Previous Article | Next Article ![]()
Journal of Bacteriology, January 2006, p. 499-506, Vol. 188, No. 2
0021-9193/06/$08.00+0 doi:10.1128/JB.188.2.499-506.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Section of Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, One University Station A5000, Austin, Texas 78712
Received 23 August 2005/ Accepted 19 October 2005
|
|
|---|
|
|
|---|
![]() View larger version (19K): [in a new window] |
FIG. 1. (A) Minimal oriTs of R1162 and pSC101. The inverted repeats in each case are indicated by the horizontal arrows, and the single base difference in the core is underlined. The base pairs making up the inner arms of the R1162 and pSC101 inverted repeats and mutated in this study are numbered for identification. Below is the Erwinia carotovora chromosomal DNA cloned to test for initiation of transfer. Inverted triangles indicate the cleavage site for the plasmid relaxase. (B) General structure of plasmids used to determine the efficiency of initiation of transfer at a mutated oriT. oriT(1) contains the mutations; the direction of transfer (16) from each oriT is indicated by the arrowheads. Restriction sites are BamHI (B), ClaI (C), HindIII (H), MfeI (M), and EcoRI (R). Amp, gene encoding ampicillin resistance.
|
|
|
|---|
, and TOP10 (Invitrogen). Conjugative mating with E. coli donors and recipients was done on semisolid agar medium as described previously (9). The donor was MV10, containing the mobilizing plasmid R751 (26) and a second plasmid acting as a source of either the R1162 or the pSC101 Mob proteins. The recipient was C600 NalR. Transconjugants were selected on medium containing Turboamp (100 µg/ml; Stratagene), 25 µg/ml nalidixic acid, and 0.8% X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside). Donors were enumerated on medium containing ampicillin (100 µg/ml). For matings with donor strains containing pUT1883 or pUT1884, the procedure was scaled up: 0.1 to 1.0 ml of a mid-log-phase culture of donor cells and 1.0 ml recipient cells were drawn onto a 0.22-µm filter by gentle vacuum and deposited cell-side up on a broth plate. After incubation for about 2 h, the cells were resuspended by vortexing and plated for donors and transconjugants.
Plasmids. (i) Plasmids used for the oriT libraries.
The plasmid pUT1616 is a pBR322 derivative containing lacO (see Fig. 4 in reference 2). The R1162 Mob proteins were provided by pUT1309, which is R1162
oriT (20), or pUT1841, which consists of the R1162 Mob genes cloned into the vector pACYC184 (10) between the HindIII and BamHI sites. The R1162 DNA in the plasmid consists of a ScaI-EcoRV fragment containing the oriT deletion from pUT1309. The plasmid pUT1705 was used as a source of the pSC101 Mob proteins. This plasmid consists of a pSC101 DNA fragment (bp 2269 to 4069 [6]) that includes the mob genes but lacks oriT. The fragment was cloned between the EcoRV and BamHI sites of pACYC184.
![]() View larger version (66K): [in a new window] |
FIG. 4. (A) Nicking at R1162 oriTs (core plus inner arm) mutated within the conserved sequence AAA in the inner arm. The nick is shown by the arrowhead. Nicking was assayed by primer extension. The unmutated, conserved DNA is lane AAA, adjacent to the sequencing ladder. The other lanes contain conserved DNA with the sequence shown at the top of the figure. (B) Sensitivity of mutated oriT DNA to oxidation by permanganate. DNA was assayed by primer extension as in panel A, except that the complement to the nicked strand was used as the template. Plasmid DNAs were extracted from cleared lysates treated (+) or untreated () with permanganate.
|
(iii) Plasmids containing mutations in AAA within the inner arm of the R1162 oriT. A set of R1162 derivatives containing mutations at positions 4, 5, and 6 in the inner arm were constructed using complementary oligonucleotides degenerate in sequence at these positions. Mutations were introduced into R1162 by the PCR method of Horton et al. (14), and the base changes for each recombinant plasmid were determined by sequencing. DNA containing the oriT inner arm and core was then cloned to test for initiation of transfer. The oriT DNA was amplified by PCR with the primers CGTTAGGCCAGTTCTTCGAAG and CCGAATTCAGGGCGCATTTACCG. The product was digested with BstBI and EcoRI and cloned between the ClaI and MfeI sites at position 1 of the test plasmid (Fig. 1B).
