This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, A. P.
Right arrow Articles by Surette, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, A. P.
Right arrow Articles by Surette, M. G.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2006, p. 8395-8406, Vol. 188, No. 24
0021-9193/06/$08.00+0     doi:10.1128/JB.00798-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Comparative Genetics of the rdar Morphotype in Salmonella{triangledown}

A. P. White1 and M. G. Surette1,2*

Department of Microbiology and Infectious Diseases,1 Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta T2N 4N1, Canada2

Received 4 June 2006/ Accepted 24 September 2006


arrow
ABSTRACT
 
The Salmonella rdar morphotype is a distinct, rough and dry colony morphology formed by the extracellular interaction of thin aggregative fimbriae (Tafi or curli), cellulose, and other polysaccharides. Cells in rdar colonies are more resistant to desiccation and exogenous stresses, which is hypothesized to aid in the passage of pathogenic Salmonella spp. between hosts. Here we analyzed the genetic and phenotypic conservation of the rdar morphotype throughout the entire Salmonella genus. The rdar morphotype was conserved in 90% of 80 isolates representing all 7 Salmonella groups; however, the frequency was only 31% in a reference set of 16 strains (Salmonella reference collection C [SARC]). Comparative gene expression analysis was used to separate cis- and trans-acting effects on promoter activity for the 16 SARC strains, focusing on the 780-bp intergenic region containing divergent promoters for the master regulator of the rdar morphotype (agfD) and the Tafi structural genes (agfB). Surprisingly, promoter functionality was conserved in most isolates, and loss of the phenotype was due primarily to defects in trans-acting regulatory factors. We hypothesize that trans differences have been caused by domestication, whereas cis differences, detected for Salmonella enterica subsp. arizonae isolates, may reflect an evolutionary change in lifestyle. Our results demonstrate that the rdar morphotype is conserved throughout the salmonellae, but they also emphasize that regulation is an important source of variability among isolates.


arrow
INTRODUCTION
 
Numerous bacterial species produce fimbriae, extracellular protein polymers that contribute to adherence to both biotic (host) and abiotic surfaces. For pathogenic Salmonella spp., genome sequencing efforts have identified over 15 distinct fimbrial types (Salmonella enterica serovars Typhimurium [42], Typhi [44], and Paratyphi [41]). Pioneering work by Baumler et al. (5) and subsequent genomic comparisons (14, 45, 61) revealed that most fimbrial operons have a scattered distribution throughout the salmonellae. Early hypotheses that fimbriae were involved in adherence to host cells suggested that numerous fimbrial types would contribute to the host specificities and tissue tropisms of different Salmonella spp. However, despite much research, the role of fimbriae in the pathogenesis of Salmonella is still not well understood. In addition, no clear links have been made connecting one fimbrial type to a particular animal host or disease process (61).

Thin aggregative fimbriae (Tafi or curli) are an exception to the general trend among Salmonella fimbriae. The divergent agfDEFG/BAC (csgDEFG/BAC) operons coding for Tafi biosynthesis have been detected in almost all Salmonella isolates tested to date (5, 18). Virtually identical operons have also been identified in Escherichia coli and other enterobacterial species (8, 49, 69). In Salmonella, Tafi are produced together with cellulose (70), capsular and extracellular polysaccharides (17, 26, 67), and BapA (38), all of which come together to form a recalcitrant extracellular matrix that links individual cells together. Extracellular matrix production is associated with multicellular properties of Salmonella, both in the formation of the rdar morphotype (16, 52) and in the formation of pellicles at the air-liquid interface in standing culture (51, 56). These phenotypes enhance the resistance of Salmonella to antimicrobial stresses (2, 55) and contribute to long-term survival (68).

