This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gyan, S.
Right arrow Articles by Sato, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gyan, S.
Right arrow Articles by Sato, T.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 2006, p. 7062-7071, Vol. 188, No. 20
0021-9193/06/$08.00+0     doi:10.1128/JB.00601-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Regulatory Loop between Redox Sensing of the NADH/NAD+ Ratio by Rex (YdiH) and Oxidation of NADH by NADH Dehydrogenase Ndh in Bacillus subtilis

Smita Gyan, Yoshihiko Shiohira, Ichiro Sato, Michio Takeuchi, and Tsutomu Sato*

International Environmental and Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu, Tokyo 183-8509, Japan

Received 28 April 2006/ Accepted 25 July 2006


arrow
ABSTRACT
 
NADH dehydrogenase is a key component of the respiratory chain. It catalyzes the oxidation of NADH by transferring electrons to ubiquinone and establishes a proton motive force across the cell membrane. The yjlD (renamed ndh) gene of Bacillus subtilis is predicted to encode an enzyme similar to the NADH dehydrogenase II of Escherichia coli, encoded by the ndh gene. We have shown that the yjlC-ndh operon is negatively regulated by YdiH (renamed Rex), a homolog of Rex in Streptomyces coelicolor, and a redox-sensing transcriptional regulator that responds to the NADH/NAD+ ratio. The ndh gene regulates expression of the yjlC-ndh operon, as indicated by the fact that mutation in ndh causes a higher NADH/NAD+ ratio. An in vitro study showed that Rex binds to the downstream region of the yjlC-ndh promoter and that NAD+ enhances the binding of Rex to the putative Rex-binding sites in the yjlC-ndh operon as well as in the cydABCD operon. These results indicated that Rex and Ndh together form a regulatory loop which functions to prevent a large fluctuation in the NADH/NAD+ ratio in B. subtilis.


arrow
INTRODUCTION
 
NADH produced during the glycolysis and tricarboxylic acid (TCA) cycle of the aerobic pathway is oxidized to NAD+ by the electron transport chain during the reduction of oxygen to water. Therefore, the NADH dehydrogenase-containing electron transport chain is important in the metabolic balance of NADH/NAD+ in the aerobic pathway.

Escherichia coli has multiple alternative electron transport chains produced in response to different environmental conditions and contains two alternative NADH dehydrogenases (15, 26). (i) NADH dehydrogenase I (NDH-1) contains one flavin mononucleotide, several Fe-S groups, and one bound ubiquinone. This isoenzyme, encoded by nuoA to -N, is coupled to the generation of proton motive force (12, 25, 27). (ii) NDH-2, encoded by ndh, is a single 47-kDa protein which contains flavin adenine dinucleotide and no iron (9, 15, 16). During fumarate respiration, NDH-1 is the preferred NADH dehydrogenase, whereas NDH-2 is used during aerobic and nitrate respiration (27).

Bacillus subtilis is a facultative aerobe that is capable of both aerobic and anaerobic respiration and has three predicted NADH dehydrogenases (YjlD, YumB, and YutJ), which share significant amino acid sequence identity with the E. coli NDH-2. Among these homologs, YjlD (also named Ndh) has been reported to be an anaerobically repressed membrane-associated protein (14), and the expression of ndh is elevated during exponential growth under aerobic conditions in strains with mutations in resDE (28), which encodes a putative oxygen sensor/regulator (4). However, the detailed regulatory mechanisms of ndh expression are unknown.

Meanwhile, a global redox-sensing protein, Rex, in Streptomyces coelicolor has been reported to function as a repressor of genes encoding respiratory proteins (2). More recently, the X-ray structure of a Rex family member from Thermus aquaticus, T-Rex, bound to NADH has been reported (23). S. coelicolor Rex and T-Rex bind to both NAD+ and NADH; however, NADH but not NAD+ inhibits the binding of these proteins to the operator regions of respiratory genes. The B. subtilis Rex homolog, YdiH (also named Rex), has also been reported to function to repress the cyd operon, encoding cytochrome bd terminal oxidase (22), and ldh and ywcJ, encoding lactate dehydrogenase and a putative formate-nitrate transporter, respectively (11).

In this report we present evidence that Ndh is a major NADH dehydrogenase in B. subtilis and oxidizes ample NADH in the cytoplasm when there is enough energy available. In the course of this work we discovered that yjlC and ndh are transcribed as a single transcriptional unit. ndh transcription is directly regulated by Rex, a global redox-sensing protein, the activity of which is regulated by the NADH/NAD+ ratio. We propose here that Ndh and Rex together form a regulatory loop to decrease the temporarily increased NADH/NAD+ ratio in the cytoplasm under aerobic conditions and to maintain a constant NADH/NAD+ ratio.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and general methods. Table 1 lists the strains and plasmids used in this study. Table 2 lists the oligonucleotide primers used in this study for PCR amplification. B. subtilis transformation was performed according to the method described by Dubnau and Davidoff-Abelson (3). E. coli BL21(DE3)/pLysS was used to produce recombinant Rex protein with an N-terminal affinity tag of six histidines. pT7 Blue-2 T-vector (Novagen) was used for TA cloning. Plasmids were constructed in E. coli JM105, unless otherwise indicated.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids used in this study


View this table:
[in this window]
[in a new window]
 
TABLE 2. Oligonucleotide primers used in this study

Plasmid and strain construction. Integrational plasmids pMutndh (native) and pMutndh (mutated) carry an internal fragment of ndh, which was amplified with primer pairs ndhF2-ndhR2 and ndhF1-ndhR1, respectively. The PCR product and pMUTinT3 (18) used for the construction were digested with BamHI and HindIII and then ligated. The plasmids were cloned in E. coli MC1061.