(iv) Plasmids containing mutations in the inner arm of the pSC101 oriT. We used a plasmid similar to pUT1705 but containing an intact oriT. Mutations in the specificity region (CGTC) in the inner arm were introduced by two-step PCR (14). We also constructed hybrid oriTs, consisting of inner arm and core with elements from both R1162 and pSC101, and tested these for initiation of transfer by using plasmids with the structure shown in Fig. 1B. In these plasmids, position 2 contained pSC101 oriT DNA (bp 4070 to 4129 [6]). The oligonucleotide GCCCCAAGCTTATGGATCCGAAGAGAAACGTCTAAGTGCGCCCTCCCTTTTGGCAATTGGGCCC and the same oligonucleotide except with a T at position 27 were amplified with the primers GCCCAAGCTTATGGATC and GGGCCCAATTGGGCCC, and the product was cloned between the BamHI and MfeI sites at position 1, as shown in Fig. 1B. A plasmid essentially similar but containing the normal inner arm plus core of pSC101 at position 1 was also constructed by amplifying the analogous oligonucleotide.
(v) Plasmids containing Erwinia carotovora subsp. atroseptica DNA. The oligonucleotide ATTGCAGAACGTGGCGGGCAATAAGCTTAAGTGCGCCCTAGCCTT, corresponding to Erwinia carotovora subsp. atroseptica chromosomal DNA (bp 1306739 to 1306766 [5]) was amplified and cloned between the BamHI and MfeI sites at position 1 in the test plasmid (Fig. 1B). Position 2 contained either the R1162 or the pSC101 oriT, on the DNA fragments described above.
Construction of oriT libraries. Construction of a plasmid library derived from a cloned, partially degenerate oligonucleotide and enrichment of the nicked oriTs by tailing and PCR were done as outlined in Fig. 2 and as described previously (3). An oligonucleotide degenerate in sequence for the inner arm of the oriT inverted repeat was amplified and cloned by replacement of a HindIII-MfeIlacO fragment in pUT1616 (3). For libraries containing oriTs composed of the pSC101 core and a 10-base degenerate inner arm, the oligonucleotide GCCCAAGCTTATGGATCC(N)10TAAGTGCGCCCTCCCTTTTGGCAA TTGGGCCC was amplified with the primers GGGCCCAATTGCCAAAAG and GCCCAAGCTTATGGATC. The DNA was then used to transform MV10 containing either pUT1309 or pUT1705, which provide the R1162 or pSC101 Mob proteins, respectively. Plasmid DNA was isolated by the cleared-lysate method (15) and tailed at the oriT nick site with terminal transferase as described previously (3). The tailed product was then amplified by PCR, with the primers CCCGAATTCCCCCCCCCCCGCA and GGGAATAAGGGCGACACGGAAATGTTG, and the resulting product was cloned at the HindIII and EcoRI sites of pUC19 (27). As shown in Fig. 2, step 4, the primer hybridizing to the tail was also complementary to the 3' end of cleaved oriT, so that molecules tailed at positions resulting from random cleavage of DNA were not amplified. In addition, although treatment with terminal transferase results in tails of different lengths, the PCR product was uniform in size, determined by the primer. The cloned DNA was then sequenced and further analyzed. As a control experiment, plasmid DNA from the cleared lysate was sequenced directly. There were equal amounts of each base at each position within the degenerate region, confirming that the original degenerate oligonucleotide had been correctly doped (25% each base) and also that the library was large, without overrepresentation of particular sequences.
![]() View larger version (20K): [in a new window] |
FIG. 2. Outline of method used to obtain population of highly mutated, cleaved oriTs. The degenerate inner arm is indicated by the large horizontal arrow.
|
containing either pUT1705 or pUT1841. DH5
was chosen because an EcoK restriction site would be created within oriT for some of the clones, and so a restrictionless recipient was required to avoid skewing the library. Nicked oriTs were then enriched by tailing and PCR amplification, as described before (3). The DNA was cloned into the vector pCRTopo2.1, and the DNA was transformed into E. coli strain TOP10. The vector and strain were purchased from Invitrogen and used according to their instructions. There were between 300 and 2,900 transformants for the four libraries. The plasmid DNA from each was pooled; restriction analysis showed that between 75 and >90% of the plasmid DNA contained the correct insert. We then sequenced the pooled plasmid DNA, with a primer (GCGTATCACGAGGCCCT) complementary to the insert.
