Previous Article | Next Article 
Journal of Bacteriology, June 2006, p. 4581-4584, Vol. 188, No. 12
0021-9193/06/$08.00+0 doi:10.1128/JB.00211-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
The rcsA Promoter of Pantoea stewartii subsp. stewartii Features a Low-Level Constitutive Promoter and an EsaR Quorum-Sensing-Regulated Promoter
Aurelien L. Carlier and
S. B. von Bodman*
Departments of Plant Science and Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut 06269-4163
Received 8 February 2006/
Accepted 28 March 2006

ABSTRACT
The upstream region of the
Pantoea stewartii rcsA gene features
two promoters, one for constitutive basal-level expression and
a second autoregulated promoter for induced expression. The
EsaR quorum-sensing repressor binds to a site centered between
the two promoters, blocking transcription elongation from the
regulated promoter under noninducing conditions.

TEXT
Pantoea stewartii subsp.
stewartii is the etiological agent
of Stewart's wilt disease in maize (
2,
3). The organism grows
in the plant xylem, where it produces large amounts of stewartan
capsular polysaccharide/exopolysaccharide (EPS), thereby impeding
normal vascular transport (
16). A cluster of 12 genes, designated
cps, encodes the functions required for stewartan biosynthesis
and translocation (
5,
8). This gene system is related to group
1
cps gene clusters based on the chromosomal linkage to the
rfb and
his locus and regulation by the RcsC/YojN/RcsA/B phosphorelay
signal transduction system (
17,
24,
32). The RcsAB heterodimeric
transcription factor binds to an RcsAB box element generally
located some distance (

100 bp) from the regulated promoters
(
31).
In P. stewartii subsp. stewartii, the synthesis of stewartan EPS is cell density dependent and governed by the EsaI/EsaR quorum-sensing system (28). The EsaI protein is an acyl homoserine lactone (AHL) signal synthase (27, 30), and EsaR is the cognate AHL-responsive transcription factor (19, 28). This system differs from the LuxR paradigm in that EsaR dimerizes and binds DNA in the absence of the AHL coinducer, thereby repressing or activating target genes depending on the location of the esaR box DNA binding site (18, 21, 26). We recently reported that EsaR controls the expression of the cps gene system indirectly through transcriptional repression and AHL-mediated derepression of the rcsA gene (18). Quorum-sensing systems govern the synthesis of EPS in other phytopathogenic bacteria, but the underlying regulatory mechanisms differ (7, 9, 22). To our knowledge, P. stewartii subsp. stewartii represents the only described example of a species in which the rcsA gene is under direct quorum-sensing control (18).
In this study, we identify the transcriptional start site(s) and promoter site(s) within the upstream region of the rcsA gene to further define the mode of quorum-sensing regulation at this promoter. We observe that the rcsA gene expresses at significant basal levels from a previously unrecognized constitutive promoter and that the induced expression initiates from a separate, AHL-inducible, RcsA-autoregulated promoter. The previously established EsaR DNA binding site (18, 19) is centered between the two promoters, suggesting that EsaR represses transcription by interfering with transcription elongation rather than by steric exclusion of RNA polymerase from the inducible promoter.
Bacterial strains and growth conditions.
The P. stewartii subsp. stewartii strains used in this study were ESN10 and ESN51, which are mutant strains derived from the wild-type strain DC283 (8). These strains carry different mutated alleles of the esaI gene (18, 27). The esaI gene in ESN10 is disrupted with a chloramphenicol resistance cassette (18), while strain ESN51 carries a Tn5 (kanamycin resistance) transposon insertion (27). Strain PSS11 is an rcsA mutant derivative of ESN10 (18). Escherichia coli strain S17-1 (23) was used for the transfer of reporter plasmids into P. stewartii subsp. stewartii. Strains were grown in Luria-Bertani medium and AB minimal medium-0.2% glucose (4). P. stewartii subsp. stewartii was grown at 28°C and E. coli at 37°C.
Constitutive, RcsA-independent transcription of the rcsA gene.
