Previous Article | Next Article ![]()
Journal of Bacteriology, November 2006, p. 7830-7839, Vol. 188, No. 22
0021-9193/06/$08.00+0 doi:10.1128/JB.00979-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Immunology, Emory University School of Medicine,1 Laboratories of Microbial Pathogenesis, Veterans Affairs Medical Center, Atlanta, Georgia2
Received 5 July 2006/ Accepted 5 September 2006
|
|
|---|
|
|
|---|
A large number of genes that function in diverse aspects of physiology and metabolism are required for swarming and have revealed the complexity of this process (see references 3-6, 11, 13, 14, 18, 26, and 27; reviewed in reference 22). Swarmer cell differentiation is dependent on certain environmental conditions that include a solid surface, inhibition of flagellar rotation, and cell-cell signaling (1, 6, 27).
In P. mirabilis, a key regulator of both flagellin expression and swarmer cell differentiation is FlhDC, a heterodimeric activator that activates class 2 genes required for flagellar biogenesis (7, 8, 9, 11, 13). In P. mirabilis, a three-tiered system of flagellar regulation similar to that in Escherichia coli is likely to be present (3, 13, 19). FlhD2C2, a transcriptional activator, acts as the primary regulator and incorporates environmental and cell growth phase signals in order to activate class 2 genes. These class 2 genes include fliA, encoding sigma 28. The FliA sigma factor then activates a third group of genes, class 3, needed for final flagellar assembly, including the flagellar filament protein FlaA or FliC (3, 13). In P. mirabilis, FlaA (FliC) and FlhDC expression is maximal during swarmer cell differentiation and then decreases sharply during consolidation (8, 13, 19).
The role of cell-to-cell signaling in the swarming process is poorly understood. The LuxS-dependent AI-2 signal is produced by P. mirabilis but does not have a role in swarming (24). Recently, a possible role for putrescine as a signaling molecule has been identified (27). Mutations in speA, encoding arginine decarboxylase, or speB, encoding agmatine ureohydrolase, block a major pathway for putrescine production and result in a 2- to 3-h delay in swarmer cell differentiation. The normal timing of swarmer cell differentiation could be restored in speA or speB mutants by a secreted signal, presumably putrescine, from wild-type but not speA mutant cells. In addition, exogenous putrescine at 25 µM could completely restore the normal timing of swarmer cell differentiation in speA mutants (27).
This study reports the characterization of a novel extragenic suppressor mutation generated by mini-Tn5 that increases swarming motility to a putrescine-deficient speA mutant of P. mirabilis. This suppressor results from a null allele in disA, encoding a putative amino acid decarboxylase. Data from this study are consistent with a role for DisA in inhibiting the assembly or activity of the FlhDC master activator in the flagellar regulon of P. mirabilis.
|
|
|---|
pir were used as hosts for transformations and plasmid propagation. Plasmids pKNG101 and pBluescript II.SK were used as cloning vectors. Media for both broth and agar plates consisted of LB (10 g tryptone, 5 g yeast extract, and 5 g NaCl per liter). Agar was used at a concentration of 1.5%. Thirty-milliliter volumes of LB broth cultures were used for conditioned medium preparations. Cells were grown to the designated optical density and harvested by pelleting at 4,300 x g for 10 min. Cell-free supernatants were prepared by adjusting the pH to 7.5 and filter sterilizing with a 0.22-µm filter unit (Nalgene). The first 5 ml was discarded to wash off filter components. Individual cultures for assay of ß-galactosidase were grown in 3 ml of LB and shaken at 250 rpm at 37°C. Assays of ß-galactosidase were carried out with sodium dodecyl sulfate (SDS)-chloroform-permeabilized cells. Swarming assays were carried out either using 82-mm plates with 25 ml of LB agar per plate or in 243- by 243- by 18-mm square plates (Nunc) with 200 ml of agar per plate. Each plate was dried with the top off at 37°C for 30 min before inoculation. Plates were inoculated by the addition of overnight cultures diluted to an optical density at 600 nm (OD600) of 0.3, and the then plates were incubated at 37°C for 12 h. |
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids
|
Construction of a disA null allele in P. mirabilis.
