 46, 66). The canonical type IV secretion system is encoded by the virB operon of the plant pathogen Agrobacterium tumefaciens (66). A number of other pathogens, including Bartonella tribocorum, Bordetella pertussis, Brucella abortus, Helicobacter pylori, and Rickettsia prowazekii, contain orthologues to the VirB proteins, and some of these systems have been shown to export proteins essential for virulence (10). In contrast to these type IV systems, the L. pneumophila Dot/Icm proteins have limited sequence similarity to the VirB proteins. Instead, the Dot/Icm proteins show high similarity to the transfer proteins from IncI plasmids (e.g., R64 and ColIb-P9) and compose a type IVB secretion system (31, 57).
As with most conjugative transfer systems, little is known about the specific function of many of the L. pneumophila Dot/Icm proteins. DotB was recently shown to possess ATPase activity and likely provides energy to the secretion apparatus (56). A second Dot protein, DotL, also contains a nucleotide binding motif and shows extensive sequence similarity to the conjugal transfer protein TrbC from IncI plasmids (19, 31). DotL also has detectable sequence similarity to a family of proposed ATPases known as TraG-like or type IV secretion system coupling proteins (T4CPs). The more notable members of the T4CP family include TraG (RP4 plasmid), TrwB (R388 plasmid), TraD (F plasmid), and the A. tumefaciens VirD4 protein (8, 18, 33).
The term "coupling protein" was proposed for this family because its members are believed to target, or couple, exported substrates to the secretion apparatus (8, 9, 15, 22, 23, 32, 61). This proposal was initially based on the phenotype of RP4 traG mutants, which were still able to process plasmid DNA into a secretion-competent intermediate and assemble a functional pilus but were unable to transfer the plasmid. This indicated that TraG plays a role in linking the two processes (9). Consistent with the idea of T4CPs linking substrates to the secretion apparatus, a number of T4CPs have been shown to interact with both exported substrates and with components of the secretion apparatus (2, 15, 20, 35, 61). Although T4CPs are absolutely required for export of substrates, their specific molecular function remains unknown (22).
We demonstrate here that a T4CP homologue, the DotL protein, is not only required for growth of L. pneumophila inside macrophages but is also essential for viability of certain strains on bacteriological media. The lethality caused by loss of dotL in those strains can be suppressed by mutations that inactivate the Dot/Icm complex, which is consistent with a DotL role in regulating the activity of this type IV secreton.
| MATERIALS AND METHODS |
|---|
|
|
|---|
protein, E. coli strain DH5
(
pir),
was used (30,
67).
|
dotL suicide plasmid, pJB1001, two PCR-amplified
fragments were cloned into the NotI/SalI sites of pSR47S
(40). Fragment 1 was
amplified by using the primers
5'-CCCAAACGGCCGCCAAACGAGTATTTACCATGC(JVP201 with the EagI site underlined) and
5'-CCCAAAGGATCCCGCATCATGGCTCTAATTCC(JVP202 with the BamHI site underlined). Fragment 2 was amplified by
using the primers
5'-CCCAAAGGATCCGCTATTGGGCATGAAGAGAGC(JVP203 with the BamHI site underlined) and
5'-CCCAAAGTCGACCCTACTGATGCAACTTTAATCC(JVP204 with the SalI site underlined). Plasmid pJB1005 was constructed
by inserting a gene encoding chloramphenicol acetyltransferase that was
amplified from pKRP10 by using the primers
5'-CCCAAAGGATCCGAGGTTCCAACTTTCACC(JVP206 with the BamHI site underlined) and
5'-CCCAAAGGATCCCTGCCTTAAAAAAATTACGC(JVP207 with the BamHI site underlined) into the BamHI site of plasmid
pJB1001.
To make the
dotN suicide plasmid,
pJB3046, two PCR-amplified fragments were cloned into the NotI/SalI
sites of pSR47S (40).
Fragment 1 was amplified by using the primers
5'-CCCGCGGCCGCGGTGTATCGTTAGGTAAAATGG(JVP289 with the NotI site underlined) and
5'-CCCGGATCCCGCCATAGTTTGGTTCACATTCAGTC(JVP903 with the BamHI site underlined). Fragment 2 was amplified by
using the primers
5'-CCCGGATCCGAGAAATGGGCTGCCAGTGC(JVP904 with the BamHI site underlined) and
5'-CCCGTCGACGCAGCTTTTAACTGATCGC(JVP286 with the SalI site underlined).
