Previous Article | Next Article ![]()
Journal of Bacteriology, August 2006, p. 5704-5711, Vol. 188, No. 16
0021-9193/06/$08.00+0 doi:10.1128/JB.00564-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Howard Hughes Medical Institute, 136 Harrison Avenue, Boston, Massachusetts 02111
Received 20 April 2006/ Accepted 7 June 2006
|
|
|---|
integrase, did not require IHF. Therefore, the defect in SXT transmission in the V. cholerae IHF mutant is probably not related to IHF's ability to promote DNA recombination. The V. cholerae IHF mutant was also highly impaired as a donor of RP4, a broad-host-range conjugative plasmid. Thus, the V. cholerae IHF mutant appears to have a general defect in conjugation. Escherichia coli IHF mutants were not impaired as donors or recipients of SXT or RP4, indicating that IHF is a V. cholerae-specific conjugation factor. |
|
|---|
100-kb SXT genome contains sequences encoding the element's conjugal transfer and chromosome integration machineries, genes that confer resistance to multiple antibiotics, as well as many genes of unknown function (5). Recently, it has become clear that SXT is part of a family of highly related ICEs that all have very similar integration and conjugation genes but differ in the genes that are not important for their transmissibility, such as antibiotic resistance genes (6).
SXT integrates in a site-specific fashion in the chromosomal gene prfC, which encodes a translation regulation protein, peptide chain release factor 3 (RF3). SXT integration disrupts the 5' end of prfC but provides a novel promoter and 5' coding sequence to enable production of a functional RF3 (19). SXT is excised from the chromosome to form a circular but nonreplicative extrachromosomal intermediate that is thought to be the substrate for conjugative transfer. The mechanism of SXT integration into and excision from the chromosome appears to be similar to that of the lambdoid phages (7, 19). SXT integration and excision require an SXT-encoded tyrosine recombinase, Int, which is related to the
family of recombinases. Excision also requires the SXT-encoded recombination directionality factor, Xis. Although the SXT Xis is unrelated to the
Xis, it appears to inhibit integration and promote excision as does
Xis (7).
In the laboratory, SXT is transmissible by conjugation to a variety of gram-negative bacteria. The SXT conjugal transfer genes are distantly related to those found in the F plasmid (5), and thus it is likely that the basic mechanisms underlying transmission of these two elements are similar. Studies of F plasmid transmission have led to several key insights into the mechanism of conjugative DNA transfer (reviewed in reference 23). Conjugation requires cell-to-cell contact initially made by pili, which are cell-surface appendages encoded by the conjugative plasmid. Through a poorly understood process, these contacts become stabilized and a mating pair is formed that is hypothesized to contain a pore or channel for DNA transfer between the two partnering cells. Following mating pair formation, one strand of the F plasmid is cleaved and single-stranded F plasmid DNA is transported to the recipient cell. The second strand of DNA is then synthesized in both the donor and recipient cells, resulting in stable maintenance of the plasmid in each cell.
Although transmissible elements such as phage
and the F plasmid encode many of the factors necessary for their own maintenance and dissemination, they also depend upon host-encoded proteins for regulation of some of their key functions. Some of these host proteins are referred to as "nucleoid" proteins, a group of abundant DNA binding proteins that modulate the structure of the chromosome (21). These proteins also serve as both positive and negative regulators of transcription, replication, and recombination (24). Two of these nucleoid proteins, the integration host factor (IHF) and the factor for inversion stimulation (Fis), influence both F plasmid and
phage biology (reviewed in references 13 and 14). IHF is a heterodimeric protein whose subunits are encoded by the himA and himD genes, while Fis is a homodimeric protein encoded by the fis gene. IHF helps regulate expression of F conjugation genes and stimulates the TraI-mediated cleavage of its origin of transfer (oriT) (15, 28). Additionally, IHF is required for both integration and excision of
, and the Fis protein stimulates
excision (3, 25, 26, 30).
