This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García-Quintanilla, M.
Right arrow Articles by Casadesús, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García-Quintanilla, M.
Right arrow Articles by Casadesús, J.

 Previous Article  |  Next Article 

Journal of Bacteriology, November 2006, p. 7963-7965, Vol. 188, No. 22
0021-9193/06/$08.00+0     doi:10.1128/JB.00995-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Bile-Induced Curing of the Virulence Plasmid in Salmonella enterica Serovar Typhimurium{triangledown}

Meritxell García-Quintanilla, Ana I. Prieto, Laurent Barnes, Francisco Ramos-Morales, and Josep Casadesús*

Departamento de Genética, Facultad de Biología, Universidad de Sevilla, Apartado 1095, Seville 41080, Spain

Received 7 July 2006/ Accepted 28 August 2006


arrow
ABSTRACT
 
Exposure to bile induces curing of the virulence plasmid in Salmonella enterica serovar Typhimurium (pSLT). Disruption of the ccdB gene increases pSLT curing, both spontaneous and induced by bile, suggesting that the pSLT ccdAB genes may encode a homolog of the CcdAB addiction module previously described in the F sex factor. Unlike the F sex factor, synthesis of pSLT-encoded pili does not confer bile sensitivity. These observations may provide insights into the evolution of virulence plasmids in Salmonella subspecies I, as well as the causes of virulence plasmid loss in other Salmonella subspecies.


arrow
TEXT
 
Certain Salmonella serovars belonging to subspecies I carry a large plasmid of 50 to 90 kb (19). All Salmonella virulence plasmids share a 7. 8-kb region, spv, required for bacterial proliferation in the reticuloendothelial system (10). Other loci of the plasmid, such as the fimbrial operon pef, the conjugal transfer gene traT, and the rck and rsk genes may play roles in other stages of the infection process (19). The virulence plasmid of Salmonella enterica serovar Typhimurium (henceforth, pSLT) is self-transmissible (1); virulence plasmids from other serovars, such as Salmonella enterica serovars Enteritidis and Choleraesuis, carry incomplete tra operons (19). The presence of virulence plasmids in host-adapted serovars has suggested that virulence plasmid acquisition may have expanded the host range of Salmonella. However, Salmonella subspecies II, IIIa, IV, and VII do not contain a virulence plasmid and carry the spv region on the chromosome (4).

During animal infection, Salmonella is exposed to bile salts, which have at least two distinct antibacterial activities, as detergents that disrupt the cell envelope (11) and as DNA-damaging agents that cause DNA rearrangements and point mutations (17). Current evidence suggests that the primary DNA lesions caused by bile salts may involve oxidative damage (18). The bile concentrations encountered by Salmonella during the intestinal stage of infection are low and changing (13). However, systemic infection leads to colonization of the hepatobiliary tract, where the concentration of bile is high and steady (13). Furthermore, Salmonella can cause chronic infections: for instance, about 3% of humans surviving typhoid fever are chronic, asymptomatic carriers of S. enterica serovar Typhi (14), which usually resides in the gall bladder (9). Salmonella survival in the presence of bile salts requires a variety of defense functions, including envelope barriers and efflux pumps (11), as well as DNA repair functions able to cope with bile-induced DNA injuries (18).

Because DNA lesions can impair DNA replication, many DNA-damaging agents cause plasmid curing (24). Furthermore, the repertoire of DNA repair functions required for bile resistance suggests that bile salts may impair DNA replication in S. enterica (18). On these grounds, we considered the possibility that exposure of Salmonella to bile could cure the virulence plasmid. Below we show that bile is a curing agent indeed. We also show that the ccdB gene plays a role in virulence plasmid stability. Finally, we describe an unsuspected difference between pSLT and the F sex factor: while synthesis of F pili greatly increases sensitivity to bile salts (3), derepression of the pSLT tra operon does not cause bile sensitivity.

Exposure to bile causes virulence plasmid curing. Despite its low copy number (6), spontaneous loss of pSLT has not been reported in the literature, indicating that the plasmid is highly stable in Salmonella populations. To detect pSLT curing, we designed a positive selection strategy based on selecting tetracycline-sensitive derivatives of a tetracycline-resistant strain (15) (Table 1). For this purpose, a Tn10 insertion (allele zzv-6315::Tn10dTc) was introduced in pSLT, permitting the selection of Tcs derivatives on Bochner-Maloy plates (15). To distinguish plasmid curing from other events causing tetracycline sensitivity (e.g., point mutations and deletions), a kanamycin resistance marker was also introduced in pSLT. The resulting virulence plasmid was thus tagged with two resistance markers, Tcr and Kmr, both located in the spv region and separated by 7 kb, approximately (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Genotypes of the bacterial strains used in this study

To obtain pSLT-cured derivatives, aliquots of saturated LB-grown cultures of strain LT2 were spread on Bochner-Maloy plates. Tcs colonies were then replica printed to LB plates supplemented with kanamycin. Plasmid curing frequency was calculated as the ratio between the number of Kms Tcs isolates and the number of bacterial cells plated (determined by plate counts on LB agar). Most, if not all, Kms Tcs isolates obtained by this procedure were plasmidless, as indicated by their inability to receive a third, unlinked plasmid marker, samA::Cmr: 19 of 19 independent Kms Tcs derivatives gave no Cmr transductants when tested for receipt of samA::Cmr by P22 HT-mediated transduction (20).