To make the
dotM suicide plasmid, pJB3050, two PCR-amplified
fragments were cloned into the NotI/SalI sites of pSR47S
(40). Fragment 1 was
amplified by using the primers
5'-CCCGCGGCCGCGAAGCAATCTTCAGTCCTGG(JVP297 with the NotI site underlined) and
5'-CCCGGATCCCTGCTGTTGTTGTGCCATCTC(JVP901 with the BamHI site underlined). Fragment 2 was amplified by
using the primers
5'-CCCGGATCCGATGAAGCGATTAGAGCTCTGG(JVP902 with the BamHI site underlined) and
5'-CCCGTCGACGCATACAGAGAGTTATCTCC(JVP294 with the SalI site underlined).
pJB1010, the His-tagged version of DotL, was constructed by amplifying the dotL open reading frame (ORF) using plasmid pJB359 and the primers 5'-GACATGCATGCGATGGGGTTGACTAATTAAGG (JVP217 with the SphI site underlined) and 5'-GACATGCATGCCCCGAAAGCAAAAGTTGCC(JVP218 with the SphI site underlined). The PCR product was digested with SphI and cloned into the SphI site of pQE-32 (Qiagen). The final construct can be used to express a fusion protein containing six histidines fused to amino acids 72 through 783 of DotL.
The
dotL complementing clone, pJB1014, was constructed by first
amplifying the dotL ORF from Lp02 chromosomal DNA by using the
primers
5'-GGGGTACCGGAATTAGAGCCATGATGCG(JVP227 with the KpnI site underlined) and
5'-GACATGCATGCGATGGGGTTGACTAATTAAGG(JVP217 with the SphI site underlined). The resulting product was
digested with KpnI and SphI and ligated into KpnI/SphI-digested
pJB908. pJB908, a derivative of the plasmid pKB5, has the
following features: (i) an RSF1010 origin to permit replication in
L. pneumophila, (ii) an
oriT mutation to
prevent inhibition of growth in macrophages, and (iii) a tac
promoter driving DotL expression
(3). Constitutive
expression from pJB1014 is able to rescue a dotL deletion
strain for viability on plates and in macrophages and expresses similar
levels of DotL compared to a wild-type strain.
pJB1242, the
lvhB suicide plasmid, was constructed by cloning two
PCR-amplified fragments into the SalI and NotI sites of pSR47S.
Fragment 1 was amplified by using the primers
5'-CCCGTCGACGTTTGGAGAAGTCAGTTTAAGG(JVP342 with the SalI site underlined) and
5'-CCCGGATCCTCATGGCGCCACCTTTTGC(JVP343 with the BamHI site underlined). Fragment 2 was amplified with
the primers
5'-CCCGGATCCGAAGCACTCGAACTATAAACC(JVP344 with the BamHI site underlined) and
5'-CCCGCGGCCGCGTTTCGCCATTGTATCCC(JVP345 with the NotI site underlined).
pJB1304, containing the lvhB operon, was constructed by first amplifying the lvhB operon from JR32 chromosomal DNA by using the primers 5'-CCCGTCGACGTTTGGAGAAGTCAGTTTAAGG(JVP342 with the SalI site underlined) and 5'-CCCGCGGCCGCGTTTCGCCATTGTATCCC(JVP345 with the NotI site underlined). The resulting product was digested with SalI and NotI and ligated into SalI/NotI-digested pJB1300. pJB1300, a derivative of the plasmid pKB5 (3), has the HindIII site in the polylinker replaced with a unique NotI site.
Antibody production. pJB1010, a polyhistidine-tagged version of DotL in which the amino-terminal signal sequence of DotL was replaced with six histidines, was purified by using Ni-nitrilotriacetic acid chromatography (Qiagen). The purified His6-DotL fusion protein was injected into rabbits to raise polyclonal antibodies against DotL (Cocalico). The serum recognized a single protein from wild-type L. pneumophila extracts that was absent in extracts from an E. coli strain and a L. pneumophila strain lacking the dotL gene.