Little is known about the role of host-encoded proteins in the biology of ICEs. Here we explored the role of IHF and Fis in SXT transmission. We found that a V. cholerae IHF mutant had a markedly reduced capacity to donate SXT, even though SXT integration and excision were not influenced by the lack of IHF. Unexpectedly, this effect was host specific; Escherichia coli IHF mutants were fully competent for SXT transfer. The V. cholerae IHF mutant appears to have a generalized defect in conjugative transfer, as transfer of RP4, an unrelated conjugative element, was also reduced in V. cholerae
himA.
|
|
|---|
,
-diaminopimelic acid (DAP), 0.2% glucose, or 0.02% arabinose. |
View this table: [in a new window] |
TABLE 1. E. coli and V. cholerae strains and plasmids used in this study
|
himA) contains an internal, in-frame deletion of 222 bp from positions 39 to 260 with respect to the start of the himA coding region. SM465 (N16961
fis) contains an internal deletion of 207 bp from positions 44 to 250 with respect to the start of the fis coding region. Deletions in the himA and fis loci of N16961 were created by allele exchange using derivatives of the counterselectable, pir-dependent vector pCVD442 (12). We performed splicing overlap-extension (SOE) PCR, as previously described (20), to create allele exchange vectors pSM419 and pSM420 for the fis and himA loci, respectively. N16961 chromosomal DNA was used as a template for the SOE PCR. These SOE PCR products contained approximately 500 bp of DNA upstream and downstream of the region on the chromosome to be deleted. The PCR products were first cloned into pCRII-TOPO (Invitrogen) and then subcloned into the XbaI and SacI restriction sites of pCVD442. The E. coli strain SM10
pir was used to mobilize pSM419 and pSM420 into N16961. The
fis and
himA N16961 strains were isolated as described previously (10). In both cases, the deletions were verified by PCR with primers flanking the deleted regions. Expression plasmids pSM660 and pSM774 contain the V. cholerae himA in pBAD18-Kn and pBAD18-Cm, respectively (16). These plasmids were constructed by first using PCR to amplify from N16961 chromosomal DNA a fragment extending from 39 bp upstream of the start of himA translation to 14 bp downstream of the himA stop codon. The upstream primer contained a SacI restriction site, and the downstream primer contained an XbaI site. This PCR product was cloned into pCRII-TOPO and then subcloned into the SacI and XbaI sites of either pBAD18-Kn or pBAD18-Cm. The expression plasmid pSM793 contains E. coli himA and himD in pBAD18-Kn. To construct this plasmid, PCR was used to amplify DNA fragments containing himA and himD from MG1655. The E. coli himA fragment contained sequences extending from 26 bp upstream of the start of the coding region to 28 bp beyond the stop codon, while the E. coli himD fragment contained sequences extending from 101 bp upstream of the start of himD translation to 17 bp downstream of the himD stop codon. Each PCR product was cloned into pCRII-TOPO. The himA fragment was subcloned into the SacI and XbaI sites of pBAD18-Kn. The himD fragment was subsequently cloned into this resulting vector in the XbaI and PstI sites.
Bacterial conjugation. Conjugation assays were performed by mixing equal volumes of overnight cultures of donor and recipient strains. In conjugation assays with strains containing the pSM660, pSM774, or pSM793 expression plasmids, overnight cultures were grown with 0.02% arabinose. Cell mixtures were concentrated by centrifugation and then resuspended in a 0.1 volume of LB broth. This cell suspension was applied to a membrane filter on an LB plate supplemented with DAP or glucose, if necessary. All conjugation assays were performed at 37°C. Matings with SXT were carried out for 6 h; matings with RP4 into or from V. cholerae were conducted for 3 h and for 15 min with E. coli mating pairs. Cells were collected in 2 ml of LB, and serial dilutions were plated on the appropriate selective media to determine the numbers of donors, recipients, and exconjugants.
SM10
pir was used to mobilize pVI64A to N16961 and SM463 (N16961
himA). These matings were performed in the presence of glucose to prevent integration of the plasmid into the donor strain. Prior to selecting for exconjugants, the cells were exposed to 0.2% arabinose for one hour to induce expression of the SXT Int. To measure excision of pVI64A from N16961 and SM463 (N16961
himA), pXis was transformed into the V. cholerae pVI64A exconjugants in the presence of glucose to repress xis expression. These transformants were then grown to an optical density at 600 nm of
0.6, induced for expression of Int and Xis with arabinose for one hour, and scored for loss of the plasmid antibiotic resistance markers.