Construction of a disA mutation in P. mirabilis PM7002 and P. mirabilis PM437 speA::mini-Tn5 lacZ was accomplished by homologous recombination between the P. mirabilis chromosome and a small internal segment of disA present in the suicide vector pKNG101 (17). PCR was used to amplify a 391-bp internal segment of the disA gene by use of the primers 5'-GCTCTAGAGCATTGGCGTGTTAGGCTCATC-3' and 5'CGGGATCCCGCCTCTTCTGG GCACAGTTTTG-3'. The PCR product was cloned into XbaI/BamHI-digested pKNG101 by using the restriction sites present within the primers. The resulting plasmid, pKG101.disA, was maintained in E. coli SM10
pir. P. mirabilis PM7002 was mated with E. coli SM10/pKNG101.disA as described above, and exconjugants were selected on tetracycline (15 µg/ml) and streptomycin (35 µg/ml). The insertion of pKNG101 into the disA gene was confirmed by Southern analysis.
Construction of a plasmid overexpressing disA. A 2,164-bp fragment encompassing the disA open reading frame was PCR amplified using the primers 5'-GCTCTAGAGCGAACGAACTTGGAAAATCTTATCTG-3' and 5'-CGGAATTCCGTCTCGAGCTTGATTTTATGTGC-3', which contain XbaI and EcoRI restriction sites. The digested PCR product was ligated into XbaI- and EcoRI-digested pBluescript II SK or pBC.SK (Stratagene).
Analysis of swarmer cell migration and differentiation. Cells were grown at room temperature overnight without shaking in 2 ml LB with antibiotic as needed and diluted to an optical density (A600) of 0.3. Swarming assays were carried out on LB agar (1.5%) containing the appropriate antibiotics. Migration distance measurements were made for strains spotted in five locations each on a 243- by 243- by 18-mm square plate (Nunc). Swarm diameter was measured and recorded at 30-min intervals. Differentiation was analyzed microscopically from scrapings of the outer edge of spots plated in a manner similar to that used for the migration assay.
Northern blot analysis. Transcription of flhDC, fliA, flgM, and flaA throughout the swarmer cell differentiation cycle was assessed by Northern blot analysis of total RNA. RNA was extracted using a MasterPure RNA purification kit (Epicenter, Madison WI) following the standard protocol with the addition of a 20-min DNase treatment. Formamide/formaldehyde-denatured RNA was resolved by electrophoresis through a 1.2% agarose formaldehyde gel and transferred onto nitrocellulose membranes by capillary transfer. Blots were probed with digoxigenin-labeled PCR products using the following primers for the indicated genes: for flaA, 5'-TATCTGGGGTGCCGATAAAC-3' and 5'-ACGGTTTTGAATCGCACCTA-3'; for flhDC, 5'-TCGGACGGGATGTAAAGAGA-3' and 5'-CAGGATTGGCGGAAAGTTTA-3'; for fliA, 5'-TAGCCTCTGGGAGCGATATG-3' and 5'-GCACTGCGCCTATTTCTTTC-3'; and for flgM, 5'-GTATTGAACGCACAAATCCACTT-3' and 5'-CAATTTTGCTGCTGCTCATTGTT-3'.