For plasmids pUCyut and pUCyum, an internal fragment of yutJ and yumB was amplified with primers pairs yutJ-F-yutJ-R and yumB-F-yumB-R. The PCR products and the pUCS192 (6) plasmid used for the construction were completely digested with restriction enzymes BamHI and EcoRI and then ligated.

pT7RA plasmid was constructed with oligonucleotide primers RT prime, A1 prime, A2 prime, S1 prime, and S2 prime to obtain the rapid amplification of cDNA ends (RACE) PCR fragment. The pT-7 Blue-2 T-vector used in the construction was digested with EcoRV and ligated to RACE PCR fragment. Before the sequencing experiment, the pT7RA plasmid was linearized by complete digestion with BamHI.

To construct the pJMrex plasmid, an internal fragment of rex was amplified with oligonucleotide primers rex-F and rex-R. The PCR product and pJM114 (19) plasmid used in this construction were digested with restriction enzymes PstI and BamHI and then ligated.

To obtain the pJMndh plasmid, an internal fragment of ndh was amplified with primers ndhF3 and ndhR1. The PCR product and the pJM114 plasmid used in this construction were completely digested with restriction enzymes XbaI and BamHI and then ligated.

For plasmid pTlacZ, the coding region of the lacZ gene from pMUTinT3 plasmid was amplified with primers lacZ-Xba and lacZ-Bgl. The PCR product and the pTCC1 (8) plasmid used for the construction were completely digested with restriction enzymes XbaI and BglII and then ligated.

To obtain plasmids pTlacZndh1, pTlacZndh2, pTlacZndh3, pTlacZndh4, and pTlacZndh6, an upstream fragment of the yjlC-ndh operon was amplified with primer pairs WTF3-NWR1, WTF3-NMR1, WTF3-NMR2, WTF3-RP1, and WTF3-RP3, respectively. The PCR products and the pTlacZ plasmid were digested with PstI and XbaI and then ligated. Before transformation into B. subtilis 168, the plasmids were linearized by digesting with ScaI.

A rex fragment was amplified by PCR with oligonucleotide primers Rex-HisF and Rex-HisR3. The PCR product was digested with BamHI and XhoI and ligated with pET-32a digested with the same enzymes. The resulting plasmid, pET-32arex-His, was cloned in E. coli BL21(DE3)/pLysS.

Growth conditions and ß-galactosidase assay. Growth for measurement of lacZ expression was performed in LB at 37°C. The ß-galactosidase activity was determined as previously described by Miller (17) by using o-nitrophenyl-ß-D-galactopyranoside as the substrate. The enzyme specific activity was expressed in nanomoles of the substrate hydrolyzed per milligram per minute.

Northern hybridization. Samples of cultures in LB at 37°C were taken at mid-log phase (T–1) and at 1 h (T1) and 3 h (T3) after the end of log phase, and total RNA was extracted from harvested cells as described previously (7). Total RNA (5 µg) resolved by electrophoresis was blotted onto a positively charged nylon membrane (Hybond N+; Amersham Pharmacia) and hybridized with digoxigenin-labeled DNA probes according to the manufacturer's instructions (Roche). The oligonucleotide primers LC-F and LC-R were used to amplify a 246-bp-long yjlC probe (probe LC), and the ND-F and ND-R primers were used to amplify a 264-bp-long ndh probe (probe ND).

5' RACE PCR. 5' RACE assays were carried out with 5 µg of total RNA purified from cells grown in LB medium and collected during the exponential phase of growth. The experiment was carried out according to a general protocol (U.S. version) provided with 5'-Full RACE Core Set from TAKARA Bio Inc. Reverse transcription was carried out by using primer RT prime which was phosphorylated at its 5' end. The first PCR was done with primers S1 prime and A1 prime, and the second PCR was done with primers S2 prime and A2 prime. PCR products were cloned into pT7 Blue-2 T-vector (Novagen) (as described in "Plasmid and strain construction" above). Plasmids containing inserts were sequenced using the DYEnamic ET terminator kit (MegaBACE, Amersham Biosciences) with primer A2 prime.

Cycling assay. Assays of the extracts containing specific dinucleotide species were performed as previously described by Bernofsky and Swan (1) and Leonardo et al. (13). Absorption was measured at 570 nm, and coenzyme standards from 0.02 mM to 1.5 mM were used to calibrate the assay.

Isolation of the overexpressed Rex-His protein. E. coli BL21(DE3)/pLysS harboring pET-32arex-His (strain BLH) were incubated overnight at 30°C in LB medium supplemented with ampicillin (50 µg/ml), and 1 ml of the culture was used to inoculate 100 ml of the same medium. Cells were grown at 37°C until the optical density at 600 nm of the culture reached about 0.5. IPTG (isopropyl-ß-D-thiogalactopyranoside) was then added to the culture at a final concentration of 1 mM. After incubation for 5 h, cells were harvested by centrifugation (5,000 x g) at 4°C and washed with lysis buffer (50 mM NaH2PO4 · 2H2O, 300 mM NaCl, 10 mM imidazole) and 100 µM phenylmethylsulfonyl fluoride. Cells were treated with 1.5 ml of lysozyme (10 mg/ml) on ice, frozen in liquid nitrogen, and immediately sonicated. The sonicated cells were treated with 10 µl of DNase I (70 U/µl) and 37.5 µl of RNase A (2 mg/ml). Cleared lysates were then mixed with 2.5 ml of Ni-nitrilotriacetic acid (QIAGEN) affinity resin. The Ni-nitrilotriacetic acid column was washed using 20 mM imidazole, and proteins were eluted with 300 mM imidazole. The eluted protein was then dialyzed against buffer A (1 M NaCl, 5 mM MgCl2, 50 mM Tris HCl [pH 7.8]) and stored with 10% glycerol at –20°C. The protein concentration was determined by the Bio-Rad protein assay.

