Previous Article | Next Article ![]()
Journal of Bacteriology, May 2005, p. 3227-3237, Vol. 187, No. 9
0021-9193/05/$08.00+0 doi:10.1128/JB.187.9.3227-3237.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Department of Cell and Molecular Biology, Uppsala University, BMC Box 596, SE-751 24 Uppsala, Sweden
Received 15 September 2004/ Accepted 27 January 2005
|
|
|---|
|
|
|---|
The gram-positive soil bacterium Streptomyces coelicolor A3(2) is a hyphal organism with a complex developmental cycle that imparts unique features to its cell division (8, 16). S. coelicolor A3(2) has a single ftsZ gene, which, unlike in any other bacterium in which this has been investigated, is dispensable for growth and survival (39). FtsZ and the same basic cell division machinery are involved in at least two distinct types of septum formation, and Z rings are assembled in both cases (46). Infrequent septation without detachment of the daughter cells takes place in the substrate mycelium. This leads to formation of widely spaced cross walls that separate the syncytial cells in vegetative hyphae. In contrast, during sporulation of aerial hyphae, multiple septa are laid down synchronously to convert the multigenomic aerial hyphae into chains of unigenomic spores (5). This process requires the synchronous assembly of multiple and regularly spaced Z rings along the sporogenic aerial hyphal cells (17, 46). This is an interesting case of developmental control of cell division in which none of the systems that have been implicated in selection of division sites in other bacteria appear to have a role. Thus, while nucleoid occlusion affects the formation of Z rings and division septa in E. coli and vegetative cells of B. subtilis (22, 37), the early stages of sporulation septation in Streptomyces often occur over nonsegregated chromosomes, and separation of nucleoids is not observed until septal constriction has started (13, 40, 46). The cell division inhibitor MinC, together with the ATPase MinD, prevents septation near cell poles in many bacteria, and they are given a topological specificity through interaction with either MinE, as in E. coli, or DivIVA, as in B. subtilis (11, 37). The genome sequences of S. coelicolor and Streptomyces avermitilis lack any obvious homologues of minC and minE, which argues against the presence of a bona fide Min system in Streptomyces (13, 16). Furthermore, the S. coelicolor homologue of DivIVA was shown to primarily affect polar growth and morphogenesis, and it had no overt effect on cell division (12). This implies that neither the Min system nor nucleoid occlusion is used during Streptomyces sporulation and that other factors of unknown nature control this form of cytokinesis.
The developmental control of this synchronous cell division involves a sporulation-specific up-regulation of ftsZ expression in sporogenic hyphae in both S. coelicolor and Streptomyces griseus (15, 30). This occurred at one specific promoter and depended on a set of regulators of early stages of sporulationthe whiA, whiB, whiG, whiH, whiI, and whiJ genes (15). In addition, the isolation of a missense mutation in ftsZ that preferentially affected sporulation septation indicated that there are differences in the Z-ring assembly between vegetative and sporogenic aerial hyphae (17). Additional genes have been described that have effects on sporulation septation, but their modes of action and whether they affect the cell division machinery directly or indirectly are not clear. Examples include ssgA, ssgB, crgA, and samR (10, 26, 52, 55, 59).
In this paper, we address the mechanism of the synchronous assembly of multiple Z rings in sporulating aerial hyphae of S. coelicolor. By constructing an FtsZ-EGFP translational fusion, we were able to visualize the Z-ring assembly in vivo at different stages of development. We found that FtsZ assembly is developmentally modulated during sporulationit involves the formation of spiral-shaped FtsZ intermediates that are remodeled into regularly spaced Z rings before initiation of septation. The impact of some developmental regulatory genes on Z-ring assembly was also studied, and the possible interplay between chromosome partitioning and FtsZ polymerization is discussed.