Real-time quantitative PCR assays for relative quantification of attB. Real-time quantitative PCR assays were performed to measure the percentage of cells in a culture that contained unoccupied SXT attB sites. In each case, the amount of attB was normalized to the amount of chromosomal DNA in each sample by amplifying the recA locus by real-time quantitative PCR. Primer design, reactions, and analysis were performed as previously described (7). Primers to amplify the attB region of V. cholerae are VattBF (5' CGAAGTATCAAAGCGCCGTAC 3') and VattBR (5' ATCGTGGTTTTACCCGCG 3'), and primers to amplify the recA locus of V. cholerae are VrecAF (5' AAAGGCTCCATCATGCGC 3') and VrecAR (5' CCGGTCGAAATGGTTTCTACA 3').
|
|
|---|
subunit of IHF) and fis in V. cholerae strain N16961, which is a sequenced El Tor biotype clinical isolate. Strain SM463 (referred to as V. cholerae
himA) contains a deletion of himA and strain SM465 (referred to as V. cholerae
fis) contains a deletion of fis (Table 1). We tested growth of V. cholerae
himA and V. cholerae
fis in rich media. V. cholerae
fis grew nearly identically to wild-type N16961 but had a slightly longer initial lag phase. V. cholerae
himA also had a longer lag phase and did not reach as high a saturation density as the wild-type strain (Fig. 1). Thus, the himA mutation appears to have a modest effect on V. cholerae growth. These results are similar to what has been reported for fis and himA in E. coli (8, 14, 22).
![]() View larger version (20K): [in a new window] |
FIG. 1. Growth of V. cholerae himA and fis mutants. Growth of V. cholerae strains N16961 (wild type [wt]), SM463 (N16961 himA), and SM465 (N16961 fis) were measured in LB broth at 37°C. Growth of each strain was assayed in triplicate, and the average absorbances and standard deviations of each time point are presented.
|
himA and V. cholerae
fis could serve as SXT recipients. Due to the low transfer frequency of SXT from V. cholerae to V. cholerae, an SXT-bearing E. coli strain was used as the SXT donor in these experiments. The frequency of SXT transfer to V. cholerae
himA was
20-fold reduced compared to a wild-type N16961 recipient (Fig. 2). Furthermore, the reduction in the recipient capacity of the himA mutant could be complemented by expressing himA from a plasmid (pSM660), indicating that this defect is due to a lack of himA. The conjugation defect of the V. cholerae himA mutant could also be complemented by expressing the E. coli IHF genes (himA and himD) from a plasmid (pSM793). In contrast to IHF, Fis does not appear to influence N16961 acquisition of SXT; V. cholerae
fis and N16961 were equally capable as SXT recipients (Fig. 2).
![]() View larger version (23K): [in a new window] |
FIG. 2. Transfer of SXT into and from himA and fis V. cholerae mutants. SXT transfer frequency is expressed as the number of exconjugants per the number of recipient cells when SXT is donated from E. coli to V. cholerae; when SXT is donated from V. cholerae to E. coli, SXT transfer frequency is expressed as the number of exconjugants per the number of donor cells. The E. coli SXT donor was the dapA strain JO641. The V. cholerae recipient strains were: N16961 (Vc wt), N16961 himA (Vc himA), and N16961 fis (Vc fis). The plasmids were all derivatives of pBAD18-Kn with either no insert, the V. cholerae himA (pSM660), or the E. coli himA and himD (pSM793). The V. cholerae SXT donor strains were the same as the V. cholerae recipient strains except that they contained SXT. The E. coli recipient was strain CAG18439. The averages and standard deviations of at least three independent assays are shown. The asterisk indicates that the frequency of exconjugant formation was below the limit of detection ( 7 x 109).
|
himA was undetectable (Fig. 2). The limit of detection in this assay is approximately 7 x 109; therefore, SXT transfer from V. cholerae
himA is reduced at least 250-fold compared to wild-type V. cholerae. SXT transfer from V. cholerae
himA was restored to wild-type levels when himA was supplied in trans from an expression vector, indicating that the observed defect in SXT transfer is due to the mutation in the himA locus. The transfer defect of the V. cholerae himA mutant could also be partially complemented by expressing the E. coli IHF genes from a plasmid, strongly suggesting that the V. cholerae and E. coli IHF proteins can function in a similar fashion to enable SXT transfer from N16961. Transfer of R391 (an SXT-related ICE) from the himA mutant was also undetectable (data not shown). Thus, the requirement for IHF for ICE transmission from V. cholerae is not limited to SXT; this result is not surprising because R391 and SXT share 95% identity over the genes that mediate integration, excision, regulation, and conjugative transfer of these elements (4). In contrast to IHF, Fis is not required for SXT transfer from N16961; V. cholerae
fis donated SXT at frequencies similar to that of wild-type V. cholerae (Fig. 2). Thus, Fis does not appear to influence SXT transmission to or from V. cholerae.