Fractionation and Western analysis. L. pneumophila was fractionated as previously described (55). Briefly, a culture of Lp02 was grown to mid-exponential phase, and the cells were pelleted and resuspended in 50 mM Tris-HCl (pH 8.0), 0.5 M sucrose, 5 mM EDTA, and 0.1 mg of lysozyme/ml. The cell suspension was incubated on ice for 1 h, MgSO4 was added to a final concentration of 20 mM, and spheroplasts were collected by centrifugation at 5,000 x g. The pellet was resuspended in 50 mM Tris-HCl (pH 8.0), sonicated, and then centrifuged at 5,000 x g to collect any unlysed cells. The supernatant was then centrifuged at 100,000 x g for 1 h at 4°C to obtain a total membrane fraction. The supernatant was removed, centrifuged at 100,000 x g, and saved as the cytoplasmic sample. The pellet was washed and resuspended in 50 mM Tris-HCl (pH 8.0). The inner membranes were solubilized by the addition of Triton X-100, and the outer membranes were collected by centrifugation at 100,000 x g. Fractions were resuspended in sodium dodecyl sulfate-polyacrylamide gel electrophoresis loading buffer, subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and either Coomassie blue stained for total protein or transferred to a membrane and probed with the anti-DotL serum (1:5,000).
Cell culture. The histiocytic cell line U937 (American Type Culture Collection) was cultured in RPMI 1640 media (BioWhittaker) containing 10% fetal bovine serum (BioWhittaker). Cells were differentiated with 12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma) as described previously (3). Differentiated U937 cells were plated as a confluent monolayer in 24-well plates, with each well containing ca. 2 x 106 cells per well.
Southern blot analysis. L. pneumophila chromosomal DNA was isolated by a combination of a high-salt precipitation to eliminate contaminating proteins, followed by isopropanol precipitation of the DNA. Chromosomal DNA was digested with 10 U of HaeII restriction enzyme overnight at 37°C. Southern blots were performed according to the ECL Southern hybridization kit (Amersham), with probes specific to regions flanking dotL (from pJB1001) or dotB (pJB921).
Transposon mutagenesis of L. pneumophila.
L. pneumophila was
mutagenized by using the transposon delivery system encoded on pJK211-2
(13). pJK211-2 contains a
temperature-sensitive origin that is not permissive for replication at
37°C, an altered sites transposase that increases the
randomness of insertion, and a mini-Tn10 transposon containing
a kanamycin cassette (KanR) and a conditional origin from plasmid R6K
later used to recover the transposon insertions in E. coli
strain DH5
(
pir). A pool of insertions was placed on
sucrose chloramphenicol plates to select for recombinants (sucrose to
select for recombinants and chloramphenicol to select for the
dotL::Cmr).
Chloramphenicol-resistant (Cmr), kanamycin-sensitive,
sucrose-resistant (Sucr) colonies were colony purified and
scored for loss of the plasmid-encoded resistance cassette to ensure
they had resolved the integrated plasmid. Insertions were recovered as
previously described
(13). The site of
insertion was identified by sequencing by using the primers JVP348
(GGATCTGGTACCGGATCC) or JVP349
(TCAACAGGTTGAACTGCGGATC).
Screen for suppression of the
dotL lethality.
Plasmids pJB1001 and pJB1005 were
transferred into L. pneumophila strains by using an RP4
conjugation system encoded on pRK600
(14). L.
pneumophila strains containing the integrated plasmid were
selected by plating on CYET containing kanamycin and streptomycin.
Resulting merodiploid strains that had a second crossover event were
selected by plating on CYET plates containing 5% sucrose.
Resolution of the integrated plasmid was confirmed by loss of kanamycin
resistance. In the case of strains containing the
dotL::Cmr cassette,
sucrose-resistant colonies were streaked onto chloramphenicol to screen
for the wild-type or mutant dotL
alleles.