The regulatory pathways controlling extracellular matrix production in Salmonella are outlined in Fig. 1. Primary control takes place within the large intergenic region between the master regulator, agfD, and the Tafi structural genes, agfBAC. Transcription of agfD is dependent upon the stationary-phase-inducible sigma factor RpoS, and is maximal in the late exponential or early stationary phase of growth (25, 52, 68). Crl acts as a cofactor in this process by stimulating the binding of the RpoS-RNA polymerase complex to agf promoter regions (9, 48). trans-acting regulatory proteins required for agfD transcription include OmpR and MlrA. The arrangement of OmpR binding sites in the agfD promoter region is similar to that in the well-characterized ompF promoter (33), with a high-affinity binding site for activation under conditions of low osmolarity and low-affinity binding sites that shut off transcription at higher osmolarity (23). The mechanism for MlrA activation of agfD transcription is unknown, and no binding sites have been identified (13). Phosphorylated CpxR (CpxR-P) acts as a repressor of agfD transcription in high salt concentrations, through binding to sites in both agfD and agfB promoter regions (35, 46). Additional regulatory proteins affecting agfD transcription include HN-S and integration host factor (IHF) (24, 35), as well as the RcsC/B (19) and TolQRA (63) systems.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 1. Complex regulation of Salmonella extracellular matrix production. Components regulating agfD transcription are indicated in boxes above the agfDEFG (csgDEFG) and agfBAC (csgBAC) operons. HN-S and IHF binding proteins and RcsBCD and TolQRA regulatory systems were not included due to the complex nature of their actions on agfD transcription. Arrows leading from AgfD show extracellular components that are transcriptionally regulated by AgfD. AdrA generates cyclic-di-GMP (c-di-GMP), a signaling molecule that activates cellulose biosynthesis by integral membrane Bcs (bacterial cellulose synthesis) enzymes (36). Since BapA (38) and capsular polysaccharides (26) were only recently discovered, their precise roles in multicellular aggregation are not well understood. CPS, extracellular polysaccharide.

Once AgfD is produced, it stimulates expression of several extracellular matrix components, either directly or indirectly (Fig. 1). AgfD has an C-terminal DNA binding domain with homology to the LuxR family of transcriptional regulators (27) and an N-terminal putative receiver domain (51). However, no activating signal has yet been identified. AgfD directly activates transcription of the agfBAC operon and adrA, which, in turn, activates cellulose biosynthesis (70). Salmonella capsular polysaccharide (26) and BapA (38) are also regulated by AgfD, but the exact mechanisms have not been determined. AgfD also positively regulates glyA (15) and represses transcription of several genes that inhibit biofilm formation (12). The growing size and complexity of the AgfD regulon shows that this protein has multiple effects on cell physiology in Salmonella.

Since Tafi are one of the few conserved fimbrial types in Salmonella, it has been hypothesized that they may have a generalist function. However, the mere presence of Tafi genes does not prove that these organelles are produced by most or all isolates. To better assess the conservation of Tafi production and the rdar morphotype throughout the salmonellae, we performed comparative genetic analysis of the important and highly variable agfD and agfB promoters from Salmonella reference collection C (SARC) isolates (10). The SARC consists of 16 strains (SARC16) from an expanded set of 96 isolates (SARC96) from all phylogenetic lineages, including S. enterica subspecies (or groups) I, II, IIIa, IIIb, IV, and VI and Salmonella bongori (group V) (10). The rdar morphotype was conserved in 80% of SARC96 isolates but in only 31% of SARC16 isolates. agfD and agfB promoter function was conserved in all SARC16 isolates, except for two S. enterica subsp. arizonae isolates that had clear sequence (cis) mutations resulting in inactive agfD and agfB promoters. Six of the remaining SARC16 isolates possessed upstream regulatory (trans) mutations. Three additional isolates reverted to the rdar morphotype when grown in long-term culture, via cis or trans changes that resulted in increased agfD transcription. Our results suggest that Tafi production and the associated rdar morphotype are conserved in all groups of Salmonella except S. enterica subsp. arizonae. The predominance of regulatory mutations rather than structural gene mutations was unexpected and highlights the importance of cis and trans regulatory elements as a source of genetic and phenotypic variation.


arrow
MATERIALS AND METHODS
 
Bacterial strains, media, and growth conditions. S. enterica serovar Typhimurium strain ATCC 14028 (American Type Culture Collection), serovar Enteritidis 27655-3b (SE 3b) (20), and ATCC 14028 containing the SE 3b agfD promoter region (ST 3b) (described below) were used as reference strains in this study. SARC isolates have been described previously (10). Strains were routinely grown for 20 h at 37°C with agitation in 1% tryptone (pH 7.2) (T) or Miller's Luria-Bertani broth (1.0% salt) supplemented with 50 µg/ml kanamycin, 100 µg/ml ampicillin, or 30 µg/ml chloramphenicol as required before additional experiments were performed. For growth of cells on agar, cultures were diluted to an optical density of 1.0 at 600 nm and 1 µl was spotted onto T medium containing 1.5% Difco agar (T agar). To visualize the production of cellulose, cells were grown on T agar containing 200 µg/ml calcofluor white (fluorescent brightener 28; Sigma-Aldrich Canada). Colony and luminescence pictures were taken with a FluorChem 8900 camera system (Alpha Innotech).