Construction of an FlhC-His6 fusion protein. An FlhC protein tagged with His6 at the carboxy terminus was generated by PCR using the primers 5'-CGATCGTCTAGAAAGGTATGCTACCTTTTTCAAC-3' and 5'-ACATGTCGACTCAATGATGATGATGATGATGCATTGCAAACTGTTCAAGACC-3'. This generated a PCR product containing the C-terminal two-thirds of the FlhC protein tagged with His6 at the C terminus. This product was cloned via SalI and XbaI sites engineered into the primers into the suicide plasmid pKNG101 (17). This plasmid was introduced into P. mirabilis by conjugation with E. coli SM10 containing this plasmid. Transformants that arose due to a single homologous recombination event were verified by Southern blot analysis for correct insertion into the flhC gene. This created a single-copy flhC-his6 in the native location of the chromosome. A strain containing the corresponding FlhC-His6 hybrid protein exhibited a slight decrease in swarming motility. In a wild-type PM7002 background, we were unable to detect FlhC-His6 by Western blot analysis. Therefore, we integrated the plasmid into a strain that contained a regulatory mutation that increased flhDC expression at least 50-fold. This mutation will be described elsewhere. The FlhC-His6 protein was readily observed in this strain by Western blot analysis, and it was used for further analysis.
Western blot analysis of FlhC-His6. FlhC protein levels were assessed in P. mirabilis SS-P FlhC-His6 strains containing either pBC or pBC.DisA by use of Western blot analysis. Cells were grown overnight with shaking in LB with chloramphenicol (100 µg/ml) and streptomycin (35 µg/ml) at 37°C and then diluted to an OD600 of 1.3. The cell suspensions (250 µl) were spread onto dry LB plates with chloramphenicol (100 µg/ml) to generate synchronously differentiating cell populations. Cells were harvested at 4 h after plating by resuspension in cold LB. For Western blot analysis, bacterial pellets were lysed in Laemmli sample buffer, heated at 95°C for 10 min and subjected to SDS-polyacrylamide gel electrophoresis on 15% Tris-HCl gels. Proteins were electroblotted to nitrocellulose, probed at 1:2,500 with a tetra-His antibody (QIAGEN), and subsequently incubated with a horseradish peroxidase-conjugated anti-mouse antibody (Amersham Biosciences) at 1:10,000. Detection was carried out using ECL Western blotting detection reagents in accordance with standard procedures (Amersham Biosciences).
|
|
|---|
LS1 displayed a swarming phenotype that was enhanced relative to that of the PM437 parent but remained less efficient than that of wild-type PM7002 (Fig. 1). Specifically, initiation of swarming began earlier in LS1, and the migration distance for each swarm cycle was larger than for PM437. Additionally, LS1 exited the first consolidation phase approximately 8 h after plating. In contrast, PM437 had not yet exited the first consolidation phase at the 9.5 h time point (Fig. 1). To confirm that the mini-Tn5Cm insertion in disA was responsible for the above-described phenotypes, a disA null allele was recreated in PM437 speA::mini-Tn5 lacZ1 by a Campbell-type insertion of the suicide vector pKNG101 within the center of the disA coding region. This resulted in strain LS2 speA::mini-Tn5 lacZ1 disA2::Smr. The swarming phenotype of the disA2::Smr allele in strain LS2 was identical to that of the disA1::mini-Tn5Cm insertion in strain LS1, which was identified in the initial screen (data not shown).
![]() View larger version (9K): [in a new window] |
FIG. 1. The disA mutation enhances swarming. Overnight cultures of PM437 speA::mini-Tn5 lacZ1, LS1 speA::mini-Tn5 lacZ1 disA1::mini-Tn5Cm, wild-type PM7002, and LS10 disA3::mini-Tn5 lacZ1 were grown overnight in LB with shaking at 37°C and adjusted to the same optical density, and 5-µl aliquots were spotted on an LB plate. The values shown represent the averages of the swarming diameters for three individual spots of each strain measured at 30-min intervals, with the standard deviations shown as error bars. The disA mutant and the corresponding parental strain were always assayed on the same plate.