|
|
|---|
(21) was used as a host for recombinant plasmids, and strain ET12567/pUZ8002 was used to drive conjugative transfer of nonmethylated DNA from E. coli to S. coelicolor as described previously (27). Cultivation of strains and general procedures for manipulation of DNA were performed as described for E. coli (45) and Streptomyces (27). S. coelicolor strains were cultivated on mannitol soy flour agar plates (MS agar) or in tryptone soy broth (TSB) (27). |
View this table: [in a new window] |
TABLE 1. Strains of Streptomyces coelicolor A3(2) used in this work
|
C31 integration system and an aac(3)IV apramycin resistance gene. The resulting pKF41 plasmid was transformed into the methylation-deficient ET12567/pUZ8002 strain and transferred by conjugation into S. coelicolor strains, in which it integrates into the chromosomal
C31 attB site. The expression of the FtsZ-EGFP fusion protein in pKF41 is driven by the natural ftsZ promoters, which are included on the plasmid. Plasmid pKF100, which contains the ftsZ17(Spo) allele (17) translationally fused at its 3' end to egfp, was created by amplifying the ftsZ17(Spo) allele, its upstream region, and the 3' end of ftsQ by PCR from plasmid pO17 (17) using the primers KF66 (CGGAATTCGTCAAGGTCCGCTCCTAC) and KF46 (TCCGGATCCTTCAGGAAGTCCGGCACGT), as described above. The PCR-amplified DNA was ligated into the pGEM-T vector (Promega Corp.) and subsequently cut out as a BamHI-EcoRI fragment and ligated into the pEGFP-1 vector (see above). The resulting pKF100 plasmid was digested with BglII and NotI, and the resulting fragment was cloned into pIJ8600 as described above. This yielded plasmid pKF101, which was transferred by conjugation into Streptomyces as described above.
The ftsZ genes carried on plasmids pKF41 and pKF101 were sequenced using dye termination chemistry and an ABI Prism 877 robotic workstation (Applied Biosystems). The readings from an ABI Prism 377 DNA Sequenator (Applied Biosystems) were assembled into "contigs" by the Staden Package Program (Medical Research Council, Laboratory of Molecular Biology, Cambridge, United Kingdom) and checked manually for mismatches.
Fluorescence microscopy. For visualization of the FtsZ-EGFP hybrid protein in vegetative mycelium, liquid cultures were grown overnight in TSB medium. Ten microliters of the overnight culture were spread on microscope slides coated with 1% agarose in H2O. For visualization of the FtsZ-EGFP hybrid protein in aerial hyphae, cultures were set up by inserting a sterile coverslip into the MS agar and inoculating along the acute angle between the glass and the agar surface (6). Alternatively, cultures were grown on MS agar plates for 2 to 4 days and impression preparations were taken by lightly pressing a coverslip on the surface of the colony (6). Coverslips with attached aerial mycelium were mounted in 50% glycerol in phosphate-buffered saline on poly-L-lysine-coated slides.
Immunofluorescence microscopy of FtsZ was carried out as described previously (17, 46). All fluorescence and phase-contrast microscopy was performed using an Axioplan II imaging fluorescence microscope equipped with appropriate filter sets, an Axiocam charge-coupled device camera, and Axiovision software (Carl Zeiss Light Microscopy). Digital images were processed using Adobe Photoshop version 7.0 software.
Deconvolution microscopy was performed on FtsZ-EGFP-expressing aerial hyphae from cultures grown on MS agar for 30 to 40 h. The microscopy was carried out as described above, and Z stacks containing 15 to 35 images were collected at a spacing of 0.05 to 0.1 µm and deconvolved using the Regularized Inverse Filter or the Constrained Iterative algorithm of the Axiovision software (Carl Zeiss Light Microscopy).
Sporulation assay. The sporulation capacities of the studied strains were estimated by inoculating an equal amount of spores from each strain on MS agar and quantifying the number of spores produced by the cultures after 6 days of incubation.