Spontaneous curing of the virulence plasmid occurred at frequencies below 10–6 (Fig. 1). The effect of bile on virulence plasmid curing was tested by growing S. enterica in liquid LB containing different concentrations of ox bile extract. Aliquots from saturated cultures grown in LB-bile were spread on Bochner-Maloy plates, and Tcs colonies were replica printed, as described above, to LB-kanamycin. Exposure to bile increased the frequency of Kms Tcs isolates in a dose-dependent fashion (Fig. 1), providing evidence that bile is a plasmid-curing agent.


Figure 1
View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1. Frequencies of curing of the Salmonella virulence plasmid in a Ccd+ strain (white histograms) and in a Ccd mutant (dark histograms). The strains used were the isogenic pair SV4492 (Ccd+) and SV4987 (Ccd). Ox bile extract (sodium choleate) was purchased from Sigma Chemical Co., St. Louis, MO, and used as described elsewhere (17). Data for the Ccd+ strain are averages of four independent experiments. Data for the Ccd strain are averages of six independent experiments. Bars represent standard errors.

Effect of ccdB disruption on virulence plasmid stability. The Salmonella virulence plasmid belongs to the F-like family, and contains DNA regions homologous to the F sex factor (19). One such region is ccdAB, which in F encodes an addiction module involved in plasmid stability (8). To investigate whether the ccdAB region of pSLT encoded a functional addiction module, a Ccd mutant of S. enterica was constructed by gene targeting. The gene chosen for disruption was ccdB, which in F encodes the toxin of the addiction module (2). Disruption of ccdB was achieved by the procedure of Datsenko and Wanner (7), using the oligonucleotides 5' CGGATCGTTTGCTGACGACAACAGGAACTGGTGATATGCAGTGTAGGCTGGAGCTGCTTC 3' and 5' CTGTTCGCTGACACGCATATCAGATCCCCCGGAACATCAGCATATGAATATCCTCCTTAG 3'. Two additional, external PCR primers were used to verify the predicted deletion: 5' TGAGGTGGCCAGCTTTATAG 3' and 5' CAGAAACTCCGCACACAGCC 3'. Primer design was based on the published genome sequence of the LT2 strain (16).

Trials of curing in a CcdB pSLT plasmid were carried out as described above. The spontaneous frequency of pSLT curing increased 1 order of magnitude in a Ccd background (Fig. 1), indicating that the ccdAB genes may encode a functional addiction module that contributes to pSLT stability. Curing of the CcdB plasmid was strongly affected by bile and reached frequencies around or above 10–4 (3 orders of magnitude higher than the spontaneous frequency of curing in wild-type pSLT) in the presence of 15% ox bile extract (Fig. 1).

Virulence plasmid functions do not affect bile resistance. To investigate whether the presence of the virulence plasmid affected S. enterica survival in the presence of bile, we compared the MICs of sodium deoxycholate (DOC) in the wild type and in a pSLT-cured derivative. Aliquots from exponential cultures in LB broth, each containing around 3 x 102 colony-forming units, were transferred to polypropylene microtiter plates containing known amounts of DOC. After 12 h of incubation at 37°C, growth was visually monitored. As a control, a DNA adenine methylase (Dam) mutant was included in these experiments; S. enterica Dam mutants are extremely sensitive to bile salts (17). Data shown in Table 2 indicate that curing of the virulence plasmid does not alter sensitivity of S. enterica to DOC. However, this observation left open the possibility that virulence plasmid functions which are usually repressed might alter bile sensitivity upon derepression. In fact, the tra operon of the F episome is known to sensitize Escherichia coli to bile salts (3). In F, bile salt sensitivity is caused by the tra-encoded type IV secretion system and requires an active F pilus assembly pathway (3). Unlike F, the tra operon of the Salmonella virulence plasmid is tightly repressed by the FinOP system (5, 21); hence, we considered the possibility that derepression of tra might confer bile sensitivity to S. enterica. Actually, tra operon derepression has been shown to cause bile sensitivity in another F relative, plasmid R100 (3). However, an S. enterica strain carrying a tra operon derepressed by a finO mutation did not show increased sensitivity to sodium deoxycholate (Table 2). In turn, a traB mutation, which prevents synthesis of pili, did not alter the MIC of DOC. A complementary observation was that neither a finO mutation nor a traB mutation had any effect on pSLT curing (Fig. 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. MIC of sodium deoxycholate in strain LT2 and mutant derivativesa