|
disA in multiple copies blocks swarming motility. To demonstrate that the loss of disA was responsible for the above-described swarming phenotype, a region containing only the disA open reading frame and ribosome binding site was generated by PCR and cloned into pBluescript II.SK (pSK.DisA). Swarming motility in wild-type PM7002 and in PM437 speA::mini-Tn5 lacZ with either pSK.DisA or vector alone was monitored. The presence of pSK.DisA abolished swarming motility in both PM7002 wild-type and PM437 speA::mini-Tn5 lacZ1 backgrounds (Fig. 2). The defect in swarming motility was not due to a decrease in cell growth, as the growth rates in liquid LB were similar in strains with either pSK or pSK.DisA (data not shown). A complete inhibition of swarming was also observed when the disA gene was cloned in a lower-copy-number plasmid, pACYC184 (data not shown). The overexpression of DisA also completely inhibited swimming migration in 0.3% soft agar, indicating that it acted as a general inhibitor of motility (data not shown).
![]() View larger version (102K): [in a new window] |
FIG. 2. Swarming phenotypes of cells overexpressing DisA. Overnight cultures of PM437/pSK, PM437/pSK.DisA, PM7002/pSK, and PM7002/pSK.DisA were grown to a low optical density in LB containing ampicillin at 150 µg/ml. These cultures were diluted to an OD600 of 0.4 in fresh LB. Three microliters of each culture of PM437/pSK, PM437/pSK.DisA, PM7002/pSK, and PM7002/pSK.DisA were spotted onto a dry LB-plus-ampicillin plate and incubated at 37°C for 12 h.
|
Putrescine production is not altered in disA mutants or DisA-overexpressing strains. The disA mutation was isolated in PM437 speA::mini-Tn5 lacZ1 as a second site suppressor that restored swarming motility. Putrescine production via SpeA/SpeB is required for normal swarmer cell differentiation. However, a speA or speB mutant is still capable of low-level swarming, which is likely due to residual putrescine production via the SpeC-dependent pathway (27). Therefore, we examined whether the stimulation of swarming by the loss of disA or the block in swarming by DisA overexpression was mediated by altered levels of putrescine that were potentially made from the SpeC-dependent alternative pathway (27). The P. mirabilis speA::lacZ fusion is repressed by putrescine and can be used to monitor the levels of extracellular putrescine (27). Conditioned medium was collected from P. mirabilis PM437 speA::mini-Tn5 lacZ1, as well as P. mirabilis LS1 speA::mini-Tn5 lacZ1/disA1::mini-Tn5Cm double mutant, at a density near that of mid-log phase as well as the beginning of stationary phase and assayed using the speA::lacZ fusion. Nearly identical levels of speA::lacZ repression were observed with conditioned medium from either PM437 or LS1 (Fig. 3A). This suggested that extracellular putrescine levels were similar in both strains.
![]() View larger version (13K): [in a new window] |
FIG. 3. Effect of disA mutant and overexpressing strains on extracellular putrescine levels. (A) The expression of ß-galactosidase from PM437 speA::mini-Tn5 lacZ1 in conditioned medium from either PM437, LS1 speA::mini-Tn5 lacZ1 disA1::mini-Tn5Cm, or wild-type PM7002 is shown. (B) Conditioned media were prepared from wild-type PM7002 and PM437 speA::mini-Tn5 lacZ1 with pSK or pSK.DisA and tested for the ability to repress the speA::lacZ fusion. For all experiments, conditioned media were collected from cells at an OD600 of 1.0. The indicator strain, PM437 speA::mini-Tn5 lacZ1, was grown in the conditioned medium to an OD600 of 0.35 and assayed for ß-galactosidase using SDS-chloroform-treated cells. The values represent the averages of duplicate samples from two independent experiments.
|
Loss of disA increases expression of genes in the flagellar regulon.