In most of the cases, 107 CFU of spores was spread on MS agar. After 6 days of incubation at 30°C, the newly formed spores from each plate were collected and prepared as described previously (27). Serial dilutions were made from each spore preparation and plated on MS agar in duplicate. The plates were scored after 4 to 5 days of incubation, and the number of spores in each preparation was calculated as CFU/ml.
|
|
|---|
C31 attachment site of the wild-type strain M145. The resulting K202 strain showed unaffected vegetative growth and sporulation as judged by its appearance in liquid culture and on plates in comparison to its parent (for further analysis, see below). Fluorescence microscopy revealed that FtsZ-EGFP assembled, presumably as mixed polymers with the native FtsZ in this strain, into bands or ring-like structures perpendicular to the hyphal length axis in both vegetative and aerial hyphae of K202 (Fig. 1). These structures could be clearly seen to have a ring shape only in some cases, but we make the assumption that they are FtsZ rings and will refer to them here as Z rings. The appearance and distribution of these Z rings were similar to those observed previously by immunofluorescence microscopy (17, 46), indicating that this strain was useful for examining FtsZ behavior during development.
![]() View larger version (101K): [in a new window] |
FIG. 1. Visualization of Z rings in vegetative hyphae (A and B) and sporogenic aerial hyphae (C and D) of the strain K202, which expresses both FtsZ-EGFP and the native FtsZ. The strain carries plasmid pKF41 with an ftsZ-egfp translational fusion. Panels A and B show overlays of fluorescence (EGFP) and phase-contrast micrographs of vegetative mycelium grown from spores in liquid TSB medium for 10 h (A) or 18 h (B). A germinated spore is indicated by "Sp." Panels C and D show fluorescence (EGFP) (C) and phase-contrast (D) micrographs of aerial hyphae after 40 h of incubation on MS agar. One example of a sporogenic hypha with clearly visible multiple Z rings is shown. Size bar, 5 µm.
|
(ftsZ-egfp)Hyb]. The strain was grown on MS agar, and living hyphae attached to coverslips were examined microscopically after 28 to 48 h of growth. Many aerial-hyphal cells showed increased levels of fluorescence, indicating that developmentally controlled up-regulation of ftsZ expression had commenced, and in some of them, regularly spaced multiple Z rings had formed. Intriguingly, the distribution of the fluorescence signal within the individual hyphae repeatedly showed characteristic patterns different from regular ladders of Z rings, and these patterns appeared to change in relative abundance depending on the time of sampling. These observations pointed toward the possibility of the Z-ring assembly being a multistep process involving remodeling of the FtsZ polymers. A number of distinct types of FtsZ-EGFP patterns could be distinguished, and in order to facilitate their interpretation, they were arbitrarily divided into six classes as follows (representative examples of each class are shown in Fig. 2). The hyphae from class 1 had one or two Z rings in their basal parts and contained only low levels of fluorescence (Fig. 2A). They were considered sporogenic based on their characteristic smooth shape and because they were often sticking up from the network of aerial hyphae. Class 1 aerial hyphae appeared after around 28 h of incubation with some variation between different experiments. In the hyphae of class 2, the intensity of the fluorescence was higher and the signal was mainly diffuse except for one or two Z rings, often in the basal part of the hypha, and/or occasional spiral-shaped structures (Fig. 2B). Class 3 hyphae showed extensive, often irregular, spiral-shaped structures and had a high level of diffuse FtsZ-EGFP fluorescence (Fig. 2C). In class 4 hyphae, variable numbers of short spirals, irregular or tilted Z-ring-like structures, and even some apparently completed Z rings were seen (Fig. 2E), and they were generally observed as distinct structures in hyphae where the level of diffuse fluorescence was lower than in classes 2 and 3. Class 5 represents regular ladders of multiple Z rings, as exemplified in Fig. 1C and 2F and in previous reports (17, 46). Class 6 represents hyphae with visibly invaginating septa, as detected in phase-contrast illumination (Fig. 2H). Thus, any fluorescent structures seen in these hyphae are not directly relevant to the events leading up to initiation of division and have not been further considered here.