Preliminary data suggested that the rcsA gene expresses at significant basal levels. To verify this observation, we created plasmid pAUC30, which carries the 600-bp upstream DNA region of the rcsA gene cloned into a gfpmut promoter probe vector, pFPV25 (18, 25). This plasmid was conjugally transferred into the esaI, AHL signal synthase-deficient P. stewartii subsp. stewartii strain ESN10 and separately into the esaI rcsA double mutant strain PSS11 for parallel evaluation. The levels of green fluorescent protein (GFP)-specific fluorescence expressed by ESN10(pAUC30) and PSS11(pAUC30) were measured on 200-µl culture aliquots using a FLUOstar OPTIMA microtiter plate reader (BMG Labtech, Durham, NC). The data summarized in Table 1 show that the rcsA promoter expresses at similar significant basal levels in both strains under noninducing conditions, indicating that basal-level expression is RcsA and AHL independent. These data also show that induction of the reporter fusion by AHL-mediated quorum sensing requires a functional copy of rcsA, which is present in strain ESN10 but lacking in PSS11. These genetic data corroborate our prediction that EsaR-mediated quorum sensing governs rcsA transcription by blocking the RcsA-positive feedback loop (18).
View this table:
[in this window]
[in a new window]
|
TABLE 1. GFP expression from the rcsA promoter in the esaI strain ESN10 and esaI rcsA double mutant strain PSS11 under noninducing and inducing conditions
|
The upstream region of the rcsA gene features two promoters.
To further define the mechanism for basal and induced
rcsA expression,
we created a set of pFPV25-based GFP reporter fusions carrying
partial DNA fragments of the 600-bp
rcsA upstream region. We
cloned DNA segments (schematically illustrated in Fig.
1A) corresponding
to bp 588 to 380, 588 to 316, and
385 to +13 from the translation initiation codon after
PCR amplification by using the primer sets 5'-CCATA
GGATCCAAATTCACAACTATCC
and 5'-ACAAG
AAGCTTCACACAATATTTTTTCT to create the reporter plasmid
pAUC31, 5'-CCATA
GGATCCAAATTCACAACTATCC and 5'-CATTT
AAGCTTCGAAAGTGTAAGGCTGA
to generate the reporter plasmid pAUC32, and 5'-CAAGA
GGATCCATTGTGTGATTTTTCTT
and 5'-ATAAT
AAGCTTCATGTTAGCGACCCTCA to create the reporter plasmid
pAUC33, respectively. The individual reporter constructs were
transferred into the
esaI mutant strain ESN51 (
28). Each strain
was grown to an optical density at 600 nm of 0.5 in AB minimal
medium-glucose with and without inducing levels of AHL extracts
(1,000
x). AHL from crude wild-type and
esaI mutant (control)
culture supernatants was extracted by a method adapted from
Elasri et al. (
10). GFP fluorescence of the induced and uninduced
cultures was measured as described previously. The data summarized
in Fig.
1B show that the reporter constructs pAUC30 (full-length
promoter region), pAUC32 (partial fragment, bp 588 to
316), and pAUC33 (partial fragment, bp 385 to
+ 13) all exhibit similar, significant basal levels of GFP expression
in the absence of exogenous AHL. In contrast, the reporter plasmid
pAUC31 (partial promoter fragment, bp 588 to 380)
lacks basal-level GFP expression. We conclude that the region
between bp 380 and 326 from the ATG translation
initiation codon contains a putative constitutive promoter.
The promoter fragments carried on pAUC30, pAUC31, and pAUC32
are AHL responsive, while that borne on pAUC33 is not. The responsive
promoter fragments each feature a conserved RcsAB box (
31) and
the previously established EsaR binding site (
18), both of which
are lacking in the promoter fragment of pAUC33. The fact that
the promoter fusion of pAUC31 is AHL inducible establishes a
likely location for the regulated promoter in the region between
bp 588 and 380. Interestingly, the expression
levels from the partial promoter fragment carried on plasmid
pAUC32 (bp 588 to 316) are approximately twofold
higher than those obtained from the full-length
rcsA promoter
fusion carried on plasmid pAUC30. This subtle difference may
be due to undefined structural silencing effects associated
with the untranslated 5' region of the mRNA, as suggested by
Majdalani and Gottesman (
17).
Biochemical evidence for two promoters.