In enteric bacteria, the FlhD2C2 master regulator activates class 2 genes in response to external stimuli (7). In turn, the class 2 gene fliA, encoding
28 (
F), directs RNA polymerase to transcribe class 3 genes, including the flagellin structural gene (flaA) in P. mirabilis. To investigate the mechanism for the increased swarming in the disA mutant background, the expressions of representative class 1 (flhDC), class 2 (fliA, flgM), and class 3 (flaA) genes were examined by Northern blot analysis in wild-type PM7002 and in LS10 disA::mini-Tn5 lacZ (Fig. 4). Since the loss of disA acted to increase swarming in both speA mutant and wild-type backgrounds, it appears to act in a general manner to increase swarming. Based on this observation, the effects of disA in a wild-type background were examined.
![]() View larger version (76K): [in a new window] |
FIG. 4. Effect of the disA mutation on expression of genes in the flagellar regulon. Overnight cultures of PM7002 and LS10 disA::mini-Tn5 lacZ1 were adjusted to the same optical density, and 200-µl aliquots were spread on LB agar plates to generate synchronously differentiating cultures. Cells were harvested off of the plates at hourly intervals. RNA was prepared and used for Northern blot analysis with PCR-generated probes corresponding to the flhDC, fliA, flgM, and flaA genes (see Materials and Methods).
|
In contrast, the effects of the disA mutation on two class 2 genes, fliA and flgM, were significantly more pronounced beginning at T2 and continuing into T6 (Fig. 4). For the class 3 flaA gene, encoding flagellin, the disA mutation also resulted in a large increase in mRNA accumulation. To more accurately quantitate this increase, twofold serial dilutions of the disA samples at time points T4 to T6 were compared to the undiluted wild-type sample and examined by Northern blot analysis. This comparison indicated that the disA mutation increased flaA mRNA accumulation 16-fold at T4 and at least 32-fold at T5 and T6.
DisA overexpression blocks expression of class 2 and class 3 genes in the flagellar regulon. The overexpression of disA on a high-copy-number plasmid was shown to completely inhibit swarmer cell differentiation (Fig. 2). To determine whether this inhibition was mediated via the flagellar regulon, the expression of flhDC, fliA, and flaA was examined by Northern blot analysis with wild-type PM7002 containing the vector control pBluescript.SK and in PM7002/pSK.DisA. DisA overexpression did not significantly decrease flhDC mRNA accumulation at any point during the swarming cycle (Fig. 5). However, for fliA (class 2) and flaA (class 3), the overexpression of disA completely inhibited expression based on mRNA accumulation (Fig. 5).
![]() View larger version (95K): [in a new window] |
FIG. 5. Effect of DisA overexpression on the flagellar regulon. Strains PM7002/pSK and PM7002/pSK.DisA were spread on LB agar plates containing ampicillin, and cells were harvested at hourly intervals. RNA was prepared and probed with PCR-generated fragments corresponding to flhDC, fliA, and flaA. For all blots, the same preparation of RNA was used, allowing for a direct comparison of different transcripts during the swarming cycle. The bottom panel shows an ethidium bromide-stained gel containing the same amount of RNA used in each Northern blot.
|
![]() View larger version (38K): [in a new window] |
FIG. 6. DisA overexpression does not alter the levels of FlhC protein. Strain SS-P expresses an FlhC-His6 fusion protein from a single copy at the native flhDC locus (see Materials and Methods). Synchronously differentiating cells of SS-P/pBC.SK and SS-P/pBC.DisA were harvested at T4, and total cell protein was separated on 15% SDS-polyacrylamide gel electrophoresis gels. Western blot analysis was carried out as described in the Materials and Methods using a penta-His antibody (QIAGEN). Lanes: 1, affinity-purified FlhC-His6 protein; 2, SS-P FlhC-His6/pBC.SK; 3, SS-P FlhC-His6/pBC.DisA; 4, PM7002 wild-type FlhC-His6.
|
The expression of the lon::lacZ fusion in P. mirabilis was not significantly altered by DisA overexpression at various time points during swarming. At T2, ß-galactosidase expression from the lon-lacZ fusion was 559 ± 62 units in cells with the vector pBC and 715 ± 240 units in cells with pBC.DisA. At T4, ß-galactosidase expression from the lon-lacZ fusion was 681 ± 67 units in cells with the vector pBC and 742 ± 109 units in cells with pBC.DisA. At T6, ß-galactosidase expression from the lon-lacZ fusion was 651 ± 75 units in cells with the vector pBC and 660 ± 41 units in cells with pBC.DisA.