Replication of L. pneumophila strains in U937 cells. L. pneumophila strains were resuspended in phosphate-buffered saline to an optical density at 600 nm of 1. The bacterial suspensions were then diluted 1:1,000 in RPMI 1640 containing 10% fetal bovine serum, and 2 mM glutamine. A monolayer of TPA-treated U937 cells were infected with various L. pneumophila strains at a multiplicity of infection of one for 1 h. The monolayers were washed with fresh RPMI and then incubated in RPMI 1640 containing 10% fetal bovine serum and 2 mM glutamine at 37°C and 5% CO2. Thymidine was added when appropriate. At 1, 24, 48, and 72 h postinfection, cells were lysed in sterile ddH2O and dilutions were plated on CYET. Plates were incubated for 4 days at 37°C, and viable counts were determined.
Accession numbers. GenBank accession numbers for submitted sequences are as follows: DotU is AF533658 and DotV is AF533657.
| RESULTS |
|---|
|
|
|---|
|
DotL is essential for viability on bacteriological media.
To investigate the function of the DotL
protein, we attempted to delete the dotL gene from the
chromosome of Lp02, a strain of L. pneumophila with an intact
dot/icm system
(3,
63). Previous attempts to
delete dot/icm genes have been uniformly successful,
indicating that the Dot/Icm complex is not required for viability on
bacteriological media (1,
3,
63). To construct an
in-frame deletion of the dotL gene, ca. 500 bp of DNA upstream
and downstream adjacent to the dotL gene was cloned into the
suicide vector pSR47S, generating plasmid pJB1001 (Fig.
2). The dotL deletion plasmid was electroporated into strain Lp02
and introduced onto the chromosome by selecting for a single crossover
event generating a dotL/
dotL merodiploid strain.
Merodiploids that had resolved were selected by plating on sucrose, a
toxic compound for gram-negative organisms containing the
counterselectable marker sacB
(4). Resolution of the
merodiploid should result in an equal proportion of strains containing
either the wild-type copy of dotL or
dotL on
the chromosome (Fig.
2).
|
dotL merodiploid strain revealed no strains that
lacked the wild-type copy of dotL (Fig.
3, top panel). In contrast, sucrose resistant recombinants derived from a
similarly constructed dotB/
dotB merodiploid
(55)
re sulted in ten strains containing wild-type dotB and four
strains containing
dotB (Fig.
3, bottom panel). To
ensure that the recombination event in the dotL/
dotL
merodiploid strain was not theoretically impossible, recombinants were
selected in a merodiploid containing the
dotL+ plasmid pJB1014. In this
situation, chromosomal dotL deletions were recovered,
indicating that a
dotL could be obtained in a strain
exogenously expressing DotL (data shown below). Finally, the
dotL::Cmr reporter
plasmid pJB1005 could not be introduced directly onto the chromosome of
the L. pneumophila strain Lp02 by using natural transformation
(56), confirming the
difficulty of constructing a dotL deletion. These results
indicated a strong bias against deleting the wild-type version of
dotL and suggested that loss of dotL may result in
lethality of L. pneumophila on bacteriological
media.
|
dotL::Cmr
merodiploid was subjected to selection on sucrose, in the absence of
chloramphenicol, and the presence of the
dotL::Cmr cassette was
subsequently screened by plating sucrose resistant recombinants on
medium containing chloramphenicol. Examination of a larger number of
sucrose-resistant strains still failed to detect a recombinant that
contained just the
dotL::Cmr allele (0 of
753 events scored). Based on these results, we conclude that
dotL is required for the viability of the L.
pneumophila strain Lp02 on bacteriological
media.
Isolation of suppressors of
dotL.
In
order to determine whether it was possible to suppress the lethality
caused by loss of dotL, we plated an even greater number of
the dotL/
dotL::Cmr
merodiploid on plates containing sucrose and chloramphenicol, thereby
directly selecting for loss of dotL. Rare sucrose-resistant,
chloramphenicol-resistant recombinants were isolated at a rate of
106. This was consistent with
dotL being an essential gene, with the
chloramphenicol-resistant colonies that arose being pseudorevertants
due to spontaneous mutations in other genes. To identify the nature of
the pseudorevertants, random transposon insertions were generated in
the dotL/
dotL::Cmr
merodiploid strain background by using a mini-Tn10 transposon,
and the insertion pool was plated on sucrose and chloramphenicol to
select for strains that could tolerate loss of dotL.