![]() View larger version (71K): [in a new window] |
FIG. 2. Classification of the patterns of FtsZ-EGFP localization in sporogenic aerial hyphae. S. coelicolor strain K202 (M145 with the plasmid pKF41 [ftsZ-egfp]) was grown on MS agar, and fluorescence micrographs of FtsZ-EGFP assembly in aerial hyphae were taken after 28 to 38 h of colony development. The hyphae were subdivided into developmental classes according to their characteristic pattern of FtsZ localization (as described in the text). A representative example of a hypha from each class is shown: class 1 (A); class 2 (B); class 3 (C); class 4 (E); class 5 (F); class 6 (G). A phase-contrast micrograph of the hypha represented in panel C reveals no signs of septal constrictions (D), while the phase-contrast micrograph of the hypha represented in panel G shows constrictions at the sites of sporulation septation (H). Arrows indicate examples of visible constrictions. Size bar, 5 µm.
|
![]() View larger version (77K): [in a new window] |
FIG.3. Spiral-shaped FtsZ filaments in sporogenic aerial hyphae of S. coelicolor. Fluorescence micrographs showing spiral-shaped FtsZ-EGFP filaments in sporogenic aerial hyphae of K202 (A, C, E, G). The micrographs were generated by deconvolving Z stacks of images, taken after about 35 h of development on MS agar. The hyphae shown in the separate micrographs originated from independent experiments. Each micrograph is a single image from a focal plane lying roughly in the middle of the cell after the blur was removed by deconvolution. The corresponding phase-contrast micrographs of the hyphae depicted in the fluorescence images are shown (B, D, F, H). One example is shown of fluorescence micrographs showing spiral-shaped FtsZ-EGFP filaments before (I) and after (J) being subjected to deconvolution. An example of immunolocalization of native FtsZ in sporogenic aerial hyphae of M145 is shown as a fluorescence (K) and a phase-contrast (L) micrograph. The arrowhead in panel G marks an example of a short spiral, and arrows in panels E and G indicate structures reminiscent of tilted Z rings. The nonfluorescent hyphae that are visible in some panels had not entered sporulation and therefore exhibit very little ftsZ expression. Size bar, 5 µm.
|
![]() View larger version (20K): [in a new window] |
FIG. 4. Time course of the dynamic assembly of FtsZ-EGFP. Two coverslips with attached aerial mycelium were examined at each time point. According to the pattern of the fluorescence signal from FtsZ-EGFP, the overtly sporogenic aerial hyphae in each examined field were assigned to any of the arbitrary classes shown in Fig. 2. The histogram shows the relative number of hyphae from a particular class at a particular time point, represented as a percentage of the total number of sporogenic hyphae discerned in the microscopical preparation at that time point. Between 100 and 400 hyphae were counted for each time point.
|
Functionality of the FtsZ-EGFP hybrid protein. In order to investigate how functional the product of the ftsZ-egfp fusion carried on pKF41 was, it was introduced into the ftsZ-null mutant HU133, yielding the strain K203. This strain had lost the blue halo characteristic of HU133 and grew to an almost normal colony size on MS agar (Fig. 5A). K203 was capable of producing grey aerial mycelium, but sporulation was delayed. Microscopic examination of the aerial mycelium showed that spores were formed at a lower frequency than is typical for wild-type strains and that they were of variable shape and size, and many nonseptated aerial hyphae were observed (Fig. 5C). These observations showed that the fusion protein was partially functional, since it restored apparently normal vegetative growth to the ftsZ-null mutant HU133, but not sufficiently functional to restore normal sporulation septation to this strain. Immunoblot analysis of strain K202 showed that FtsZ-EGFP was present at a relatively low level in comparison to native FtsZ (data not shown), suggesting that it may be an unstable protein and that cleavage of the EGFP off the hybrid protein could contribute to the partial functionality of this protein.