Swarming motility of the P. mirabilis lon mutant was completely blocked when DisA was overexpressed (data not shown). Therefore, the ability of DisA overexpression to inhibit swarming appears to be independent of the Lon protease.
Phenethylamine inhibits swarming and decreases expression of class 2 and class 3 genes. The similarity of DisA to amino acid decarboxylases suggested two possible mechanisms for the inhibition of swarming and the decreased expression of class 2 and class 3 genes in the flagellar cascade upon DisA overexpression. The first possibility is that the overexpression of DisA depleted one or more amino acids that were required for expression of class 2 and class 3 genes. If this were the case, then supplementation of agar with high concentrations of amino acids may increase the intracellular concentration and increase swarming in a DisA-overexpressing strain. However, when all 20 amino acids were tested at concentrations up to 100 mM, there was no rescue of swarming, even when DisA was present on a medium-copy-number plasmid, pACYC184. The second possibility was that the inhibition of swarming in the DisA-overexpressing strain was due to increased intracellular concentrations of the DisA product, i.e., a decarboxylated amino acid. Commercially available decarboxylated amino acids were incorporated into agar plates at concentrations ranging from 0.5 to 30 mM, and the ability of each compound to mimic DisA overexpression and inhibit swarming was assessed. The decarboxylated amino acids tested were as follows (with the parent amino acids in parentheses for reference): tyramine (tyrosine), phenethylamine (phenylalanine), histamine (histidine), gamma-amino butyric acid (glutamic acid), agmatine (arginine), and cadaverine (lysine). The only decarboxylated amino acids that were able to inhibit swarming were tryamine and phenethylamine. For tyramine, a very high concentration (40 mM) was required for a complete inhibition of swarming, and examination of the levels of class 1 (flhDC), class 2 (fliA), and class 3 (flaA) genes by Northern blot analysis indicated that tyramine had no effect on the expression of these genes (data not shown). Therefore, the effect of tyramine on swarming was likely indirect and not mediated by altering flagellar gene expression. In contrast, 1 mM phenethylamine resulted in a 50% inhibition of swarming, and 4 mM phenethylamine completely inhibited swarming (Fig. 7A).
![]() View larger version (70K): [in a new window] |
FIG. 7. Effect of phenethylamine on swarming motility and expression of genes in the flagellar regulon. (A) Phenethylamine was added to 2x LB broth to give concentrations of 1 mM, 2 mM, 4 mM, and 8 mM. Solutions were adjusted to pH 7.0 and sterilized through a 0.22-µm syringe filter. The LB-phenethylamine solution was added in a 1:1 ratio to a sterile 2x agar solution (3%) prior to the plates being poured, resulting in phenethylamine concentrations of 0.5 mM, 1 mM, 2 mM, and 4 mM and a final agar concentration of 1.5%. A culture of P. mirabilis PM7002 was grown to an OD600 of 0.5, and 3 µl was spotted onto dried plates with either LB or LB containing phenethylamine. Plates were incubated for 12 h at 37°C. The swarm front is indicated by an arrowhead. (B) For mRNA analysis of flagellar genes, synchronously differentiating cells of PM7002 were grown on LB or LB containing 4 mM phenethylamine, and cells were harvested at T3. Northern blot analyses of flhDC (class 1), fliA (class 2), and flaA (class 3) genes were done using PCR-generated probes.
|
Expression of disA during the swarming cycle. We initially attempted to monitor disA expression by Northern blot analysis, but we were unable to detect disA mRNA by this method. Therefore, the expression of disA was examined in strain LS10 containing a single-copy disA::lacZ fusion that was isolated by the insertion of mini-Tn5 lacZ1. Synchronously differentiating cells were harvested off of LB agar plates at hourly intervals and assayed for ß-galactosidase activity. The expression of disA::lacZ increased threefold at approximately 3 hours after plating (Fig. 8). At time point T3, swarmer cells were present.