IHF is not required for integration or excision of SXT.
Given the similarity between the
and SXT integrases and the requirement for IHF in integration and excision of
DNA from the E. coli chromosome, we initially suspected that the diminished capacity of the V. cholerae himA mutant to transfer or receive SXT reflected a role for IHF in SXT excision and integration. To determine whether the observed defect in the capacity of the V. cholerae IHF mutant to act as an SXT recipient was due to a decreased frequency in SXT integration into the chromosome, we utilized pVI64A, a plasmid containing the minimal SXT DNA elements required for integration into the chromosome (V. Burrus, unpublished). The pVI64A plasmid is based on the pir-dependent vector pSW23T (11) and carries both the SXT attP region and the SXT int under control of an inducible promoter. After conjugative transfer from a pir+ host to a pir host, Kanr exconjugants can only be isolated if pVI64A integrates into the chromosome; in nearly all cases, integration occurs via recombination between the chromosomal attachment site (attB) and a homologous sequence on the plasmid (attP) and is catalyzed by the SXT integrase (reference 7 and V. Burrus, unpublished data). By utilizing this minimal SXT integration system, we are bypassing any effects IHF may have on the expression of SXT-encoded genes. Following mobilization of pVI64A from the pir+ mob RP4+ host SM10
pir, the frequencies of formation of N16961 (pVI64A) and V. cholerae
himA (pVI64A) exconjugants were nearly identical (Fig. 3). In addition, PCR assays for the SXT integration junction (attL and attR) sequences in wild-type and V. cholerae
himA pVI64A exconjugants (four each) revealed that pVI64A was integrated into the SXT attB site, the 5' end of prfC. Together these findings indicate that IHF is not required for SXT integration. These data also suggest that the IHF mutant recipient is fully competent to receive and process DNA transferred by the RP4 conjugation system present in the donor cells in this assay.
![]() View larger version (8K): [in a new window] |
FIG. 3. IHF is not required for integration of pVI64A. Integration of pVI64A, a mobilizable replication-deficient plasmid containing the SXT attP site and the SXT int under the control of an inducible promoter, was tested in a conjugation assay. The frequency of exconjugant formation was calculated by dividing the number of exconjugants by the number of recipients. SM463 is the N16961 himA strain. The averages and standard deviations of three independent conjugation assays are shown.
|
himA background, pXis (7), a plasmid containing the SXT xis under the control of an inducible promoter, was introduced into a wild-type and a V. cholerae
himA pVI64A exconjugant. Because pVI64A cannot replicate in V. cholerae, its excision from the chromosome ultimately results in plasmid (Kanr) loss. Following expression of Xis, 97% ± 2% of the wild-type cells lost pVI64A, whereas 75% ± 16% of the
himA cells lost the plasmid. Thus, IHF is not required for pVI64A excision from the chromosome. The slightly lower excision frequency observed in the V. cholerae
himA strain may be attributable to differences in the levels of Xis between the wild-type and
himA backgrounds, as the pXis plasmid appeared to be less stable in the
himA background.
To confirm that SXT excision from the chromosome occurs in the absence of IHF, we used real-time quantitative PCR to measure SXT excision in wild-type and V. cholerae
himA strains. The amount of attB relative to a single-copy chromosomal locus (recA) was quantified in chromosomal DNA preparations of wild-type N16961 SXT+ and V. cholerae
himA SXT+. In this assay, attB is only detected if SXT has excised from the chromosome (7). The amount of unoccupied attB was 0.47% ± 0.21% in the wild type and 0.31% ± 0.15% in V. cholerae
himA. This small reduction in the percent attB in the himA strain versus the wild type is not statistically significant (P = 0.1889, Student t test). These results indicate that IHF is not required for SXT excision. Furthermore, because excision relies on both the SXT-encoded Int and Xis proteins, these results suggest that the levels of Int and Xis are not dramatically affected in the IHF mutant. If this is the case, the reduced frequency of SXT exconjugants when V. cholerae
himA was the recipient is not likely attributable to reduced levels of Int, which is required for SXT integration.