![]() View larger version (61K): [in a new window] |
FIG. 5. Dideoxy base sequencing of pooled DNA from plasmid libraries containing the cloned, partially degenerate oligonucleotides, labeled bp(1-7) and bp(8-13) at the top. The patterns of chain termination for the population nicked after propagation in strains containing either the R1162 or the pSC101 Mob proteins are shown in the top panel. At the bottom are the patterns without prior enrichment for nicking.
|
|
|
|---|
We first introduced our collection of plasmids with the mutated oriTs into an E. coli strain encoding the R1162 Mob proteins. The plasmid DNA was then isolated by the cleared-lysate procedure (15), which conserves those molecules cleaved at the nick site. We identified the sequences that allow nicking by first tailing at the nick site with terminal transferase and then amplifying the cleaved and tailed oriT with PCR. The amplified DNA was cloned into pUC19 and used to transform E. coli strain TOP10. We blindly selected 18 colonies and determined the sequence of the oriT DNA in each. All of the oriTs in the collection were highly mutated, and there were 17 different sequences, indicating there was a diverse collection of tailed molecules in the library. The distribution of bases for the 18 individual isolates is shown in Fig. 3. As with the library based on the R1162 oriT (3), the distribution of bases was not random; in particular, there was the strong preference for A at positions 4, 5, and 6, as reported previously. These bases are located 4 bases from the core in both the pSC101 and the R1162 oriTs (Fig. 1A). In addition, G was most commonly present at position 10. The base frequency at each position reflected enrichment of nicked molecules: when plasmid DNAs from the cleared lysates were sequenced directly, there were nearly equal amounts of the four bases at each of the degenerate positions (data not shown).
![]() View larger version (25K): [in a new window] |
FIG. 3. Relative frequency of each base at the 10 positions (numbered according to Fig. 1) making up the inner arm of the inverted repeat in the oriT of R1162. The normal base at each position is indicated by the widest portion of each bar in the graph.
|
The results of testing selected mutated oriTs for initiation of transfer are shown in Table 1. Not all of the mutated oriTs were active, even though they had been derived by enriching for nicked molecules. Possibly the nicking is too low to detect by measuring the frequency of transfer or, alternatively, the relaxosomes are improperly oriented to engage the secretion machinery effectively. It also appears that a G in the 10th position is important for activity when the rest of the inner arm is highly mutated. However, these data show that in many cases transfer can be initiated at nearly the normal rate, even when the inner arm of the inverted repeat contains many mutations.
|
View this table: [in a new window] |
TABLE 1. Effect of multiple mutations in inner arm of R1162 oriT on initiation of transfer
|
Strict requirement for base sequence within the inner arm of the oriT inverted repeat for the pSC101 relaxosome. Since the pSC101 Mob proteins are inactive on the R1162 oriT (19), we asked whether this indicated that these proteins had a stringent requirement for the base sequence of the DNA making up the inner arm of the inverted repeat, in contrast to the relatively relaxed specificity of the R1162 Mob proteins for this region (3). We repeated the tailing procedure to obtain nicked molecules, this time with a strain containing the pSC101 Mob proteins, encoded by the plasmid pUT1705. Despite numerous attempts, either we did not obtain any PCR product or the sequence of the amplified DNA suggested that it was derived from contaminant DNA rather than a cleaved molecule. These failures indicated that the population of cleaved molecules was so small that it was undetectable by the tailing and PCR procedure.