We performed primer extension analysis of mRNAs extracted from
strain ESN51 grown in AB minimal medium-glucose with and without
AHL supplementation. Total RNA was isolated using the Masterpure
RNA kit (Epicenter, Madison, WI) by following the protocol recommended
by the manufacturer. Contaminating genomic DNA was removed by
RQ1 DNase (Promega, Madison, WI). The primer 5'-GTCGAATCCACATCGGGTATTGATGTAA
was 5'-end phosphorylated in the presence of T4 kinase (Epicenter,
Madison, WI) and [

-
32P]ATP (Perkin-Elmer, Boston, MA). The primer
extension reactions were carried out in the presence of Superscript
III reverse transcriptase (Invitrogen) at 55°C for 1 h.
The autoradiogram in Fig.
2A shows two major primer extension
products. Uninduced cells yield significant levels of a shorter
transcript with an apparent adenosine (A) transcriptional start
site at residue 336 from the translation initiation codon.
A conserved
70 promoter consensus sequence is properly positioned
from the identified transcriptional start site and represents
the likely constitutive promoter. The second, larger extension
product corresponds to a transcript with an apparent guanosine
(G) transcriptional start site located at bp 460 from
the translation initiation codon. This transcript appears primarily
under AHL-inducing conditions. A likely inducible promoter located
between bp 497 and 470 (Fig.
2B) precedes the
G transcriptional start site. Interestingly, this promoter is
located upstream of the previously established EsaR binding
site (bp 421 and 401) (
18). In addition, a well-conserved
RcsAB binding motif (78.6% identity to the consensus TaAGaatatTCctA
sequence [
31], where the uppercase letters indicate conserved
residues) is located 25 bp upstream of the 35 promoter
consensus sequence of this predicted inducible promoter. The
assignment of these inducible promoter elements differs from
those specified in a previous publication, which was based on
bioinformatics predictions and the assumption that EsaR blocks
transcription initiation (
18).
Quorum-sensing regulation of the rcsA gene.
The genetic and biochemical data presented in this report allow
us to develop a model for the expression of an RcsA coactivator.
In this model, the
rcsA promoter of
P. stewartii subsp.
stewartii features an upstream, quorum-sensing-responsive, RcsA-autoactivated
promoter and a downstream constitutive promoter. The two promoters
are separated by a 97-bp region that includes the
cis-acting
esaR box element (
18). At a low cell density and low AHL concentration,
ligand-free EsaR binds to the
esaR box, which presumably blocks
transcription elongation from the upstream promoter. Transcription
from the constitutive promoter remains unaltered. At a high
cell density and high AHL concentration, EsaR repression relaxes
(
19), allowing transcription from the upstream promoter and
priming of a positive RcsA-dependent feedback loop for the induced
transcription of the
rcsA gene. This hierarchical regulatory
scheme remains unique, to our knowledge.
An inherent feature of many quorum-sensing systems is the positive-feedback regulatory circuit at the level of autoinducer signal synthesis, which is thought to be a key factor in the switch-like control of quorum-sensing-regulated phenotypes (11-14, 29). However, in P. stewartii subsp. stewartii, AHL synthesis is constitutive, and the expression of esaR is autorepressed (19, 27). Thus, the positive-feedback regulatory loop at the RcsA level may be a key contributing factor to a rapid "off-on" switching mechanism for EPS synthesis. In this regard, we have shown that the onset of EPS synthesis in P. stewartii subsp. stewartii is strictly cell density linked, generally ensuing at
2 x 108 cells/ml when grown in liquid culture (28).
The EsaR/RcsA regulatory hierarchy may represent a strategy for coupling the Rcs environmental sensory pathway with the EsaR population density sensory system, presumably to ensure that EPS synthesis occurs exclusively when both inputs coincide. The integration of the rcsA and quorum-sensing signaling networks, however, may play an even broader role in governing the transition between successive stages of biofilm development in P. stewartii subsp. stewartii. For example, in E. coli and Salmonella enterica serovar Typhi, the RcsAB heterodimer represses surface adhesion and motility, which are functions typical of early biofilm development (1, 6, 15, 17, 20). Conversely, RcsAB activates the synthesis of EPS, which contributes to biofilm maturation. In addition, RcsB plays a role in the activation of cell division independently of RcsA (17). Assuming that RcsA and RcsB serve similar roles in P. stewartii subsp. stewartii, the quorum-sensing control of the RcsA coactivator may represent a key mechanism for coordinating the differential expression of physiological processes that define population development.

ACKNOWLEDGMENTS
We thank Carmen Herrera, Maria Koutsoudis, Dimitris Tsaltas,
and Tim Minogue for helpful discussions.