IHF influences RP4 transfer to and from V. cholerae.
Since the deficiency in SXT transfer from V. cholerae
himA does not appear to be attributable to a critical role for IHF in SXT recombination with the chromosome, we explored if the himA deletion caused a generalized conjugation defect in N16961. To test this possibility, we measured transmission of the broad-host-range conjugative plasmid RP4 into and from V. cholerae
himA. Unlike SXT, RP4 does not integrate into the chromosome; however, RP4 transfers through a process that is presumed to be mechanistically similar to that of SXT. RP4 transfer from an E. coli donor to V. cholerae
himA was over 30-fold lower than that for wild-type N16961 (Fig. 4). Furthermore, transfer of RP4 from V. cholerae
himA was reduced over 200-fold compared to the wild type. The frequency of RP4 transfer from V. cholerae
himA was restored to wild-type levels when himA was supplied in trans from an expression plasmid. These results are similar to those found with transfer of SXT into and from V. cholerae
himA and suggest that the himA deletion confers a general defect in conjugation to N16961.
![]() View larger version (16K): [in a new window] |
FIG. 4. Transfer of RP4 into and from himA V. cholerae. The frequency of exconjugant formation was calculated by dividing the number of exconjugants by the number of recipients when assaying RP4 transfer into V. cholerae and by dividing the number of exconjugants by the number of donors when measuring RP4 transfer from V. cholerae. The E. coli RP4 donor strain was J63. The V. cholerae recipient strains were N16961 (Vc wt) and N16961 himA (Vc himA). The plasmids were all derivatives of pBAD18-Cm with either no insert or the V. cholerae himA (pSM774). The V. cholerae RP4 donor strains were the same as the V. cholerae recipient strains except that they contained RP4. The E. coli recipient of RP4 was MC1061. The averages and standard deviations of three independent conjugation assays are shown.
|
and IHFß subunits are 86% and 81% identical to the respective E. coli orthologs. To our surprise, no defect in either SXT or RP4 transmission was detected in E. coli strain MG1655 himA del83-Tn10 (Fig. 5). The frequency of RP4 or SXT exconjugant formation was equivalent to that of the wild type when the himA mutant strain was either the recipient or donor of either conjugative element. In the case of E. coli, the IHFß subunit encoded by himD was capable of functioning without the IHF
subunit (himA); an E. coli himA himD double mutant was also assayed as a recipient and donor of SXT. Like the himA single mutant strain, the frequency of exconjugant formation was approximately the same as that of the wild type when this himA himD double mutant was either the recipient or donor of SXT (data not shown). These results are in marked contrast to what we observed in the V. cholerae
himA mutant.
![]() View larger version (17K): [in a new window] |
FIG. 5. Influence of IHF on conjugal transfer of SXT and RP4 into and from the E. coli IHF mutant. The frequency of SXT or RP4 transfer is shown as the number of exconjugants divided by the number of recipients when the mutant was used as the recipient, and the frequency is presented as the number of exconjugants divided by the number of donors when the IHF mutant strain was used as the donor. The SXT donor strain is JO212 and the RP4 donor strain is J63. The recipient strains are as follows: BI533 (MG1655, wild type), SM768 (MG1655 himA), CAG18439 (E. coli Tetr), or MC1061 (E. coli Smr). The averages and standard deviations of three independent conjugation assays are shown.
|
|
|
|---|
himA V. cholerae were similar, it is clear that IHF's role in promoting DNA recombination does not explain our observations. Instead, our findings suggest that IHF facilitates the capacity of V. cholerae to act as a donor and perhaps as a recipient in conjugation.
Deletion of himA from V. cholerae did not appreciably alter the frequency of SXT integration into or excision from the V. cholerae chromosome. In contrast, IHF is required for integration and excision of
and closely related bacteriophages into and from the E. coli chromosome. IHF is thought to perform a primarily architectural role in
recombination, bending the DNA and permitting assembly of recombinogenic complexes (2). SXT and
encode similar tyrosine recombinases that are thought to catalyze recombination between these elements and chromosomal DNA. The similarity of the likely active site of the SXT integrase to the active sites of the
type integrases suggests that the fundamental chemistry of SXT recombination is similar to that described for recombination of
DNA with its chromosomal target. We suspect that differences in the architecture of the nucleoprotein complexes formed during SXT and
recombination explain the different requirements for accessory factors in the integration and excision of these mobile elements. In fact, sequence analysis (based on the E. coli IHF consensus DNA binding site) suggests that there is no IHF binding site in the region of SXT that recombines with the chromosome. It is possible that SXT integration and/or excision require accessory factors other than IHF or Fis. Excision from the E. coli chromosome of the conjugative transposon Tn916, which also encodes a tyrosine recombinase, has been shown to be stimulated by HU (8), a nucleoid protein that shares structural homology to IHF and some overlapping functions (27).