![]() View larger version (7K): [in a new window] |
FIG. 8. Expression of disA during swarming. An overnight culture of P. mirabilis LS10 disA::mini-Tn5 lacZ1 was spread onto the surface of agar plates to generate synchronously differentiating cells. At hourly intervals, cells were harvested off of plates, and the expression of the disA::lacZ fusion was monitored by ß-galactosidase activity (Miller units [MU]). The reported values represent one experiment. In repeated experiments (n = 3), similar induction values were observed each time.
|
|
|
|---|
28) and the class 3 gene (flaA), a disA mutation increased mRNA accumulation at least 10-fold during swarmer cell differentiation, and DisA overexpression completely blocked both fliA and flaA mRNA accumulation (Fig. 5). Although modest increases in flhDC expression can result in amplified increases in class 2/class 3 gene expression (2), it is still difficult to reconcile a 1.4-fold increase in flhDC expression with the drastic increase in class 2/class 3 gene expression. In addition, in class 2 flhA mutants, where flagellin export is blocked, there are 10-fold-lower levels of flhDC mRNA (13). This indicates the presence of a feedback mechanism to positively influence flhDC mRNA levels. In disA mutant cells, the higher levels of class 2 and class 3 gene expression may contribute to the slight increase in flhDC mRNA by this unidentified feedback mechanism. A recent study detailing a microarray analysis of pH-regulated genes in E. coli revealed that genes involved in flagellar synthesis and motility were repressed at high pH (20). However, the flhD and flhC genes were not repressed by high pH in this study. The target of this pH-mediated decrease in motility is unknown. By analogy to this study, the activity of DisA as a decarboxylase has the potential to increase the external or internal pH by the production of a basic amine, if the primary substrate for DisA is an amino acid with a basic side chain. However, the pH values for cultures in mid-log phase and stationary phase at identical optical densities were the same for wild-type and disA mutant strains (data not shown). In addition, when cells with pSK.DisA and those containing only pSK vector were grown to the same density, the pH values for the media were the same. This suggests that external pH changes are not responsible for altered swarming. Furthermore, the addition of acetate, a permeant acid, to plates did not restore swarming to disA-overexpressing strains when used at a variety of concentrations.
How does DisA act to inhibit swarming? First, based on the results shown in Fig. 3, it is unlikely that DisA acts by inhibiting the putrescine-dependent pathway for swarmer cell differentiation (Fig. 3) (27). This is further supported by the fact that, in contrast to disA mutants, flagellin expression is not altered in putrescine-defective speB mutants (unpublished results). Therefore, based on the similarity of DisA to amino acid decarboxylases, two possibilities may be considered: the substrate of DisA acts as a positive effector of swarming by increasing the expression of class 2 and class 3 genes in the flagellar cascade, or the product of the DisA reaction, possibly a decarboxylated amino acid, is an inhibitor of class 2/class 3 gene expression and swarming. Taking the first possibility into account, in a disA mutant, the amino acid substrate would accumulate and activate class 2 gene expression. In DisA-overexpressing strains, the substrate would be depleted and reduce expression of class 2/class 3 genes. However, we were unable to demonstrate that amino acids at concentrations up to 100 mM could restore swarming to a strain overexpressing DisA (data not shown). With respect to the second possibility, since DisA exhibited similarity to amino acid decarboxylases, we tested a panel of commercially available decarboxylated amino acids for effects that mimicked DisA overexpression. Only phenethylamine, the product of phenylalanine decarboxylation, could reduce expression of class 2/class 3 genes (fliA and flaA) and inhibit swarming (Fig. 7). The effect of phenethylamine on decreasing the accumulation of mRNA corresponding to fliA and flaA was not as strong as that when DisA was overexpressed. There are two possible explanations for this: (i) the levels of DisA expression are very high when present on a plasmid, leading to artificially high intracellular concentrations of phenethylamine (or another decarboxylated product) and the uptake of exogenous phenethylamine in wild-type cells is not sufficiently high to reach the same intracellular concentration, or (ii) phenethylamine may not be the true product of the DisA reaction, but is similar enough to exert a strong but incomplete inhibition of class 2/class 3 gene expression. However, the ability of phenethylamine to mimic DisA overexpression is intriguing, since DisA is most homologous to tyrosine and phenylalanine decarboxylases.