EMSA. In each reaction the desired concentrations of protein and DNA were incubated in buffer {25 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)] [pH 6.1], 25 mM NaCl, 0.5 mM dithiothreitol, 2 mM EDTA, 2 mM MgCl2, 5% glycerol} for 15 min at room temperature. In the case of electrophoretic mobility shift assay (EMSA) with coenzymes (ß-NAD+ and ß-NADH) (Sigma), desired concentrations of coenzymes were added after 15 min of incubation to this reaction mixture and further incubated for 15 min at room temperature. The samples were loaded onto a 6% polyacrylamide gel in Tris-borate-EDTA. After a prerun of about 1 h, the gel was electrophoresed at 4°C for 2 h and then denatured in denaturation solution (1.5 M NaCl, 0.5 M NaOH) and neutralized in neutralization solution (0.5 M Tris-HCl [pH 7.5], 1.5 M NaCl, 0.001 M Na2EDTA). After neutralization, the gel was blotted on an N+ Hybond nylon membrane overnight. The hybridizations were carried out with digoxigenin-labeled probes at 68°C in a hybridization oven. The hybridized probes bound to antidigoxigenin-alkaline phosphatase conjugate (1:5,000 dilutions) were detected with nitroblue tetrazolium/BCIP (5-bromo-4-chloro-3-indolylphosphate) (according to the protocol described by Roche Applied Chemicals). A 356-bp cyd probe was prepared using oligonucleotide primers cydPF and cydPR to amplify the promoter region. A 154-bp ndh probe (probe B) was prepared using oligonucleotide primers WTF1 and RP0 to amplify the promoter region. Site-directed mutagenesis was carried out to introduce one- and two-base-pair alterations within the putative Rex-binding site lying between positions –92 and –113 from the initiation codon. ndh mutant probes (109 bp) having one base pair altered (probe C) and two base pairs altered (probe D) were amplified using primer pairs M1F-RP0 and M2F-RP0, respectively. An 83-bp ndh probe (probe E) which lacked the binding site was amplified using primers D1F and RP0. After amplification, DNAs were labeled according to the protocol provided with the DIG DNA labeling and detection kit (Roche Applied Science).


arrow
RESULTS
 
Growth pattern of the ndh mutant. NADH dehydrogenase plays an important role in catalyzing the translocation of electrons from NADH to ubiquinone and in generating proton motive force which is utilized to produce ATP for cellular metabolism. Since B. subtilis is thought to have three possible NDH-2-encoding genes (16), i.e., yjlD, yutJ, and yumB, we tested the growth of strains with mutations in these genes on LB solid medium at 37°C. We found that the growth of yutJ and yumB mutants on LB plates was similar to that of the wild type, but the yjlD (renamed ndh) mutant exhibited a growth defect (Fig. 1A). This led us to presume that among the three possible NADH dehydrogenases, Ndh is the major NADH dehydrogenase in B. subtilis and possibly plays a crucial role in aerobic respiration. To further verify this idea, the growth patterns of strain 168 (wild type) and the ndh mutant (DMZ) cells were compared at 37°C in LB liquid medium. Similar to the growth on solid medium, the ndh mutant exhibited slower growth than the wild type (Fig. 1B) in liquid culture. The slower growth indicates the importance of Ndh as the major NADH dehydrogenase in B. subtilis. A slow-growth phenotype has also been observed in E. coli cells having mutations in the nuo operon, which encodes NDH-1 (20).


Figure 1
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 1. (A) DMZ (YjlD) exhibits slower growth than YUM1 (YumB), YUT1 (YutJ), and the wild-type (WT) strain. Strains were grown on LB solid medium at 37°C. (B) Growth curves of the B. subtilis wild-type strain and the ndh mutant. Open circles, B. subtilis 168; closed circles, B. subtilis DMZ. Cultures were grown in LB medium at 37°C. OD600, optical density at 600 nm.

yjlC-ndh forms a transcriptional unit. Sequence analysis of the yjlC-ndh region showed that the ndh start codon resides 42 nucleotides downstream of the yjlC stop codon (http://bacillus.genome.ad.jp/). In addition, no consensus promoter sequence was observed in the upstream region of the ndh open reading frame. This suggested that yjlC and ndh probably constitute an operon. We therefore examined whether the two genes are cotranscribed by Northern blot analysis. Two types of DNA probes were used for the Northern hybridization experiment, probe LC and probe ND, containing the 5' regions of yjlC and ndh, respectively (Fig. 2A) (described in Materials and Methods). RNA was isolated at three time points of the growth curve (T–1, T1, and T3), as described in Materials and Methods. A single transcript of 2 kb, which corresponds to the size of the yjlC-ndh operon, was detected for RNA isolated from wild-type strain 168 cultures at T–1 with either probe (Fig. 2B), whereas the transcript was barely detected in RNA prepared from cultures at T1 and T3 with either probe. This observation suggested that the yjlC-ndh operon is expressed at a much higher level in exponential phase than in stationary phase. A similar result was obtained with RNA isolated from cells cultured in sporulation (DS) medium.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2. Transcriptional unit of the ndh operon. (A) Gene organization of the ndh operon. Thick bars (probe LC and probe ND) indicate probes used for Northern hybridization experiments. The length of the transcript, as deduced from Northern hybridization experiments, is indicated by the arrow. aa, amino acids. (B) Northern hybridization analysis using probes LC and ND. Upper panel, probe LC; lower panel, probe ND. RNA was isolated from B. subtilis 168 (lanes 1 to 3) and from the rex mutant (lanes 4 to 6) grown at 37°C in LB medium and harvested at mid-log phase (lanes 1and 4) and at 1 h (lanes 2 and 5) and 3 h (lane 3 and 6) after the end of log phase. The transcript size was determined by comparison with standard RNA markers of 0.2 to 10 kb (Novagen). (C). Nucleotide sequence of the upstream region of the yjlC-ndh operon. The initiation codon, transcription initiation site, and –10 and –35 regions are shown in boldface uppercase. The nonmatching sequence compared to the consensus –10 and –35 sequences are shown in lowercase. The bent arrow indicates the transcriptional start site. The sequence in boldface lowercase within the rectangle indicates the Rex-binding site.