![]() View larger version (94K): [in a new window] |
FIG. 5. Sporulation phenotypes of strains carrying the ftsZ-egfp translational fusion. Panel A shows the colony appearance after 5 days of growth on MS agar, and panels B to F are phase-contrast micrographs of examples of spore chains and aerial hyphal fragments from the surfaces of colonies after 5 days of growth on MS agar. The S. coelicolor strains were the following: B, O17 {HU133 with plasmid pO17 [ftsZ17(Spo)]}; C, K203 (HU133 with plasmid pKF41 [ftsZ-egfp]); D, J2417 (HU133 with plasmid pKF32 [ftsZ+]); E, K205 {HU133 with plasmid pKF101 [ftsZ17(Spo)-egfp]}; F, HU133 ( ftsZ::aphI).
|
(ftsZ-egfp)Hyb context in strain K202, and growth and development of this strain on plates was indistinguishable from that of the parent ftsZ+ strain M145 (data not shown). The sporulation capacities of the strains bearing the ftsZ-egfp fusions were quantified, and the sizes of the spores were scored. The sporulation capacity of strain K202 was estimated as being equal to that of the parent, M145. Both strains yielded spores with similar average sizes after 6 days of growth on MS agar (average length, 1.02 ± 0.21 µm for M145 and 1.17 ± 0.43 µm for K202). The difference was due to a somewhat larger number of irregular and elongated spores and spore-like compartments in K202. In occasional vegetative or aerial hyphae, often morphologically deviating from normal hyphae, conspicuous strongly fluorescent and irregularly shaped structures were seen, presumably reflecting accumulation of nonfunctional FtsZ aggregates. Cells with such structures were rare and had no impact on quantitative analyses like those presented in Fig. 4. The production of normal amounts of regularly sized spores, and the observation of FtsZ-EGFP at expected locations (Fig. 1) in the great majority of cells, showed that, although the EGFP tag disturbed the functionality of FtsZ, there were no strong dominant-negative effects of the FtsZ-EGFP fusion. These observations support the notion that FtsZ-EGFP could form mixed polymers with the native FtsZ and be used to detect the subcellular localization of FtsZ polymers.
Interestingly, the fusion between the FtsZ17(Spo) mutant protein, which is unable to support sporulation (17), and EGFP restored sporulation to the ftsZ-null strain HU133 when expressed from the pKF101 integrating plasmid. The resulting strain was called K205, and it grew and developed as well as the congenic ftsZ+ strain J2417 on MS agar in terms of colony size and ability to produce grey spore pigment (Fig. 5A). In contrast, the O17 strain, which contains the ftsZ17(Spo) mutant allele on an integrating plasmid, was unable to sporulate, remained white during development, and gave fewer colonies than K205 upon restreaking (Fig. 5A). In accordance with these observations, sporulation assays and microscopic examination showed abundant production of spores of regular size in K205 (0.94 ± 0.20 µm), while O17 produced only aberrantly septated or nonseptated aerial hyphae (Fig. 5B and E). Thus, there was a mutual suppression of the negative effects on ftsZ function between the ftsZ17(Spo) mutation and the EGFP tag. This suppression appears to work only intramolecularly, since no suppression was seen when the ftsZ17(Spo) and
(ftsZ-egfp)Hyb alleles were present in trans in the same strain (17).
Strain K204, which carries ftsZ17(Spo)-egfp in addition to the native ftsZ, showed spiral-shaped FtsZ structures during sporulation similar to those of strain K202, which carries the normal ftsZ-egfp fusion (data not shown). Since ftsZ17(Spo)-egfp produces a more functional protein than ftsZ-egfp according to the assays described above, this further argues against the possibility that the spiral-shaped structures were defective polymers or artifacts caused by the disturbed functionality of the EGFP fusion protein.