Since DisA acts downstream of flhDC mRNA accumulation but upstream of fliA transcription, the most likely target(s) of the DisA inhibition is the FlhD and/or FlhC protein. We hypothesize that the decarboxylated product of the DisA reaction (possibly phenethylamine) acts either by inhibiting the interaction or assembly required for FlhD2C2 heterotetramer formation or by inhibiting the DNA binding ability of the FlhD2C2 heterotetramer (Fig. 9). With respect to the first possibility, a recent study has demonstrated that the DnaK chaperone is required for the formation of active FlhD2C2 complexes in Salmonella (28). If a similar requirement for DnaK exists in P. mirabilis, the DisA decarboxylation product may block the formation of functional FlhD2C2 complexes by interfering with DnaK function. It should be noted that all of the possibilities in this model are highly speculative, and, to our knowledge, there are no examples of small molecules that regulate FlhD2C2 stability or interaction with DNA.
![]() View larger version (7K): [in a new window] |
FIG. 9. Possible mechanisms for the DisA-mediated inhibition of class 2 and class 3 gene expression in the flagellar regulon. A model for the posttranscriptional regulation of FlhD/FlhC activity is presented. The DisA product is hypothesized to inhibit FlhD2C2 heterotetramer formation, possibly via DnaK. Alternatively, DisA may inhibit the ability of FlhD2C2 to bind DNA.
|
What is the physiological role of DisA in P. mirabilis? Expression of a chromosomal disA::lacZ fusion is activated at T3, a time point when swarmer cells begin to be present. The activation of DisA at this time point may seem counterproductive, since DisA acts as a negative regulator of flagellin expression and swarmer cell differentiation. However, swarmer cell differentiation is a transient process, and this state is maintained for only 1 to 2 h before cells dedifferentiate back to vegetative cells. At T3, when DisA expression is maximal, the process of differentiation has already begun and the levels of flagellin expression have already increased 20- to 30-fold above the levels in vegetative cells. In addition, the FlhDC-dependent genes that are likely required for swarmer cell differentiation have already been activated. Therefore, the program of gene expression required for differentiation is well under way at T3 when DisA becomes activated. The increased expression of DisA may serve as a mechanism to dampen expression of flagellin and genes required for swarmer cell differentiation, possibly to prepare cells for dedifferentiation. DisA may not be the only mechanism that decreases class 2/class 3 gene expression at this time, and additional components may have a role as cells prepare to dedifferentiate. It is important to note that the complete block in class 2/class 3 gene expression in cells containing pSK.DisA (Fig. 5) is likely due to the extremely high levels of DisA expression that occur when disA is on a high-copy-number plasmid. In summary, DisA may not be the only gene product involved in the down-regulation of class 2/class 3 genes as swarmer cells prepare to dedifferentiate back to vegetative cells, but the effects of the disA mutation support an important role in this process.
We are grateful to Katy Clemmer for conducting some of the ß-galactosidase assays used in this study.
Published ahead of print on 15 September 2006. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»