The Northern blot analysis indicated that yjlC and ndh are cotranscribed from a promoter residing upstream of the yjlC gene. Next, the yjlC transcriptional start site was identified by 5' RACE PCR. The transcription start site was defined from the sequencing results for eight clones. Out of eight clones, the sequencing results for six clones indicated that the transcriptional start site was located 257 bp upstream of the initiation codon of the yjlC gene. The –10 sequence (TGTTATCAT) has a nearly perfect match to a canonical "extended –10" sequence (TGNTATAAT) (5), and a less conserved –35 sequence (TTCAAA) is present with 14-bp spacing (Fig. 2C). Hence, the results indicated that the yjlC-ndh promoter is recognized by RNA polymerase containing the housekeeping sigma factor {sigma}A.

ndh mutation alters the NADH/NAD+ ratio in cytoplasm. If Ndh is the major NADH dehydrogenase in B. subtilis, the mutants with lowered NADH dehydrogenase activity should have an altered intracellular NADH/NAD+ ratio. To examine this hypothesis, we used a sensitive cycling assay to measure the concentrations of NADH and NAD+ in wild-type and ndh mutant (DMZ) cells harvested at mid-log, T1, and T3 time points. Our results reproducibly showed that the NADH/NAD+ ratio was significantly higher in the ndh mutant than in the wild type (for example, the NADH/NAD+ ratio was ~0.8 in the wild-type strain and ~2.2 in the ndh mutant at mid-log phase) (Fig. 3). Similar trends were seen in cells harvested at T1 and T3. The values shown in Fig. 3 are means from triplicate assays, and the significance was determined using Student's t test. The results suggest that ndh encodes the major, if not sole, functional NADH dehydrogenase in B. subtilis and that reduced NADH dehydrogenase activity in the ndh mutant increases the intracellular NADH/NAD+ ratio.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. The ndh mutant has an altered intracellular NADH/NAD+ ratio. The NADH and NAD+ concentrations were measured in triplicate as described in Materials and Methods. The experiments were repeated three times, and the average is plotted with its standard deviation. 168, wild-type strain; DNDH, ndh mutant.

ndh mutation enhances yjlC-ndh transcription. We next examined the effect of the ndh mutation on ndh transcription by using a transcriptional yjlC-lacZ fusion. In the ndh insertional mutant (DMZ) with the pMUTinT3 vector, the lacZ gene was integrated into the ndh gene, and hence ß-galactosidase is expressed from the promoter for yjlC-ndh. In the fusion-integrated strains, ß-galactosidase activities were high during the exponential phase (T–1) but began to decrease concomitantly with further transition from the exponential to the stationary phase in LB medium (Fig. 4). We then constructed the DNZ strain, which contains the yjlC-ndh-lacZ fusion (ndh is not disrupted). The level of expression of yjlC-ndh-lacZ in DNZ was five- to sixfold lower than that of yjlC-lacZ in DMZ. We postulated that the high yjlC-ndh expression in DMZ was due to the high NADH/NAD+ ratio in the cytoplasm caused by the loss of NADH dehydrogenase activity. Rex is known as a redox-sensing repressor that responds to the NADH/NAD+ ratio in S. coelicolor (2). Recently, Rex (YdiH), an S. coelicolor Rex ortholog, was identified in B. subtilis (22), although such regulation has not been demonstrated in the B. subtilis Rex protein. Therefore, we assumed that the high level of NADH in the ndh mutant was due to higher expression of the yjlC-ndh operon, and if so, it is likely that the regulation is mediated through the Rex protein. Therefore, we next examined the effect of a rex mutation on yjlC-ndh expression in DHNZ (Fig. 4). As expected, the ß-galactosidase activity in DHNZ was as high as that in DMZ. This result also corresponds well with the results of Northern blot hybridization, where the yjlC-ndh transcript signal was stronger in the rex mutant strain than in the wild type (Fig. 2B).


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 4. Expression of ndh depends on expression of ndh. (A) Schematic representation of relevant genes in constructed strains. (B) ß-Galactosidase activities of the strains. Closed squares, DNZ; open squares, DMZ; circles, DHNZ. Cultures were grown in LB medium at 37°C.

S. coelicolor Rex is a repressor that is released from DNA when the NADH/NAD+ ratio becomes high (2). Therefore, it is conceivable that Rex could repress the transcription of ndh and that the repression is relieved under conditions with a higher NADH/NAD+ ratio. If Rex directly regulates ndh transcription, the ndh regulatory region must contain a conserved Rex-binding box. The reported Rex-binding consensus sequence is TTTGTGAADTABTGAKCAAWDT (D = A, T, or G; B = T, C, or G; K = G or T; and W = A or T) (22). A sequence similar to the consensus Rex-binding sequence was found in the upstream region of yjlC (Fig. 2C). To verify that this sequence is indeed the Rex-binding site, nucleotide changes in the sequence were introduced and the effect of the mutations on yjlC-ndh transcription was determined (Fig. 5B). The ß-galactosidase activities of strain CDA2 (with a one-base-pair alteration in the putative Rex-binding box) and CDA3 (with a two-base-pair alteration) were both approximately fourfold higher than the activity in strain CDA1 (with the wild-type Rex-binding box). This result showed that yjlC-lacZ expression is derepressed if it lacks the conserved Rex-binding box (in strain CDA4). These results strongly suggested that Rex exerts a negative effect on yjlC-ndh transcription by directly binding to the regulatory region of the yjlC-ndh operon. Strain CDA6, with yjlC-lacZ that lacks the –10 and –35 regions, showed negligible activity.


Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. Transcriptional analysis of the regulatory region in the ndh operon. (A) Schematic representation of the constructed lacZ-fused strains; altered bases within the Rex-binding box are indicated in boldface lowercase. The positions are indicated with reference to the initiation codon of yjlC. (B) ß-Galactosidase activities of the strains. Closed squares, CDA1; open squares, CDA2; circles, CDA3; closed triangles, CDA4; open triangles, CDA6. Cultures were grown in LB medium at 37°C.