This research was supported by the National Science Foundation (grant MCB-0211687), the Agricultural Experiment Station (grant CONS00775), and the University of Connecticut Research Foundation.

FOOTNOTES
* Corresponding author. Mailing address: Department of Plant Science, University of Connecticut, 1390 Storrs Rd., Storrs, CT 06269-4163. Phone: (860) 486-4408. Fax: (860) 486-0534. E-mail:
susanne.vonbodman{at}uconn.edu.


REFERENCES
1 - Arricau, N., D. Hermant, H. Waxin, C. Ecobichon, P. S. Duffey, and M. Y. Popoff. 1998. The RcsB-RcsC regulatory system of Salmonella typhi differentially modulates the expression of invasion proteins, flagellin and Vi antigen in response to osmolarity. Mol. Microbiol. 29:835-850.[CrossRef][Medline]
2 - Bradshaw-Rouse, J. J., M. H. Whatley, D. L. Coplin, A. Woods, L. Sequeira, and A. Kelman. 1981. Agglutination of Erwinia stewartii strains with a corn agglutinin: correlation with extracellular polysaccharide production and pathogenicity. Appl. Environ. Microbiol. 42:344-350.[Abstract/Free Full Text]
3 - Braun, E. J. 1982. Ultrastructural investigation of resistant and susceptible maize inbreds infected with Erwinia stewartii. Phytopathology 72:159-166.
4 - Clark, J. D., and O. Maaloe. 1967. DNA replication and the cell cycle in Escherichia coli. J. Mol. Biol. 23:99-112.[CrossRef]
5 - Coplin, D. L., and D. Cook. 1990. Molecular genetics of extracellular polysaccharide biosynthesis in vascular phytopathogenic bacteria. Mol. Plant-Microbe Interact. 3:271-279.[Medline]
6 - Danese, P. N., L. A. Pratt, and R. Kolter. 2000. Exopolysaccharide production is required for development of Escherichia coli K-12 biofilm architecture. J. Bacteriol. 182:3593-3596.[Abstract/Free Full Text]
7 - Denny, T. P. 1995. Involvement of bacterial polysaccharides in plant pathogenesis. Annu. Rev. Phytopathol. 33:173-197.
8 - Dolph, P. J., D. R. Majerczak, and D. L. Coplin. 1988. Characterization of a gene cluster for exopolysaccharide biosynthesis and virulence in Erwinia stewartii. J. Bacteriol. 170:865-871.[Abstract/Free Full Text]
9 - Dow, J. M., L. Crossman, K. Findlay, Y. Q. He, J. X. Feng, and J. L. Tang. 2003. Biofilm dispersal in Xanthomonas campestris is controlled by cell-cell signaling and is required for full virulence in plants. Proc. Natl. Acad. Sci. USA 100:10995-11000.[Abstract/Free Full Text]
10 - Elasri, M., S. Delorme, P. Lemanceau, G. Stewart, B. Laue, E. Glickmann, P. M. Oger, and Y. Dessaux. 2001. Acyl-homoserine lactone production is more common among plant-associated Pseudomonas spp. than among soilborne Pseudomonas spp. Appl. Environ. Microbiol. 67:1198-1209.[Abstract/Free Full Text]
11 - Fuqua, C., and E. P. Greenberg. 2002. Listening in on bacteria: acyl-homoserine lactone signalling. Nat. Rev. Mol. Cell Biol. 3:685-695.[CrossRef][Medline]
12 - Fuqua, C., M. R. Parsek, and E. P. Greenberg. 2001. Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu. Rev. Genet. 35:439-468.[CrossRef][Medline]
13 - Goryachev, A. B., D. J. Toh, and T. Lee. 2006. Systems analysis of a quorum sensing network: design constraints imposed by the functional requirements, network topology and kinetic constants. BioSystems 83:178-187.[Medline]
14 - Goryachev, A. B., D. J. Toh, K. B. Wee, T. Lee, H. B. Zhang, and L. H. Zhang. 2005. Transition to quorum sensing in an Agrobacterium population: a stochastic model. PLoS Comput. Biol. 1:e37.[Medline]
15 - Huang, Y.-H., L. Ferrieres, and D. J. Clarke. 2006. The role of the Rcs phosphorelay in Enterobacteriaceae. Res. Microbiol. 157:206-212.[Medline]
16 - Leigh, J. A., and D. L. Coplin. 1992. Exopolysaccharides in plant-bacterial interactions. Annu. Rev. Microbiol. 46:307-346.[CrossRef][Medline]