Figure 2
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 2. Frequencies of curing of the Salmonella virulence plasmid in strains with different levels of tra operon expression. To increase the sensitivity of the assay, killing of plasmid-cured cells by CcdAB was avoided using a Ccd background. White histograms show spontaneous curing frequencies; dark histograms show curing frequencies in the presence of 15% ox bile extract. The strains used were the isogenic trio SV4987 (CcdB), SV5226 (CcdB FinO), and SV5228 (CcdB TraB). Data are averages of six independent experiments. Bars indicate standard errors.

Potential roles of bile in the evolution of salmonellae. A study on the distribution of spv genes among Salmonella subspecies considered that virulence plasmid instability might have favored spv translocation to the chromosome (and concomitant virulence plasmid loss) during the evolution of subspecies II, IIIa, IV, and VII (4). In this study, we suggest that bile could be a factor contributing to virulence plasmid instability in the ancestors of these subspecies. Bile concentrations of 15%, which induce significant rates of virulence plasmid curing under laboratory conditions, are commonly found in the gall bladder of humans and other mammals (13). Hence, bile can be predicted to impair the stability of the virulence plasmid in natural populations of Salmonella during systemic and chronic infections. Because bile can also induce DNA rearrangements (17), an attractive hypothesis is that both spv translocation and virulence plasmid loss could be caused by bile.

An additional, intriguing observation was that, unlike F and other F-like plasmids (3), synthesis of pSLT-encoded pili does not sensitize the host cell to bile salts. It is also noteworthy that certain pSLT-encoded Tra proteins show high divergence from their F counterparts, despite the overall conservation of tra operon organization and regulation in both plasmids. For instance, amino acid identities are only 68% for TraV, 33% for TraP, 29% for TraY, and 14% for TraS (data not shown). These observations may provide evidence that the type IV secretion apparatus encoded on the virulence plasmid has become bile resistant during the evolution of Salmonella subspecies I.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grant BIO2004-3455-CO2-02 from the Spanish Ministry of Education and Science and the European Regional Fund. M.G.Q. was the recipient of an F.P.U. fellowship from the Spanish Ministry of Education. L.B. was the recipient of a visiting student fellowship from the Université Henri Poincaré, Nancy, France.

We are grateful to Gabriel Gutiérrez for advice and discussions.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Departamento de Genética, Facultad de Biología, Universidad de Sevilla, Apartado 1095, E-41080 Seville, Spain. Phone: 34 95 455 7105. Fax: 34 95 455 7104. E-mail: casadesus{at}us.es. Back