Rex binds to the upstream region of yjlC-ndh. To examine the direct interaction of Rex with this putative target site, we performed EMSA analysis of the ndh promoter region with the Rex protein. Recombinant Rex protein (Rex-His) was purified from E. coli by using expression vector pET32a. A DNA fragment (probe cyd) carrying the cyd upstream region, including the Rex-binding site, was used as a positive control. We observed three levels of shifted bands corresponding to three types of Rex-DNA complexes formed in the upstream region of cyd (Fig. 6C). This result is in good agreement with recent data from Schau et al. (22), confirming that the purified Rex protein was active. We next investigated whether Rex binds to a DNA fragment containing the putative Rex-binding site. For this experiment, we first used the 154-bp probe B containing the putative Rex-binding site of the yjlC-ndh operon (Fig. 6A). The EMSA result showed one shifted band with Rex, suggesting that this fragment has a single Rex-binding site (Fig. 6B). We also used a longer (350-bp) ndh probe to determine whether an additional Rex-binding site is present in a region further upstream of the yjlC-ndh operon, but the EMSA results again showed only one Rex-binding site (data not shown). To confirm the putative Rex-binding site, we performed EMSA with two probes having mutations in the putative binding site, as shown in Fig. 2C. The first mutant probe (probe C) was 109 bp long with a one-base-pair alteration in the putative binding site, the second mutant probe (probe D) had a similar length with a two-base-pair alteration, and the third mutant probe (probe E) was about 83 bp long and lacked the putative binding site (Fig. 6A). Probe C showed weak affinity to Rex, and the binding was still weaker with probe D (Fig. 6B). In addition, mutant probe E, which lacks the putative Rex-binding site, showed no shift of the band at all (Fig. 6B). These results strongly support the notion that Rex binds to the putative Rex-binding site, which was further confirmed by the results of the following ß-galactosidase assays. Strain HCDA1 (rex mutation introduced into the CDA1 strain) showed higher yjlC expression than CDA1, which supports the idea that Rex negatively regulates ndh transcription by direct binding to the Rex-binding site (Fig. 7A). In addition, yjlC-lacZ expression in the rex mutant was comparable to that in the wild-type strain carrying the yjlC-lacZ fusion that bears a mutation in the putative Rex box (compared Fig. 7A and 5B). yjlC-lacZ carrying the mutated Rex box or without the Rex box (CDA3 and CDA4, respectively) showed almost identical activity in the wild-type and rex mutant strains, indicating that the rex mutation exerted no additional effect on the expression of yjlC-lacZ if the Rex box was either mutated or deleted (Fig. 7B and C, respectively). These results, taken together with the EMSA results, clearly demonstrated that Rex binds directly to the Rex box located between positions –92 and –113 (ATTGTGCATGAATTCACAATCC) from the initiation codon and represses yjlC-ndh transcription.


Figure 6
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 6. EMSA with Rex-His protein. (A) Structural representation of the upstream region of the yjlC-ndh operon and probe DNA fragments used in the assay. Altered bases are indicated in boldface lowercase. The nucleotide positions are indicated relative to the initiation codon of yjlC. (B) EMSA with probes B, C, D, and E. (C) Schematic representation of the upstream region of cyd used as the probe DNA. Open boxes, –10 and –35 regions; solid boxes, Rex-binding sites. The DNA probes were incubated with increasing amounts of Rex-His protein (0, 0.5, 0.75, 1.5, 3, and 15 µM in lanes 1, 2, 3, 4, 5, and 6, respectively) and analyzed by EMSA. The thin and thick arrows show the positions of the protein-DNA complex and unbound DNA, respectively.


Figure 7
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 7. Rex negatively regulates the transcription of the ndh operon. ß-Galactosidase activity was measured in the wild-type (CDA) and in rex mutant (HCDA) strains. (A) Open circles, HCDA1; closed circles, CDA1. (B) Open circles, HCDA3; closed circles, CDA3. (C) Open circles, HCDA4; closed circles, CDA4. Cultures were grown in LB medium at 37°C. Open boxes, –10 and –35 regions; solid box, Rex-binding site; gray box, Rex-binding site with a mutation.

Ndh and Rex form a regulatory loop enabling oxidation of ample NADH in the cytoplasm under aerobic conditions. The abnormal alteration in the NADH/NAD+ ratio caused by the ndh mutation and direct regulation of ndh transcription by Rex led us to analyze whether the NADH/NAD+ ratio affects binding of Rex to the promoter. Furthermore, Brekasis and Pagget (2) and Sickmier et al. (23) reported that the binding activities of S. coelicolor Rex and of T. aquatics T-Rex are inhibited by NADH. The S. coelicolor Rex protein binds to the operator sites of the cydABCD and rex-hemACD operons (2). In order to determine if the B. subtilis Rex DNA-binding activity is inhibited by NADH, we performed EMSA analysis using the cyd probe and probe B (ndh) in the presence of NADH or NAD+. The addition of increasing concentrations of NADH reduced the formation of all Rex-DNA complexes formed with either the cyd probe or probe B (Fig. 8A and C). These results demonstrated that NADH inhibits the Rex DNA-binding activity in B. subtilis also, which is in good agreement with the data reported for S. coelicolor Rex and T-Rex. However, although a low concentration of NADH (~0.1 mM) completely abolished S. coelicolor Rex- or T-Rex-DNA complex formation, B. subtilis Rex-DNA complexes were only partially dissociated even at higher concentrations of NADH (~1 mM). Surprisingly, addition of increasing concentrations of NAD+ enhanced the formation of both Rex-DNA complexes (Fig. 8B and D). Unlike for B. subtilis Rex, NAD+ has a negligible negative effect on S. coelicolor Rex- or T-Rex-DNA complex formation (2, 23). Together, the results indicate that NAD+ enhances the binding of Rex to the putative Rex-binding sites in the yjlC-ndh operon in B. subtilis.