Generation of luciferase reporters. Template DNA from each Salmonella strain was prepared following the method of Walsh et al. (64). agfB and agfD, mlrA, or rpoS promoter-containing fragments were PCR amplified using primers agfD1 and agfD2 (68), mlrA1 (GATTAAACTCGAGCATACCCGCAA [an XhoI site is underlined]) and mlrA2 (GACGGATCCATCGTTTCACCCTTGCTC [a BamHI site is underlined]), or rpoS1 (GCCCTCGAGCAGGTCTGCACAAAATTC [an XhoI site is underlined]) and rpoS2 (GCGGGATCCGTATTCTGACTCAAAAGGTG [a BamHI site is underlined]). PCR products were purified, sequentially digested with XhoI and BamHI (Invitrogen Canada Inc.), and ligated using T4 DNA ligase (Invitrogen Canada Inc.) into pCS26-Pac (XhoI-BamHI) or pU220 (BamHI-XhoI) reporter vectors containing the luxCDABE operon from Photorhabdus luminescens (7). The RpoS-responsive synthetic promoter::lux fusion sig38-H4 has been previously described (68). Plasmids were transformed into all Salmonella strains by electroporation (Gene Pulser 2.0; Bio-Rad Laboratories Inc.).

Real-time gene expression/bioluminescence assays. Overnight cultures were diluted 1 in 600 in T broth to a final volume of 150 µl, supplemented with antibiotics as required, in 96-well clear-bottom black plates (9520 Costar; Corning Inc.). The culture in each well was overlaid with 50 µl of mineral oil prior to starting the assays. Cultures were assayed for luminescence (0.1 s; counts per second) and absorbance (620 nm, 0.1 s) every 30 min during growth at 28°C with agitation in a Wallac Victor2 (Perkin-Elmer Life Sciences, Boston, Mass.). The background expression of the pCS26 and pU220 vectors is the instrument background (~150 CPS) (7). The maximum expression from an average Salmonella promoter is 1,000 to 5,000 cps, and the dynamic range can reach greater than 1,000,000 cps; agfD and agfB have very high activity. Generally, values greater than 400 cps are considered significant.

DNA sequencing and sequence alignments. Promoter::lux plasmids were purified from Salmonella (QIAspin miniprep kit; QIAGEN Inc.), and DNA sequencing was performed by Macrogen (Seoul, South Korea) using primers pZE05 and pZE06 (7). DNA sequences were assembled using Contig Express (Vector NTI 7.0; Informax, Bethesda, MD). For each isolate, sequence discrepancies were resolved by sequencing additional clones. Multiple-sequence alignment of the intergenic regions was performed using the Clustal W algorithm (Vector NTI 7.0; Informax, Bethesda, MD). The neighbor-joining dendrogram and bootstrap values, anchored on ATCC 14028, were calculated using MEGA version 3.0 (37).

Preparation of ATCC 14028 genomic library and additional plasmid vectors. Purified ATCC 14028 genomic DNA was partially digested with Sau3a, and fragments were separated by sucrose density gradient centrifugation (54). Fragments of 15 to 20 kb were isolated, dialyzed against water, and ligated into BamHI-digested pBR322 before transformation into Sarc1. Transformant colonies were isolated on LB-ampicillin agar, pBR322 plasmids were purified (QIAspin miniprep kit; QIAGEN), and DNA sequencing was performed (Macrogen, Seoul, South Korea) using primers pBR322seqB (AAGGAGCTGACTGGGTTGAAGG) and pBR322seqC (TCGGCACCGTCACCCTGGA). Purified plasmids were retransformed into Sarc1 to confirm that they conferred a switch in colony morphology.