17 - Majdalani, N., and S. Gottesman. 2005. The Rcs phosphorelay: a complex signal transduction system. Annu. Rev. Microbiol. 59:379-405.[CrossRef][Medline]
18 - Minogue, T. D., A. L. Carlier, M. D. Koutsoudis, and S. B. von Bodman. 2005. The cell density-dependent expression of stewartan exopolysaccharide in Pantoea stewartii ssp. stewartii is a function of EsaR-mediated repression of the rcsA gene. Mol. Microbiol. 56:189-203.[CrossRef][Medline]
19 - Minogue, T. D., M. Wehland-von Trebra, F. Bernhard, and S. B. von Bodman. 2002. The autoregulatory role of EsaR, a quorum-sensing regulator in Pantoea stewartii ssp. stewartii: evidence for a repressor function. Mol. Microbiol. 44:1625-1635.[CrossRef][Medline]
20 - Prigent-Combaret, C., G. Prensier, T. T. Le Thi, O. Vidal, P. Lejeune, and C. Dorel. 2000. Developmental pathway for biofilm formation in curli-producing Escherichia coli strains: role of flagella, curli and colanic acid. Environ. Microbiol. 2:450-464.[CrossRef][Medline]
21 - Qin, Y., Z. Q. Luo, A. J. Smyth, P. Gao, S. Beck von Bodman, and S. K. Farrand. 2000. Quorum-sensing signal binding results in dimerization of TraR and its release from membranes into the cytoplasm. EMBO J. 19:5212-5221.[CrossRef][Medline]
22 - Quiniones, B., G. Dulla, and S. E. Lindow. 2005. Quorum sensing regulates exopolysaccharide production, motility, and virulence in Pseudomonas syringae. Mol. Plant-Microbe Interact. 18:682-693.[Medline]
23 - Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology 1:37-45.
24 - Torres-Cabassa, A., S. Gottesman, R. D. Frederick, P. J. Dolph, and D. L. Coplin. 1987. Control of extracellular polysaccharide synthesis in Erwinia stewartii and Escherichia coli K-12: a common regulatory function. J. Bacteriol. 169:4525-4531.[Abstract/Free Full Text]
25 - Valdivia, R. H., and S. Falkow. 1996. Bacterial genetics by flow cytometry: rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence induction. Mol. Microbiol. 22:367-378.[CrossRef][Medline]
26 - von Bodman, S. B., W. D. Bauer, and D. L. Coplin. 2003. Quorum sensing in plant-pathogenic bacteria. Annu. Rev. Phytopathol. 41:455-482.[CrossRef][Medline]
27 - von Bodman, S. B., and S. K. Farrand. 1995. Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N-acylhomoserine lactone autoinducer. J. Bacteriol. 177:5000-5008.[Abstract/Free Full Text]
28 - von Bodman, S. B., D. R. Majerczak, and D. L. Coplin. 1998. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc. Natl. Acad. Sci. USA 95:7687-7692.[Abstract/Free Full Text]
29 - Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu. Rev. Cell Dev. Biol. 21:319-346.[CrossRef][Medline]
30 - Watson, W. T., T. D. Minogue, D. L. Val, S. B. von Bodman, and M. E. A. Churchill. 2002. Structural basis and specificity of acyl-homoserine lactone signal production in bacterial quorum sensing. Mol. Cell 9:685-694.[CrossRef][Medline]
31 - Wehland, M., and F. Bernhard. 2000. The RcsAB box. Characterization of a new operator essential for the regulation of exopolysaccharide biosynthesis in enteric bacteria. J. Biol. Chem. 275:7013-7020.[Abstract/Free Full Text]
32 - Whitfield, C., and I. S. Roberts. 1999. Structure, assembly and regulation of expression of capsules in Escherichia coli. Mol. Microbiol. 31:1307-1319.[CrossRef][Medline]
Journal of Bacteriology, June 2006, p. 4581-4584, Vol. 188, No. 12
0021-9193/06/$08.00+0 doi:10.1128/JB.00211-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
von Bodman, S. B., Willey, J. M., Diggle, S. P.
(2008). Cell-Cell Communication in Bacteria: United We Stand. J. Bacteriol.
190: 4377-4391
[Full Text]