Figure 8
View larger version (70K):
[in this window]
[in a new window]
 
FIG. 8. Effects of NAD+ and NADH on DNA-binding activity of Rex. (A) The cyd DNA probe (5 ng/µl) and Rex-His (15 µM) were incubated with increasing amounts of NADH (0, 0.2, 0.5, 1.0, and 10.0 mM in lanes 2, 3, 4, 5, and 6, respectively). (B) The cyd DNA probe (5 ng/µl) and Rex-His (8 µM) were incubated with increasing amounts of NAD+ (0, 0.2, 0.5, 1.0, and 10.0 mM in lanes 2, 3, 4, 5, and 6, respectively.) Lane 1 shows the unbound cyd probe without protein and coenzymes in panels A and B. (C) The yjlC-ndh DNA probe (5 ng/µl) and Rex-His (15 µM) were incubated with increasing amounts of NADH (0, 0.125, 0.145, 0.17, 0.2, 0.25, 0.5, 1.0, 2.0, 5.0, and 10.0 mM in lanes 2 to 12, respectively). (D) The yjlC-ndh DNA probe (5 ng/µl) and Rex-His (8 µM) were incubated with increasing amounts of NAD+ (0, 0.125, 0.2, 0.25, 0.5, and 1.0 mM in lanes 2, 3, 4, 5, 6, and 7, respectively). Lanes 1 in panels D and E show unbound yjlC-ndh probe. The solid triangles indicate the increasing concentrations of NAD+. The open triangles indicate the increasing concentrations of NADH. The thin and thick arrows show the positions of protein-DNA complexes and unbound DNA, respectively.


arrow
DISCUSSION
 
NADH produced during the catabolism of glucose via glycolysis and the TCA cycle needs to be oxidized to NAD+ to provide oxidizing power to the cellular machinery. NADH dehydrogenase is the first enzyme of the respiratory chain, catalyzing the reoxidation of NADH and transferring electrons to ubiquinone, but in B. subtilis, the physiological role of NADH dehydrogenase has not been well understood. Our studies provide evidence that the ndh gene plays an essential role not only in the respiration chain but also in its own expression via a regulatory loop between redox sensing of the NADH/NAD+ ratio by Rex and oxidation of NADH by the NADH dehydrogenase Ndh.

Type I (NDH-1) and type II (NDH-2) NADH dehydrogenases are widely distributed in organisms, both eukaryotic and prokaryotic (16, 26). E. coli has both of the two enzymes that can oxidize NADH. During fumarate respiration, NDH-1, encoded by the nuo genes, is the preferred NADH dehydrogenase, whereas NDH-2, encoded by ndh, is used during aerobic and nitrate respiration (24). Interestingly, genes resembling nuoA to -N encoding NDH-1 of E. coli were found to be missing in the genome of B. subtilis (10). Instead, three genes, i.e., yjlD, yutJ, and yumB, have been predicted to encode NDH-2 in B. subtilis. In this study we focused on yjlD (renamed ndh) and obtained evidence which proved that Ndh is the major NADH dehydrogenase in B. subtilis, since an ndh mutant but not yutJ and yumB mutants exhibited slower growth in LB (Fig. 1). We also showed that ndh is expressed at a much higher level in the exponential phase than in the stationary phase (Fig. 2 and 3). The mechanism of repression of ndh expression during stationary phase is unknown, but it is thought to be independent of Rex (Fig. 2). Ndh has been reported to be an anaerobically repressed protein (14), and the expression of ndh is elevated during exponential growth under aerobic conditions in a resDE (oxygen sensor/regulator) mutant (28). Some additional regulation may result from changes in the expression level of ndh in the stationary phase and/or anaerobic condition. We have not determined the characterization of the other two gene products, but they may become activated and take over the function of Ndh during stationary phase. However, Ndh most probably plays a central role in the respiratory chain and also maintains the cell NADH/NAD+ balance in the vegetative phase (Fig. 3).

Brekasis and Pagget (2) reported that the S. coelicolor Rex protein, a novel sensor of the NADH/NAD redox poise, binds to the cis elements of the cyd and nuo operons in S. coelicolor. Schau et al. (22) determined the precise B. subtilis Rex (YdiH)-binding region in the cyd operon. However, so far, no study has demonstrated the effect of NADH and NAD+ on the DNA-binding activity of Rex in B. subtilis. We determined the DNA-binding activity of Rex with NADH or NAD+. The results showed that NAD+ boosted the binding activity of Rex but that NADH seemed to have a negligible effect or a partial negative effect on DNA-binding activity. These data suggest that DNA-binding determinants of B. subtilis Rex are distinct from those of S. coelicolor Rex, since in S. coelicolor Rex NAD+ plays a small or negligible role in DNA-binding activity while NADH completely inhibits DNA-binding activity. Interestingly, B. subtilis Rex and S. coelicolor Rex regulate respiratory metabolism gene expression via redox sensing of the NADH/NAD+ ratio, although their DNA-binding determinants are distinct.

Microarray analysis performed by Larsson et al. (11) revealed that during the transition from aerobic to microaerophilic and finally to anaerobic growth, the coordination of certain respiratory genes (e.g., cyd, encoding cytochorome terminal oxidase; ldh, encoding lactate dehydrogenase; lctP, encoding lactate permease; and ywcJ, encoding a predicted formate nitrate transporter) is negatively regulated by Rex (11). However, although they emphasized the regulation of the above genes in their microarray analysis, they did not show the regulation of certain important aerobic respiratory genes, such as ndh, by Rex. They described a regulatory model in which Rex and LDH act coordinately to prevent a large fluctuation in the NADH/NAD+ ratio under fermentative conditions. In this work, however, we have shown an alternative model, which functions under aerobic conditions, in which Rex and Ndh together form a regulatory loop to maintain a constant NADH/NAD+ ratio. More recently, Reents et al. (21) have also shown a regulatory model for redox regulators ResD, Fnr, and Rex during the transition to anaerobic growth conditions.