Effects of developmental regulators whiA, whiB, whiG, whiH, and whiI on expression and assembly of FtsZ-EGFP. The localization of FtsZ-EGFP in living aerial hyphae of the whiA, whiB, whiG, whiH, and whiI disruption mutants containing the pKF41 plasmid was examined, since these genes are required for full sporulation septation. Aerial hyphae were investigated after 4 to 6 days of incubation on MS agar (Fig. 6), when the aerial hyphae of the mutants had developed their characteristic phenotypes.
![]() View larger version (28K): [in a new window] |
FIG. 6. Visualization of FtsZ-EGFP assembly into Z rings in aerial hyphae of the whiG mutant strain J2400 (A), whiB mutant J2402 (B), whiI mutant J2450 (C), and whiH mutant J2408 (D) after 96 h of development on MS agar plates. Size bar, 5 µm.
|
The whiH mutant K209 differed somewhat from the other mutants. Several (4 to 12) Z rings were observed in many aerial hyphae of this strain (Fig. 6D). They were irregularly spaced and of variable shape and fluorescent intensity, even with occasional short helical structures. Although much lower than in the wild-type strains, this frequency of Z rings was higher than in any of the other whi mutants that were examined and higher than can be explained by the vegetative type of septation. A slight increase in the overall fluorescence signal was seen in the whiH aerial hyphae that contained these Z rings, but this increase was small compared to the intensity in the sporogenic hyphae of the wild-type counterpart, strain K202. Thus, the absence of large numbers of Z rings can be accounted for by the previously reported failure to up-regulate ftsZ expression in the whiH mutant also, and it is not possible to determine whether there are any additional specific effects of the tested whi genes on the assembly of FtsZ.
|
|
|---|
Based on these results, we propose a model for the assembly of FtsZ prior to sporulation septation in S. coelicolor (Fig. 7). The process may start with the placement of a Z ring and a basal septum in the distal part of the sporogenic hypha (stage A). For S. griseus, it has been suggested that the sporogenic cells are delimited at the base by a specialized septum, different from both vegetative cross walls and sporulation septa (30). No direct equivalent has been observed in S. coelicolor. However, we frequently see one or two hyphal cross walls, similar to vegetative septa, in the aerial branches that sporulate, but in the section below what will become the actual spore chain (unpublished observations). We suggest that such a septum demarcates the compartment in which sporulation septation later commences with a significantly increased expression of FtsZ, as judged by the increase in the fluorescent signal from FtsZ-EGFP. The latter observation is in agreement with the developmentally controlled induction of ftsZ transcription in sporogenic hyphae (15, 30). The rise in the cytoplasmic concentration of FtsZ leads to the initiation of assembly into spiral-shaped filaments (Fig. 7, stage B). The exact shape, helical pitch, and length of these polymers were for technical reasons difficult to visualize and appeared to be variable, but they formed throughout the length of the sporogenic cell, and no particular site of initiation or nucleation of the structures could be discerned. We propose that the spiral-shaped filaments are continually remodeled and eventually transformed into short helical or ring-like structures (Fig. 7, stage C) that subsequently give rise to an array of regularly spaced Z rings (Fig. 7, stage D). As judged from the low abundance of hyphae with pronounced regular ladders of Z rings in the time course experiments (class 5 in Fig. 4), we speculate that this is a short-lived stage and that septation rapidly commences once the FtsZ polymers have coalesced into stable rings. Thus, the hyphae with ladders of Z rings rapidly trigger sporulation septation and develop visible constrictions (Fig. 7, stage E). This leads to the formation of chains of unigenomic spores (Fig. 7, stage F).