DNA fragments containing mlrA or rpoS with native promoters were PCR amplified from ATCC 14028 using primers mlrAcloneFOR (GTCGGATCCCCAGATTAAACTCGTACATAC [a BamHI site is underlined]) and mlrAcloneREV (GTCGGATCCTCTGTTTAAACGCCAAGG [a BamHI site is underlined]) or rpoScloneFor1 (GCCGAATTCCAGGTCTGCACAAAATTC [an EcoRI site is underlined]) and rpoScloneREV (GCCAAGCTTGACAAGGGTACTTACTCGC [a HindIII site is underlined]). PCR products were purified and ligated into BamHI- or EcoRI- and HindIII-digested pBR322. To move rpoS into pACYC184, pBR322/rpoS was digested with EcoRI, and the linearized plasmid was incubated at 68°C for 30 min with 2.5 U of Pfx DNA polymerase (Invitrogen Canada Inc.) to generate blunt-ended DNA. The linearized plasmid was digested with HindIII, and the rpoS-containing fragment was ligated into HindIII- and HincII-digested pACYC184 (Fermentas Life Sciences). Plasmids were transformed into Salmonella strains by electroporation. Sarc9 was not included in these experiments because of its recalcitrance to genetic manipulation and its unique requirement for salt (>0.5%) in the growth media used.

Generation of ATCC 14028 mutant strains. An in-frame deletion of 949 bp in rpoS (encoding amino acids 7 to 323 in RpoS) was generated using overlap extension PCR (31) with primers rpoScloneFor1, rpoSRev1 (CGCTTCGATATCAGCGTATTCTGACTCA), rpoSFor2 (AATACGCTGATATCGAAGCGCTGTTCCG), and rpoSRev2 (GCCAAGCTTGTCGCAACATGACCGTGGT [a HindIII site is underlined]). Italicized sequences correspond to regions of identity between rpoSRev2 and rpoSFor2. PCR products were purified, digested with EcoRI and HindIII, and ligated into pHSG415 (29). To generate strain ST 3b, the agfD promoter region from SE 3b was PCR amplified using primers agfD3b1 (AGTGAATTCGCTTCTTATCCGCTTCC [an EcoRI site is underlined]) and agfD3b2 (GTAAAGCTTTACTATCAAATCTAAACTTCAAA [a HindIII site is underlined]) and cloned into pHSG415. Mutations were introduced into the chromosome of ATCC 14028 following established procedures (65, 66). {Delta}rpoS isolates were identified by smooth colony morphologies and lack of catalase activity when grown on T agar at 28°C; chromosomal deletions in rpoS were confirmed by PCR. ST 3b isolates were selected by the ability to form rdar colonies when grown at 37°C on T agar; agfD promoter sequence mutations were confirmed by DNA sequencing.

Long-term standing-culture experiments. ATCC 14028, Sarc1, Sarc2, Sarc4, Sarc8, Sarc11, Sarc14, and Sarc16 at an A600 of 1 (~109 cells) were inoculated into 5 ml of 1% tryptone broth or Miller's LB (1% NaCl) and grown in loosely capped 16- by 125-mm borosilicate culture tubes at room temperature (RT) for up to 21 days. After pellicle formation had occurred, material was carefully removed from the air-liquid interface, resuspended in 1 ml of sterile phosphate-buffered saline, and broken up using a tissue homogenizer until uniform turbidity was reached (~ 20 s). Alternatively, cultures were vortexed to resuspend the pellicles. Homogenized pellicle mixtures were serially diluted onto T agar and incubated at RT to isolate individual colonies.


arrow
RESULTS
 
Conservation of the rdar morphotype throughout the salmonellae. When SARC96 isolates were grown on T agar at RT for up to 14 days, three distinct phenotypic classes were observed: 79% of isolates formed rdar colonies with complete surface patterns that could be lifted off the agar surface intact, 4% formed colonies with incomplete patterns, and 17% formed smooth, nonaggregative colonies without surface patterns (Table 1). Cellulose production was tested by growing isolates on agar containing calcofluor (56); all rdar-positive isolates were cellulose positive (Table 1). In general, most incomplete-pattern and smooth isolates were negative for cellulose production, with some exceptions (Table 1). S. enterica subspecies arizonae (group IIIa) was unique in that all isolates were smooth and did not produce cellulose (Table 1). In general, multicellular behavior (rdar morphotype) was conserved in six of seven Salmonella groups.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Prevalence of multicellular pattern formation (rdar morphotype) in the salmonellae (Salmonella reference collection C [10])

Smooth isolates were evenly distributed within the different Salmonella groups, but many belonged to the conventional SARC16 set, consisting of at least two isolates from each Salmonella subgroup (10). Four SARC16 isolates were rdar positive, one had an intermediate phenotype, and the remaining 11 isolates were smooth (Table 1). For all Salmonella groups except IIIa, the smooth colony morphologies of the SARC16 isolates were atypical compared to most isolates in the SARC96 set (Table 1).