We then performed DNA microarray analysis under aerobic conditions and found that Rex, in addition to regulating the above-mentioned genes, including ndh, is also a negative regulator of genes involved in glycerol metabolism and the TCA cycle (data not shown). It would be no surprise if Rex regulated such genes, because they play an important role in the production of NADH. The physiological reason for a global gene regulation system under the control of Rex will be the subject of future studies.

These results support the following model for the maintenance of a constant NADH/NAD+ ratio in the cytoplasm under aerobic conditions. When the NAD+ concentration is high in the cytoplasm, Rex in the complex with NAD+ binds to the upstream region of yjlC-ndh to repress the transcription, leading to a decrease in the oxidation of NADH. When the concentration of NADH becomes higher than that of NAD+, Rex forms a complex with NADH. Since Rex in the complex with NADH has a weaker affinity to DNA, ndh transcription is induced, which results in NADH oxidation in the cytoplasm. Thus, we propose that Ndh and Rex form a "regulatory loop" that maintains the NADH/NAD+ ratio in B. subtilis cells.

The mechanism discovered in this work will provide clues for unraveling the complexity behind the maintenance of a constant NADH/NAD+ ratio in the cytoplasm, but we have not ruled out the existence of other mechanisms that may also be involved in maintaining a constant NADH/NAD+ ratio in the cytoplasm. Whether the Ndh-Rex pair forms a similar regulatory loop in other bacteria or whether this mechanism is exclusive to B. subtilis remains to be clarified. Further work on Ndh and Rex should lead to a better understanding of redox regulation under various conditions in B. subtilis.


arrow
ACKNOWLEDGMENTS
 
We are indebted to Michiko M. Nakano (Oregon Health Science University) for critically reading the manuscript and giving valuable comments.

This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: International Environmental and Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu, Tokyo 183-8509, Japan. Phone: 81-423-67-5706. Fax: 81-423-67-5706. E-mail: subtilis{at}cc.tuat.ac.jp. Back


arrow
REFERENCES
 
    1
  1. Bernofsky, C., and M. Swan. 1973. An improved cycling assay for nicotinamide adenine dinucleotide. Anal. Biochem. 53:452-458.[CrossRef][Medline]
  2. 2
  3. Brekasis, D., and M. S. Pagget. 2003. A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3(2). EMBO J. 22:4856-4865.[CrossRef][Medline]
  4. 3
  5. Dubnau, D., and R. Davidoff-Abelson. 1971. Fate of transforming DNA following uptake by competent Bacillus subtilis. Formation and properties of the donor-recipient complex. J. Mol. Biol. 56:209-221.[CrossRef][Medline]
  6. 4
  7. Geng, H., S. Nakano, and M. M. Nakano. 2004. Transcriptional activation by Bacillus subtilis ResD: tandem binding to target elements and phosphorylation-dependent and -independent transcriptional activation. J. Bacteriol. 186:2028-2037.[Abstract/Free Full Text]
  8. 5
  9. Helmann, J. D., and C. P. Moran, Jr. 2002. RNA polymerase and sigma factors, p. 289-312. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. American Society for Microbiology Washington, D.C.
  10. 6
  11. Hosoya, S., K. Asai, N. Ogasawara, M. Takeuchi, and T. Sato. 2002. Mutation in yaaT leads to significant inhibition of phosphorelay during sporulation in Bacillus subtilis. J. Bacteriol. 184:5545-5553.[Abstract/Free Full Text]
  12. 7
  13. Igo, M. M., and R. Losick. 1986. Regulation of a promoter that is utilized by minor forms of RNA polymerase holoenzyme in Bacillus subtilis. J. Mol. Biol. 191:615-624.[CrossRef][Medline]
  14. 8
  15. Imamura, D., K. Kobayashi, J. Sekiguchi, N. Ogasawara, M. Takeuchi, and T. Sato. 2004. spoIVH (ykvV), a requisite cortex formation genes, is expressed in both sporulating compartments of Bacillus subtilis. J. Bacteriol. 186:5450-5459.[Abstract/Free Full Text]
  16. 9
  17. Jaworowski, A., H. D. Campbell, M. I. Poulis, and I. G. Young. 1981. Genetic identification and purification of the respiratory NADH dehydrogenase of Escherichia coli. Biochemistry 20:2041-2047.[CrossRef][Medline]
  18. 10
  19. Kunst, F., N. Ogasawara, I. Moszer, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.[CrossRef][Medline]
  20. 11
  21. Larsson, J. T., A. Rogstam, and C. von Wachenfeldt. 2005. Coordinated patterns of cytochrome bd and lactate dehydrogenase expression in Bacillus subtilis. Microbiology 151:3323-3335.[Abstract/Free Full Text]
  22. 12
  23. Leif, H., V. D. Sled, T. Ohnishi, H. Weiss, and T. Friedrich. 1995. Isolation and characterization of the proton-translocating NADH: ubiquinone oxidoreductase from Escherichia coli. Eur. J. Biochem. 230:538-548.[Medline]
  24. 13
  25. Leonardo, M. R., Y. Dailly, and D. P. Clark. 1996. Role of NAD in regulating the adhE gene of Escherichia coli. J. Bacteriol. 178:6013-6018.[Abstract/Free Full Text]
  26. 14
  27. Marino, M., T. Hoffmann, R. Schmid, H. Mobitz, and D. Jahn. 2000. Changes in protein synthesis during the adaptation of Bacillus subtilis to anaerobic growth conditions. Microbiology 146:97-105.[Abstract/Free Full Text]
  28. 15
  29. Matsushita, K., T. Ohnishi, and H. R. Kaback. 1987. NADH-ubiquinone oxidoreductases of the Escherichia coli aerobic respiratory chain. Biochemistry 26:7732-7737.[CrossRef][Medline]
  30. 16
  31. Melo, A. M., T. M. Bandeiras, and M. Teixeira. 2004. New insights into type II NAD(P)H:quinone oxidoreductases. Microbiol. Mol. Biol. Rev. 68:603-616.[Abstract/Free Full Text]
  32. 17
  33. Miller, J. H. 1972. Experiments in molecular genetics, p. 352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  34. 18
  35. Ogasawara, N. 2000. Systematic function analysis of Bacillus subtilis genes. Res. Microbiol. 151:129-134.[Medline]
  36. 19
  37. Perego, M. 1993. Integrational vectors for genetic manipulation in Bacillus subtilis, p. 615-624. In A. L. Sonenshein, J. H. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C.
  38. 20
  39. Prüss, B. M., J. M. Nelms, C. Park, and A. J. Wolfe. 1994. Mutations in NADH:ubiquinone oxidoreductase of Escherichia coli affect growth on mixed amino acids. J. Bacteriol. 176:2143-2150.[Abstract/Free Full Text]
  40. 21
  41. Reents, H., R. Münch, T. Dammeyer, D. Jahn, and E. Härtig. 2006. The Fnr regulon of Bacillus subtilis. J. Bacteriol. 188:1103-1112.[Abstract/Free Full Text]
  42. 22
  43. Schau, M., Y. Chen, and F. M. Hulett. 2004. Bacillus subtilis YdiH is a direct negative regulator of the cydABCD operon. J. Bacteriol. 186:4585-4595.[Abstract/Free Full Text]
  44. 23
  45. Sickmier, E. A., D. Brekasis, S. Paranawithana, J. B. Bonanno, M. S. Paget, S. K. Burley, and C. L. Kielkopf. 2005. X-ray structure of a Rex-family repressor/NADH complex insights into the mechanism of redox sensing. Structure 13:43-54.[Medline]
  46. 24
  47. Tran, Q. H., J. Bongaerts, D. Vlad, and G. Unden. 1997. Requirement for the proton-pumping NADH dehydrogenase I of Escherichia coli in respiration of NADH to fumarate and its bioenergetic implications. Eur. J. Biochem. 244:155-160.[Medline]
  48. 25
  49. Weidner, U., S. Geier, A. Ptock, T. Friedrich, H. Leif, and H. Weiss. 1993. The gene locus of the proton-translocating NADH: ubiquinone oxidoreductase in Escherichia coli. Organization of the 14 genes and relationship between the derived proteins and subunits of mitochondrial complex I. J. Mol. Biol. 233:109-122.[CrossRef][Medline]
  50. 26
  51. Yagi, T. 1991. Bacterial NADH-quinone oxidoreductases. J. Bioenerg. Biomembr. 23:211-215.[CrossRef][Medline]
  52. 27
  53. Yagi, T. 1993. The bacterial energy-transducing NADH-quinone oxidoreductases. Biochim. Biophys. Acta 1141:1-17.[Medline]
  54. 28
  55. Ye, R. W., W. Tao, L. Bedzyk, T. Young, M. Chen, and L. Li. 2000. Global gene expression profiles of Bacillus subtilis grown under anaerobic conditions. J. Bacteriol. 182:4458-4465.[Abstract/Free Full Text]