Thirty-three such insertions were isolated from independent pools.
These strains were first analyzed by Southern blot to ensure that they
had only one insertion. To confirm that the phenotype was linked to the
transposon insertion, the strains were recreated by transforming the
transposon and flanking chromosomal DNA into the original,
unmutagenized merodiploid strain by using natural transformation
(56). Examination of the
33 strains by this assay demonstrated that, in each case, the phenotype
was linked to the transposon insertion. Finally, the transposons and
flanking DNA were recovered on a plasmid, and the sites of the
transposon insertions on the L. pneumophila chromosome were
identified by sequencing off the end of each
transposon.
Surprisingly, approximately one-half of the
insertions (16 of 33) were in other dot/icm genes. This
included four insertions in dotA, two in dotG, one in
dotI, five in dotO, three in icmF, and one
in icmX (Fig.
4). In most cases, the phenotype appeared to be due to inactivation of the
gene the transposon was inserted in, because the insertions were in
terminal genes of proposed operons (e.g., dotA, dotO,
icmF, and icmX). Among the insertions that were not
in known dot/icm genes, three mutants (JV1308, JV1343, and
JV1499) were defective for intracellular growth of L.
pneumophila when the insertions were separated from the
dotL (data not shown). The three mutants each
contained an insertion in a different site of the same gene, which is
located ca. 20 kb from region II (Fig.
4)
(63). This gene codes for
a small protein of 180 amino acids that has extensive homology to DotE
(40% amino acid identity over 171 amino acids). We have
designated this gene dotV because it is required for proper
targeting of the L. pneumophila phagosome and for
intracellular growth (unpublished results) (accession no.
AF533657).
Finally, the remaining insertions were not in known dot/icm
genes or homologous genes and, when separated from the dotL
deletion, caused the corresponding strains to exhibit various degrees
of growth inhibition inside host cells (data not
shown).
|
dotL, we attempted
to delete dotL in a strain containing an in-frame deletion of
the dotA gene. In contrast to the previous attempt to delete
dotL (Fig. 3),
both dotL and
dotL loopouts were obtained
from the
dotA dotL/
dotL merodiploid,
demonstrating that loss of a single dot gene could allow the
isolation of the
dotL mutation (Fig.
5). Because the
dotL suppressor hunt identified only a
subset of dot/icm genes, we investigated whether they were the
only dot/icm genes that, when inactivated, could suppress the
dotL lethality. In-frame deletions were constructed
in 23 of the 26 dot/icm genes, and the
dotL
suicide plasmid was integrated into each strain to assay for the
ability to tolerate loss of dotL. Remarkably, dotL
could be deleted in almost all of the strains containing different
dot/icm mutations (Fig.
6). This suppression was specific in that dotL could not be
deleted in a strain lacking a housekeeping gene found in region II,
citA, which is not required for intracellular growth (Fig.
6)
(42).
|
|
dotL is not essential in all L. pneumophila strain backgrounds.
dotL, also known as
icmO, is essential for viability in the Lp02 background.
However, it has been previously published that loss of dotL in
another L. pneumophila strain, JR32, is not a lethal event
(52). Lp02 and JR32 were
independently derived from L. pneumophila Philadelphia-1, an
organism isolated from the original Legionnaires' disease outbreak
in 1976 (3,
38). Each strain was
individually selected to be streptomycin resistant and to lack host
restriction, and Lp02 was then also selected to be a thymidine
auxotroph. Due to the relatedness of these two strains, it was
surprising that dotL/icmO was essential for viability in Lp02
but was dispensable in JR32. To confirm that dotL was not an
essential gene in JR32, a clean
dotL was constructed
in the JR32 background and was indeed found to be viable on buffered
CYE plates (data not shown). To examine intracellular growth,
monolayers of U937 macrophages were challenged with wild-type L.
pneumophila strains Lp02 and JR32. Both strains were able to
multiply >1,000-fold in 3 days (Fig.
7). In contrast, an Lp02 strain lacking a functional dotA gene,
Lp03, was unable to replicate inside macrophages. As previously shown,
deletion of dotL in JR32 prevented the strain from replicating
in U937 macrophages, and this defect could be complemented by the
addition of a plasmid containing
dotL+ (Fig.