We next reduced the size of the degenerate region to increase the chance of finding mutated oriTs that remained active with the pSC101 Mob proteins. In addition, the inner arm of the pSC101 oriT is longer by 3 bases than that of the R1162 oriT (Fig. 5 top), and this could have affected the results with the first degenerate oligonucleotide. We used two oriT oligonucleotides, having degenerate regions corresponding to bp 1 to 7 [bp(1-7)] or 8 to 13 [bp(8-13)] of the inner arm (Fig. 5, top). In each case, a library of nicked molecules was generated by transforming strains containing either the R1162 or the pSC101 Mob proteins. Rather than examining individual clones of nicked oriTs, we pooled the plasmids from each library of transformants and sequenced the population. As a control, each initial library was also sequenced prior to enrichment for nicking. The results of these procedures are shown in Fig. 5. The autoradiogram at the bottom of the figure shows that the four bases were present in similar amounts at the degenerate positions in each of the libraries. The gel at the top of the figure shows the sequencing results following enrichment of the nicked sequences by tailing and recloning. Base pairs 1 to 7 were significantly degenerate for both the pSC101 and the R1162 libraries, although G and A at positions 6 and 7 are overrepresented in the R1162 library. The conserved A is consistent with the results shown for R1162 in Fig. 3. For the bp(8-13) library, the results for the two plasmids were different. The bases AACCGG, the sequence for the R1162 oriT at these positions, are enriched, but it is clear that other bases are also present in the library. In contrast, the sequence appears much more uniform in the pSC101 bp(8-13) library and corresponds to the normal sequence at these positions for the pSC101 oriT. Moreover, the sequence of bp(1-7) appeared degenerate. This suggested to us that in fact there were no members of the bp(8-13) degenerate library that could be cleaved by the pSC101 proteins and that the tailed and enriched molecules were contaminants from the bp(1-7) library. We attempted enrichment of nicked molecules for the pSC101 Mob proteins four more times, twice from the library initially used and twice with a second, independently derived library of cloned fragments. In the case of the first library, the same, presumably contaminating sequence was obtained both times. With the second library, we did successfully enrich DNA having a single sequence. However, this DNA was not nicked by the pSC101 Mob proteins upon retesting (data not shown).
We conclude that compared to R1162, the pSC101 Mob system has a strict requirement for the base sequence within locations 8 to 13 of the inverted repeat (Fig. 1), next to the core DNA. Since the AAA triplet is present in both oriTs, it is the four base pairs next to the core, CGTC, that are important for recognition of the cognate oriT by the pSC101 Mob proteins.
The high degree of degeneracy for the bp(1-8) libraries, for both the R1162 and the pSC101 Mob systems, suggested that within the inner arm, the six bases (GTGAAG) distal to the core were not required for the specificity of the pSC101 Mob proteins, although they are unique to the pSC101 oriT (Fig. 1A). To test this directly, we constructed a hybrid oriT having the inner arm of R1162 but with the CCGG adjacent to the core replaced by the corresponding CGTC of the pSC101 oriT. Using plasmids of the type shown in Fig. 1B but with a copy of the pSC101 oriT at position 2, we tested the hybrid oriT for initiation of transfer in cells containing the pSC101 Mob proteins. The initiation frequency was 0.84 for the hybrid oriT. An oriT composed of the complete pSC101 inner arm and core showed the same initiation frequency. Thus, the sequence CGTC (plus the core) was sufficient for recognition of oriT and for the full activity of the pSC101 relaxosome at initiation of a round of transfer. The R1162 Mob proteins were active on the hybrid oriT as well (recombination frequency of 0.35). In addition, like the R1162 Mob proteins, the pSC101 Mob proteins were tolerant to an A-to-T base change in the AAA region. When the hybrid oriT had the sequence ATA at this site, the recombination frequency decreased only slightly, to 0.26.
Single mutations in the pSC101 specificity sequence CGTC lowered the transfer frequency and, like the mutations in AAA of the R1162 oriT, prevented strand separation within the core. The transfer frequencies of plasmids with these mutations were 1.5 x 104 (CGTG) and 6.4 x 106 (CCTC), significantly lower than the normal (CGTC) frequency of 0.03. Part of the lower frequency could be due to a defect in termination, since plasmids containing a single copy of the complete oriT were tested. However, both mutations reduced the sensitivity of core DNA to permanganate (Fig. 6), at a level roughly coordinate with their effect on transfer. All plasmids transferred at the normal high frequency when the R1162 Mob proteins were provided in trans.
![]() View larger version (48K): [in a new window] |
FIG. 6. Sensitivity of pSC101 oriTs containing mutations in the specificity region to oxidation by permanganate. Plasmid DNAs were isolated from treated (+) or untreated () cleared lysates. The sequence of the specificity region in each case is shown at the top, with the mutated base underlined.
|
|
View this table: [in a new window] |
TABLE 2. Initiation of transfer from Erwinia carotovora DNA
|
|
|
|---|
Within the AAA region of the inner arm, A-to-T mutations are much better tolerated by the R1162 relaxase than A-to-C mutations. These results are consistent with those of earlier studies involving relaxase-mediated recombination at oriTs cloned in M13 bacteriophage, where single-stranded oriT DNA was shown to be cleaved and rejoined in vivo by the relaxase in the absence of the other proteins of the relaxosome (1, 18). An A-to-T mutation in one arm of the inverted repeat was suppressed by a second, T-to-A mutation in the other arm that restored base-pairing within the hairpin loop (1). Thus, it is almost certainly the relaxase itself which is binding to the AAA region. The relative tolerance to TA transversions (Fig. 2 and Table 2) is consistent with binding of the relaxase to the minor groove, where the positions of the major potential contacts for the protein are not greatly altered by an AT-to-TA change (25). An AAA-to-ATA change is also tolerated by the pSC101 relaxosome, so the R1162 and pSC101 relaxases probably interact similarly with the DNA at this AT "waist."