The himA deletion had a more potent effect on the capacity of V. cholerae to donate SXT or RP4 than to acquire these conjugative elements. Transfer of SXT or RP4 from the IHF mutant was reduced at least several hundred-fold compared to wild-type V. cholerae. In contrast, the capacity of the IHF mutant to serve as a recipient of these elements was only reduced 20- to 30-fold compared to the wild type. In the conjugation assays performed here, there is probably sufficient time for newly formed exconjugants to serve as donors of SXT or RP4. Thus, it is possible that the comparatively small reduction in the frequency of V. cholerae
himA to acquire SXT or RP4 may at least in part reflect this mutant's inability to donate newly acquired elements. This idea is supported by our experiments using pVI64A shown in Fig. 3. In this assay, transfer of pVI64A depends on the RP4 conjugation system expressed from the chromosome of the donor cell (and not from the mobile element). Therefore, newly formed exconjugants are unable to serve as donors. The frequencies of pVI64A exconjugants were approximately equal using either wild-type or
himA V. cholerae as recipients, suggesting that the V. cholerae IHF mutant may not be impaired in its capacity to serve as a recipient of conjugative elements.
We believe it is unlikely that IHF plays a direct role in transfer of SXT and RP4 from V. cholerae. One reason we suspect IHF does not directly affect SXT or RP4 transfer is that E. coli IHF mutants were not defective in acquisition or transfer of these elements. The V. cholerae-specific requirement for IHF for transmission of SXT and RP4 was unexpected, as the E. coli and V. cholerae IHF proteins appear to be highly similar. In fact, the E. coli IHF protein can complement the V. cholerae IHF mutant for transfer of SXT. Thus, it seems unlikely that the E. coli and V. cholerae IHF proteins could interact with these mobile element in different ways in their respective hosts.
The V. cholerae-specific requirement for IHF in the transfer of SXT and RP4 is difficult to explain. It is possible that E. coli codes for an additional factor (not present in V. cholerae) that can substitute for IHF in its absence. Another possible explanation is that the IHF regulon differs between E. coli and V. cholerae and that an important regulator of conjugation is IHF dependent only in V. cholerae. In E. coli, IHF is a global regulator of transcription; microarray analyses revealed that E. coli IHF directly or indirectly affects the transcription of over 100 genes of diverse functions (1). Microarray analyses suggest that this appears to be the case in V. cholerae as well (S. M. McLeod and M. K. Waldor, unpublished data). In V. cholerae, IHF may regulate a host factor that is required for transmission of both SXT and RP4. The identity of this factor awaits future investigation. Overall, there appears to be differences in the conjugation capacities of V. cholerae and E. coli. The transfer frequencies of both RP4 and SXT are significantly higher between E. coli cells than between V. cholerae cells or between V. cholerae and E. coli. Perhaps E. coli has both IHF-independent as well as IHF-dependent conjugation pathways, whereas V. cholerae has only IHF-dependent pathways.
Although self-transmissible mobile genetic elements contain genes that encode machinery necessary for their maintenance and transmission, it is evident that these elements also depend on host-encoded functions. Given the complex biology of conjugation and the degree of interaction that must occur between element- and host-encoded factors, it is amazing that many mobile genetic elements have a broad host range. The data presented here suggest that relatively subtle changes in host cell physiology can significantly impact the host range of SXT and RP4.
S.M.M. is supported by NIH F32AI056692. M.K.W. is supported by NIH grant AI-42347 and HHMI.
|
|
|---|
integrase and the
Int family. In N. L. Craig (ed.), Mobile DNA II. ASM Press, Washington, D.C.
contains a hybrid genome derived from tandemly integrated elements. Proc. Natl. Acad. Sci. USA 97:8572-8577.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»