7)
(52).
|
dotL strain was viable, closer examination
revealed that it displayed a key difference from other dot/icm
mutants (Table
2). Wild-type L. pneumophila stains, such as Lp02 and JR32,
exhibit a significantly decreased plating efficiency on buffered CYE
plates containing a low amount of sodium chloride (0.65%)
compared to growth on plates lacking sodium chloride
(11,
45,
64). Most
dot/icm deletions (e.g.,
dotA) exhibit an
increased plating efficiency on plates supplemented with salt (Table
2). However, the JR32
dotL strain was even more sensitive to sodium
chloride than JR32 (Table
2), suggesting that the
physiology of the JR32
dotL is perturbed. These data
suggest that loss of dotL in either the Lp02 strain or the
JR32 strain is detrimental to the
cell.
|
dotL strain to survive. Alternatively, a gene may be
absent in Lp02 that is normally able to suppress the lethality caused
by loss of dotL. In fact, a number of differences have been
reported between various L. pneumophila serogroup I isolates
including Lp01, the progenitor strain of Lp02, and JR32 (Table
1)
(6,
36,
47). One potential
candidate is lvhD4, which is present in JR32 but not in Lp01
(47). lvhD4 is
encoded in the lvhB1-11/lvhD operon and is a component of a
second type IV secretion system found in L. pneumophila
strains such as JR32
(51). lvhD4
encodes a protein with similarity to T4CPs, most specifically to the
A. tumefaciens VirD4
(51), and could in theory
functionally substitute for DotL.
To confirm that the JR32 and
Lp02 isolates we were working with contained and lacked lvhD4,
respectively, we performed Southern analysis with a probe specific to
lvhD4 (Fig.
8, top). Consistent with previous reports, Lp01 and Lp02 lacked
lvhD4, whereas JR32 and Philadelphia-1, the progenitor strain
for both Lp02 and JR32, both contained it (Fig.
8A). Lp01 and Lp02 may
have lost the lvhB-lvhD region during their derivation to
become restriction minus, since a number of restriction or modification
genes are located adjacent to the lvhB/lvhD4 system
(47). To determine
whether there was a connection between the presence of lvhD4
and
dotL lethality, we deleted lvhD4 from
JR32 or added it back to Lp02 and then assayed the consequence of
deleting dotL. dotL could still be deleted in a JR32
strain lacking the lvhB-lvhD4 region, indicating that
lvhD4 was not responsible for the viability of the JR32
dotL strain (Fig.
8B). Likewise, the
addition of the lvhB-lvhD4 region from JR32
to the Lp02 strain did not suppress loss of dotL. Therefore,
lvhD4 does not appear to be responsible for the altered
requirements of dotL in these two L. pneumophila
strains.
|
dotM and dotN are also essential for viability in the Lp02 background.
While
constructing a collection of dot/icm deletions, we were able
to generate in-frame deletions in 23 of the 26 known dot/icm
genes. However, similar to the dotL deletion, we could not
construct a deletion in dotM, the gene upstream of
dotL (Table
3). dotM, also known as icmP, codes for a predicted
inner membrane protein with similarity to TrbA of the IncI plasmids R64
and ColIb-P9 (24% amino acid identity). Since dotL and
dotM are likely to be cotranscribed in a two gene operon,
dotML, it was possible that the lethality of the dotM
deletion was due solely to polarity on the downstream dotL
gene (Fig. 4). However,
the
dotM mutation could not be obtained in the
presence of a complementing clone containing a wild-type version of
dotL, suggesting that the dotM lethality was not due
to polarity but reflected the essentiality of dotM (Table
3). Moreover, insertions
in dotM were obtained in a screen for genes that resemble
dotL, i.e., genes that are essential in the presence of a
functional Dot/Icm complex
(13).