The relaxases of the plasmids R1162 and pSC101 are closely related. For the N-terminal 198 amino acids making up the minimal region required for recognition and processing at oriT by the R1162 relaxase (4), the two proteins contain amino acids that are approximately 45% identical and 16% closely similar. Nevertheless, the R1162 relaxosome shows significantly lower specificity for its substrate than the pSC101 Mob proteins. For the pSC101 relaxase, the identity of each of the four bases (CGTC) adjacent to the core is important for transfer and strand separation in the core, with base changes causing a loss of activity. Replacing the corresponding four bases (CCGG) in the R1162 oriT with CGTC makes this oriT fully active for initiation by the pSC101 Mob proteins. Since the first base is the same in both cases, it is the three base pairs adjacent to the core which are used by the pSC101 Mob proteins to distinguish the pSC101 oriT from a related oriT. The R1162 relaxosome is not completely indifferent to the sequence at these positions: for example, G at the position adjacent to the core appeared important for activity when the inner arm was heavily mutated (Fig. 2 and Table 1). However, the R1162 proteins are able to initiate transfer efficiently on both the pSC101 oriT (3) and, at lower frequency, Erwinia DNA (C and T at this position, respectively). The overall acceptability of the four bases adjacent to the core probably depends on the identity of each, with no base change by itself having a large effect.
We have suggested earlier that MobC, which assists in strand separation at oriT (28) and is required by the R1162 relaxase for optimal activity on both the pSC101 and the R1162 oriTs (19), might permit a looser fit between relaxase and DNA and thus account for the lower specificity of the R1162 protein (3). The pSC101 Mob system does not encode a homolog to MobC, and the relaxase might need a firmer grip on the DNA in order to separate the DNA strands within oriT. However, we have not ruled out the possibility that the pSC101 relaxase uses a host-encoded protein such as HU to facilitate localized melting of the oriT DNA. As described above, the importance of these bases might lie in providing the protein with additional contacts on the DNA, thus strengthening binding by the relaxase and minimizing the need for an accessory protein to help in strand separation. However, during our screens for nicked molecules (Fig. 2 and 4), we were unable to identify any oriTs nicked by the pSC101 relaxase and containing mutations in the specificity sequence CGTC, even when MobC was provided in the cell (data not shown). One possibility is that CGTC is important for orienting the relaxase, so that it is active on core DNA and so that other combinations of bases are sterically not allowable, even in the presence of MobC. It is also possible that the R1162 relaxase and MobC interact specifically with each other. It will be interesting to see how the R1162 relaxase is oriented properly for activity, sometimes at nearly normal levels (Table 1), without using its own specificity sequence as a guide. Perhaps the R1162 relaxase is oriented by MobC for proper strand separation through a specific protein-protein interaction.
The R1162 Mob proteins can initiate transfer from DNA cloned from the Erwinia chromosome. It has been shown elsewhere that these proteins can also initiate transfer from an oriT in the chromosome of E. coli (16). Taken together, these observations suggest that the R1162 Mob proteins can function at ectopic sites in the chromosome, thus enabling horizontal gene transfer without prior integration of its own DNA. This could be particularly significant in the case of a broad-host-range plasmid like R1162, which can share cytoplasm with many different bacterial chromosomes. Moreover, the core itself does not have to be perfectly conserved: for example, either A or G can occupy the fourth position (Fig. 1). The R1162 Mob system is a member of a large family (3, 12), and remnants of plasmids and other transfer elements integrated previously into chromosomes, as well as sequences occurring by chance, could provide an additional source of core-like DNA.
This work was supported in part by a grant from the National Institutes of Health (GM37462). M.C.S. was supported by NSF Research Experiences for Undergraduates grant DBI-0139881.
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»