Journal of Bacteriology, October 2006, p. 7062-7071, Vol. 188, No. 20
0021-9193/06/$08.00+0     doi:10.1128/JB.00601-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Toyoda, K., Teramoto, H., Inui, M., Yukawa, H. (2009). The ldhA Gene, Encoding Fermentative L-Lactate Dehydrogenase of Corynebacterium glutamicum, Is under the Control of Positive Feedback Regulation Mediated by LldR. J. Bacteriol. 191: 4251-4258 [Abstract] [Full Text]  
  • Somerville, G. A., Proctor, R. A. (2009). At the Crossroads of Bacterial Metabolism and Virulence Factor Synthesis in Staphylococci. Microbiol. Mol. Biol. Rev. 73: 233-248 [Abstract] [Full Text]  
  • Kohler, C., von Eiff, C., Liebeke, M., McNamara, P. J., Lalk, M., Proctor, R. A., Hecker, M., Engelmann, S. (2008). A Defect in Menadione Biosynthesis Induces Global Changes in Gene Expression in Staphylococcus aureus. J. Bacteriol. 190: 6351-6364 [Abstract] [Full Text]  
  • Makhlin, J., Kofman, T., Borovok, I., Kohler, C., Engelmann, S., Cohen, G., Aharonowitz, Y. (2007). Staphylococcus aureus ArcR Controls Expression of the Arginine Deiminase Operon. J. Bacteriol. 189: 5976-5986 [Abstract] [Full Text]  
  • Fuchs, S., Pane-Farre, J., Kohler, C., Hecker, M., Engelmann, S. (2007). Anaerobic Gene Expression in Staphylococcus aureus. J. Bacteriol. 189: 4275-4289 [Abstract] [Full Text]  
  • Puri-Taneja, A., Schau, M., Chen, Y., Hulett, F. M. (2007). Regulators of the Bacillus subtilis cydABCD Operon: Identification of a Negative Regulator, CcpA, and a Positive Regulator, ResD. J. Bacteriol. 189: 3348-3358 [Abstract] [Full Text]  
  • Swartz, T. H., Ito, M., Ohira, T., Natsui, S., Hicks, D. B., Krulwich, T. A. (2007). Catalytic Properties of Staphylococcus aureus and Bacillus Members of the Secondary Cation/Proton Antiporter-3 (Mrp) Family Are Revealed by an Optimized Assay in an Escherichia coli Host. J. Bacteriol. 189: 3081-3090 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gyan, S.
Right arrow Articles by Sato, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gyan, S.
Right arrow Articles by Sato, T.