|
dotN
could not be due to simple polarity on the downstream gene
dotO because deletions could easily be made in the
dotO gene. Similar to dotL, both dotM and
dotN could each be deleted in strains lacking a functional
dot complex (Table
3). These results indicate
that three dot genes, dotL, dotM, and
dotN are each essential for viability on bacteriological media
in the Lp02 background and in each case, the lethality can be
suppressed by inactivation of the Dot/Icm
complex. | DISCUSSION |
|---|
|
|
|---|
dotL lethality and have shown that the majority of
these map to other dot/icm genes. However, inactivation of
several dot/icm genes (dotK, icmS, and
icmW) did not suppress loss of dotL, indicating
specificity to the suppression. DotL has limited homology to the T4CP family of proteins. T4CPs have been proposed to play a central role in type IV secretion systems (34). They have been shown to bind substrates synthesized in the cytoplasm and target them to the secretion apparatus in the inner membrane (2, 15, 61). T4CPs have also been shown to interact with other components of the secretion apparatus, namely, the VirB10-family of proteins (20, 35). Finally, T4CPs are absolutely required for export of substrates (22). Based on their homology to Escherichia coli FtsK and Bacillus subtilis SpoIIIE, and their ability to bind DNA, T4CPs have been proposed to function as molecular pumps, driving export of substrates via hydrolysis of ATP (22). In consideration of these traits, T4CPs would appear to be likely candidates to function as regulators of the type IV secretion complexes.
Based on the
similarity of DotL to T4CPs, it is surprising that inactivation of the
dotL gene in strain Lp02 is lethal. No other known T4CP is
essential for viability. Moreover, the only proteins associated with
conjugative transfer that that are required for bacterial viability are
inhibitors of plasmid toxin segregation factors
(43). DotL, however,
shows no sequence similarity to such factors. In addition, if DotL
functioned as an inhibitor of a plasmid segregation toxin, then the
dotL lethality suppressors would be predicted to map
to the toxin. In contrast, many of the
dotL
suppressors are components of the Dot/Icm machinery, and the
non-dot/icm suppressors do not have homology to any known
toxin inhibitors.
To explain these overall observations regarding toxicity induced by loss of dotL, we propose that loss of the DotL protein results in the accumulation of a toxic structure consisting of a portion of the Dot/Icm complex (Fig. 9). This partial Dot/Icm complex could be deleterious for a number of different reasons. First, a partial Dot/Icm complex could misassemble or misfold in the absence of DotL, disrupting the membrane in some fashion. Alternatively, loss of dotL could be toxic because the type IV secretion system forms an unregulated pore in the membrane in the absence of DotL (Fig. 9). In this model, DotL would play the role of a regulator of the complex, controlling the opening and closing of the pore.
|
dotL
phenotype, increased sensitivity to sodium relative to a wild-type
strain, is much more consistent with an unregulated pore. Although the
sodium sensitivity of wild-type L. pneumophila strains is not
well understood, it is believed to result from leakage of sodium ions
through the Dot/Icm secretion apparatus
(11,
64). This model is
supported by the observation that strains resistant to sodium chloride
often contain mutations in dot/icm genes
(63). Taken in this
context, loss of a regulator of the secretion pore is predicted to
enhance the effect of exogenous sodium and is consistent with the
hypersensitivity of the JR32
dotL. Finally, there is
precedence in the literature of an example in which loss of a protein
resulted in an unregulated pore that can be lethal under certain
circumstances. Inactivation of Yersinia pestis lcrG results in
an unregulated type III secretion pore under certain conditions and has
led to the model where LcrG forms a plug at the base of the apparatus
(39,
58). Based on the phenotype of a strain lacking dotL, mutations that cause lowered viability in the presence of an intact Dot/Icm apparatus were previously isolated (13). lidA was shown to encode a protein exported by the Dot/Icm system that may interact directly with DotL (13). Other lid genes may encode proteins necessary for proper assembly of the Dot/Icm complex, particularly a subcomplex consisting of DotL, DotM, and DotN. For example, three Lid proteins are involved in disulfide bond metabolism and, since the DotN protein is rich in cysteine residues, it may be that mutations affecting the formation of disulfide bonds could disrupt folding of DotN (13).
The
dotL lethality phenotype in Lp02 has proven to be
useful for several additional reasons. First, it has provided a
convenient plate selection for additional dot/icm mutants.