{triangledown} Published ahead of print on 8 September 2006. Back


arrow
REFERENCES
 
    1
  1. Ahmer, B. M. M., M. Tran, and F. Heffron. 1999. The virulence plasmid of Salmonella typhimurium is self-transmissible. J. Bacteriol. 181:1364-1368.[Abstract/Free Full Text]
  2. 2
  3. Bahassi, E. M., M. A. Salmon, L. Van Melderen, P. Bernard, and M. Couturier. 1995. F plasmid CcdB killer protein: ccdB gene mutants coding for non-cytotoxic proteins which retain their regulatory functions. Mol. Microbiol. 15:1031-1037.[Medline]
  4. 3
  5. Bidlack, J. E., and P. M. Silverman. 2004. An active type IV secretion system encoded by the F plasmid sensitizes Escherichia coli to bile salts. J. Bacteriol. 186:5202-5209.[Abstract/Free Full Text]
  6. 4
  7. Boyd, E. F., and D. L. Hartl. 1998. Salmonella virulence plasmid: modular acquisition of the spv virulence region by a plasmid in Salmonella enterica subspecies I and insertion into the chromosome of subspecies II, IIA, IV and VII isolates. Genetics 149:1183-1190.[Abstract/Free Full Text]
  8. 5
  9. Camacho, E. M., and J. Casadesús. 2002. Conjugal transfer of the virulence plasmid of Salmonella enterica is regulated by the leucine-responsive regulatory protein and DNA adenine methylation. Mol. Microbiol. 44:1589-1598.[CrossRef][Medline]
  10. 6
  11. Camacho, E. M., A. Serna, C. Madrid, S. Marqués, R. Fernández, F. de la Cruz, A. Juárez, and J. Casadesús. 2005. Regulation of finP transcription by DNA adenine methylation in the virulence plasmid of Salmonella enterica. J. Bacteriol. 187:5691-5699.[Abstract/Free Full Text]
  12. 7
  13. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 90:6640-6645.
  14. 8
  15. Engelberg-Kulka, H., and G. Glaser. 1999. Addiction modules and programmed cell death and antideath in bacterial cultures. Annu. Rev. Microbiol. 53:43-70.[CrossRef][Medline]
  16. 9
  17. Gilman, R. H., S. Islam, H. Rabbani, and H. Ghosh. 1979. Identification of gallbladder typhoid carriers by a string device. Lancet 14:795-796.[CrossRef]
  18. 10
  19. Gulig, P. A., A. L. Caldwell, and V. A. Chiodo. 1992. Identification, genetic analysis and DNA sequence of a 7. 8-kb virulence region of the Salmonella typhimurium virulence plasmid. Mol. Microbiol. 6:1395-1411.[Medline]
  20. 11
  21. Gunn, J. S. 2000. Mechanisms of bacterial resistance and response to bile. Microbes Infect. 2:907-913.[CrossRef][Medline]
  22. 12
  23. Hensel, M., J. E. Shea, C. Gleeson, M. D. Jones, E. Dalton, and D. W. Holden. 1995. Simultaneous identification of bacterial virulence genes by negative selection. Science 269:400-403.[Abstract/Free Full Text]
  24. 13
  25. Hofmann, A. F. 1998. Bile secretion and enterohepatic circulation of bile acids, p. 937-948. In M. Feldman, B. F. Scharschmidt, and W. B. Sleisenger (ed.), Sleisenger and Fordtran's gastrointestinal disease, 6th ed. W. B. Saunders & Co., Philadelphia, Pa.
  26. 14
  27. Losonsky, G. A., C. Ferreccio, K. L. Kotloff, S. Kaintuck, J. B. Robbins, and M. M. Levine. 1987. Development and evaluation of an enzyme-linked immunosorbent assay for serum Vi antibodies for detection of chronic Salmonella typhi carriers. J. Clin. Microbiol. 25:2266-2269.[Abstract/Free Full Text]
  28. 15
  29. Maloy, S. R., V. J. Stewart, and R. K. Taylor. 1996. Genetic analysis of pathogenic bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  30. 16
  31. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856.[CrossRef][Medline]
  32. 17
  33. Prieto, A. I., F. Ramos-Morales, and J. Casadesús. 2004 Bile-induced DNA damage in Salmonella enterica. Genetics 168:1787-1794.[Abstract/Free Full Text]
  34. 18
  35. Prieto, A. I., F. Ramos-Morales, and J. Casadesús. 3 August 2006, posting date. Repair of DNA damage induced by bile salts in Salmonella enterica. Genetics [Online.] doi:10.1534/genetics.106.060889.[Abstract/Free Full Text]
  36. 19
  37. Rotger, R., and J. Casadesús. 1999. The virulence plasmids of Salmonella. Int. Microbiol. 2:177-184.[Medline]
  38. 20
  39. Schmieger, H. 1972. Phage P22 mutants with increased or decreased transducing abilities. Mol. Gen. Genet. 119:75-88.[CrossRef][Medline]
  40. 21
  41. Smith, H. R., G. O. Humphreys, N. D. F. Grindley, J. D. Grindley, and E. S. Anderson. 1973. Molecular studies of a fi+ plasmid from strains of Salmonella typhimurium LT2. Mol. Gen. Genet. 123:1443-1451.
  42. 22
  43. Torreblanca, J., and J. Casadesús. 1996. DNA adenine methylase mutants of Salmonella typhimurium and a novel Dam-regulated locus. Genetics 144:15-26.[Abstract]
  44. 23
  45. Torreblanca, J., S. Marques, and J. Casadesús. 1999. Synthesis of FinP RNA by plasmids F and pSLT is regulated by DNA adenine methylation. Genetics 152:31-45.[Abstract/Free Full Text]
  46. 24
  47. Willetts, N. S. 1967. The elimination of Flac+ from Escherichia coli by mutagenic agents. Biochem. Biophys. Res. Commun. 27:112-117.[CrossRef][Medline]


Journal of Bacteriology, November 2006, p. 7963-7965, Vol. 188, No. 22
0021-9193/06/$08.00+0     doi:10.1128/JB.00995-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Garcia-Quintanilla, M., Ramos-Morales, F., Casadesus, J. (2008). Conjugal Transfer of the Salmonella enterica Virulence Plasmid in the Mouse Intestine. J. Bacteriol. 190: 1922-1927 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García-Quintanilla, M.
Right arrow Articles by Casadesús, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García-Quintanilla, M.
Right arrow Articles by Casadesús, J.