![]() View larger version (63K): [in a new window] |
FIG. 7. Schematic representation of the proposed progression of dynamic localization of FtsZ during sporulation of S. coelicolor M145. The different stages discussed in the text are indicated by letters. FtsZ localization is shown in green. The arrow points to the putative basal septum.
|
The identity of the putative developmental regulator(s) that modulates the cell division machinery to give rise to sporulation septation remains to be elucidated. We have examined the effects of the developmental regulatory genes whiA, whiB, whiG, whiH, and whiI on the expression and assembly of FtsZ during sporulation. The failure of whiA, whiB, whiG, and whiI mutants to make more Z rings than during vegetative growth (Fig. 6) is consistent with their deficiency in sporulation-specific induction of the ftsZ2p promoter in aerial hyphae (15). This was reflected here by the low expression of the FtsZ-EGFP translational fusion in aerial hyphae of these strains. Similar abundances of Z rings have previously been observed using immunolocalization of FtsZ in aerial hyphae of whiB- and whiG-deficient strains (46). The higher frequency of Z rings in the whiH mutant is consistent with the fact that this mutant, in contrast to the others, is capable of laying down a few sporulation septa (14, 46). Although the exact significance of these Z rings, and whether they are all used for septation, is unclear, it distinguishes whiH from the other early whi genes in relation to cell division control. Finally, although the comparatively low expression may be sufficient to explain the failure of these mutants to make sporulation septa, the possibility cannot be excluded that any of the whi genes may affect cell division by other mechanisms in addition to transcriptional control of ftsZ.
The dynamic behavior of the FtsZ polymers raises questions regarding the factors that guide the regular placement of series of Z rings in sporogenic hyphae and ensure the production of uniformly sized spores containing one copy of the genome each. The actions of these factors are likely to be different from that of the Min system and an overt "nucleoid veto." Whereas such mechanisms inhibit FtsZ polymerization at other sites than midcell in many bacteria, an important implication of the results reported here is that in Streptomyces FtsZ can start assembling into filaments along most of the sporogenic hyphal cell without any apparent zones of inhibition. An interesting possibility, then, is that the remodeling and congregation of these polymers into evenly distributed Z rings could be influenced by the positioning of the chromosomes. There may be a stage in the process of sporulation when individual chromosomes or particular chromosomal loci are being aligned in a certain way along the lengths of sporogenic hyphae, thus influencing the distribution of the Z rings. Also, either the arrays of Z rings or the growing sporulation septa may direct the regular partitioning of the individual nucleoids. These speculations are supported by reports of irregularly placed sporulation septa in mutants defective in chromosome partitioning (28, 57) and the observed segregation defects in mutants specifically defective in making sporulation septa, such as whiH, ftsZ
2p, and ftsZ17(Spo) strains (7, 15, 17).
A number of studies have described the ability of FtsZ to produce spiral-like filaments in vivo. Such structures have been observed both in certain mutants in E. coli and B. subtilis and upon overexpression of FtsZ in E. coli (1, 24, 36, 41, 47). Most recently, it was reported that highly mobile helix-like structures are part of the normal cycle of FtsZ assembly in E. coli (53). In the case of Streptomyces sporulation, the challenge is now to determine how such FtsZ spirals can be reshaped into a large number of Z rings. Although the structure of FtsZ protofilaments has been elucidated (32, 33), the assembly and nature of the polymers in the Z ring in vivo remains unclear, and it is not known how FtsZ protofilaments interact with each other and with other proteins (34). Such interactions should be crucial for the in vivo dynamics of FtsZ polymerization and are likely to be critical for the remodeling of the extensive spiral-shaped structures in S. coelicolor. The efficiency of sporulation septation seems to be a sensitive indicator of disturbances in the behavior of the FtsZ polymers, and this can even be detected as decreases in the amount of spore pigment being produced (15, 17). Thus, S. coelicolor may offer a powerful system for genetic analysis of the in vivo dynamics of FtsZ.
We thank Nora Ausmees and Santanu Dasgupta for discussions and constructive criticism of the manuscript.
|
|
|---|
H controls the expression of ssgB, a homologue of the sporulation-specific cell division gene ssgA, in Streptomyces coelicolor A3(2). Mol. Genet. Genom. 267:536-543.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»