This is noteworthy because many of the dot/icm genes were
identified by labor-intensive screens that have never been performed to
saturation (1,
3,
45). The only selection
for dot/icm mutants previously available was based on the
phenomenon that sodium-resistant L. pneumophila strains were
often avirulent, although this phenomenon is poorly understood and may
be mutagenic (11,
64). The benefit of our
new selection is amply demonstrated since we have already identified an
additional dot/icm gene, dotV, by this
procedure.
The
dotL lethality phenotype also
provides information about existing Dot/Icm proteins. A number of
Dot/Icm proteins that appear to be primarily cytoplasmic and not
membrane associated were still able to suppress the loss of DotL when
their genes were inactivated. For example, IcmQ and IcmR have been
shown to be soluble proteins in the cytoplasm of L.
pneumophila where IcmR appears to function as a chaperone for IcmQ
(16). Although the
specific function of IcmQ remains unknown, the fact that
icmQ and
icmR were able to suppress
the lethality caused by the
dotL suggests that they
are directly required for the assembly or activity of the Dot/Icm
complex. Another example is the DotB ATPase
(55). Although DotB does
not appear to be an integral component of the Dot/Icm membrane complex,
it is required for expression of the
dotL lethality
trait, thus indicating that the protein plays a role in the assembly
and/or function of the apparatus.
In contrast, inactivation of
icmS or icmW did not suppress loss of dotL.
Since icmS and icmW are predicted to encode
cytoplasmic proteins and have been proposed to function as chaperones
for secreted substrates
(12), their failure to
suppress is consistent with our model. Moreover, inactivation of a
secreted substrate ralF
(41) also failed to
suppress loss of dotL (unpublished results). One additional
Dot/Icm protein, the putative lipoprotein DotK, was also not required
for
dotL lethality. Combined with the observation
that a
dotK strain shows only mild defects for
intracellular growth
(53), this suggests that
DotK is not essential for the formation of the Dot/Icm complex. Further
examination of how various dot/icm mutants are able to
suppress loss of dotL may reveal information on which
components are key to formation of the secretion pore.
A third
interesting observation that resulted from our analysis of the
dotL lethality involved dotM and
dotN. Similar to dotL, we discovered that
dotM and dotN are also essential for viability in the
Lp02 background and are not essential for the viability of JR32 on
bacteriological media but are required for growth of JR32 inside
macrophages (50). Since
all three proteins appear to code for inner membrane components of the
secretion apparatus, it is possible that DotM and DotN interact with
DotL and regulate its activity, perhaps by modulating its proposed
nucleotide hydrolysis capability. In fact, we have recently shown that
DotM can be coimmunoprecipitated by using DotL specific antibodies
(Vincent and Vogel, unpublished).
It is interesting that deleting
dotL in two very closely related strains results in very
different phenotypes: death versus life. This is likely to be due to a
genetic difference between the two strains acquired during their
derivation. The JR32 strain may have acquired a suppressor mutation or
Lp02 may have lost a gene that prevents
dotL
lethality. One difference between these strains is that Lp02 lacks the
second type IV secretion system encoded by the lvhB operon
(47). However, deletion
of the lvhB operon in JR32 did not cause the dotL
deletion to be lethal, and therefore the identity of the suppressor(s)
remains to be discovered. Nevertheless, the difference between these
two strains may not be as profound as it initially appeared, since the
JR32
dotL strain is less fit than a wild-type strain,
as demonstrated by its hyper-NaCl sensitivity. It is possible that the
difference in phenotypes between the two strains is more a matter of
degrees of sensitivity to loss of dotL rather than JR32 being
impervious to its loss.
The
dotL phenotype
described here is consistent with the proposal that T4CPs function as
inner membrane gates for exported substrates
(49). Further
characterization of this interesting phenomenon should shed light not
only on the function of DotL and other T4CPs but also on the L.
pneumophila Dot/Icm complex and other type IV secretion
systems.
| ACKNOWLEDGMENTS |
|---|
G.M.C. was supported by training program J32AI1007422. This study was funded by the Whitaker Foundation (J.P.V.), the American Lung Association (J.P.V.), and NIH grant AI48052-01A2 (J.P.V.) and by funding from the Howard Hughes Medical Institute to R.R.I.
| FOOTNOTES |
|---|
B.A.B. and G.M.C. contributed equally to this study. ![]()
| REFERENCES |
|---|
|
|
|---|