Conservation of agfD and agfB promoter activity in SARC16 isolates. To analyze the genetic conservation of Tafi production throughout the salmonellae, the agfDEFG-agfBAC intergenic region was amplified from each SARC16 isolate and used to generate agfD and agfB promoter luciferase fusions (7). This DNA region included the 521-bp intertranscript region and 5' untranslated regions of agfB and agfD (23). We were unable to amplify agfD-agfB fragments from S. enterica subsp. arizonae isolates Sarc5 and Sarc6; therefore, the Sarc35 and Sarc37 isolates from the SARC96 collection were used in their place for all subsequent experiments (Table 1). Three subspecies I reference strains were included as controls in these experiments: serovar Typhimurium ATCC 14028, serovar Enteritidis 27655-3b (SE 3b), and ATCC 14028 containing the agfD promoter region from SE 3b (ST 3b).

To determine if each set of promoters was functional and to compare their activities directly (i.e., independent of variation in levels of transcription factors), expression was measured in the same strain background, ATCC 14028. Surprisingly, agfD and agfB promoters from 17 of the 19 strains were active (Fig. 2A). The variation in magnitude for active agfD promoters varied from 96,000 to 520,000 luminescence counts per second, whereas for agfB the expression levels varied from 430,000 to 740,000 cps (Fig. 2A). Some cis (sequence) variability was reflected in the variation in promoter strength. However, since the temporal pattern of expression remained conserved (Fig. 2B and C), it appears that important regulatory sites in the agf promoters are functionally conserved throughout the salmonellae. Peak expression for agfD promoters lasted approximately 5 to 6 hours (Fig. 2B), whereas for agfB promoters the maximum expression lasted only 30 to 60 min (Fig. 2C). The only inactive agf promoters were obtained from S. enterica subsp. arizonae isolates Sarc35 and Sarc37; these promoters were inactive when ATCC 14028 was grown under a variety of additional conditions (data not shown).


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 2. cis variability of agfD and agfB promoters in Salmonella. Expression of agfD and agfB promoter::lux fusions from 19 isolates representing seven different Salmonella groups was measured in ATCC 14028. (A) Maximum luminescence (counts per second) values for each reporter strain are represented as the mean and standard deviation from at least three independent experiments. Salmonella isolates corresponding to each promoter are listed below the x axis: SARC isolates are numbered as described in Table 1; 14028, serovar Typhimurium ATCC 14028; ST 3b, ATCC 14028-3b; SE 3b, serovar Enteritidis 27655-3b. Salmonella subgroup numbers are listed below each set of strains. (B and C) Light production by agfD::lux (B) and agfB::lux (C) reporter strains as a function of time, normalized by the maximum counts per second for each strain. The dashed line represents the level of maximum luminescence. Results from one representative experiment are shown.

Sequence conservation of the agfBAC-agfDEFG intergenic region between different Salmonella isolates. Alignment of the agfB and agfD promoter sequences showed a high amount of divergence among the SARC16 isolates and three subspecies I reference strains (Fig. 3). The overall sequence identity for the region between agfB and agfD was only 67%. Most sequence changes were group specific and clustered into regions not immediately adjacent to the agf promoters (Fig. 3). Consistent with this, each Salmonella subgroup formed a separate node in the alignment.


Figure 3
View larger version (39K):
[in this window]
[in a new window]

 
FIG. 3. Multiple-sequence alignment of the agfBAC-agfDEFG intergenic region from representative isolates of each Salmonella subgroup. Conserved bases are shown in gray, base pair differences are shown in black, and gaps in the alignment are represented by white spaces. Transcriptional start sites (arrows) and –10 and –35 promoter regions (boxes) for agfB and agfD are displayed as annotated for the serovar Typhimurium LT2 genome (42). Important regulatory regions or binding sites for OmpR (hatched boxes), CpxR (black boxes), H-NS (gray box), and IHF (white box) are displayed above the alignment (23, 35, 46). The circled regions highlight changes in a putative AgfD binding site (12) and the activating OmpR site adjacent to the agfD promoter (23). Neighbor-joining dendrograms are shown on the left of the alignment, and bootstrap values based on 1,000 computer-generated trees are indicated at the nodes. Strains and groups are listed as described in the legend to Fig. 2. Sequence and alignments are available from the authors.

Unique cis changes were identified for the inactive agf promoters from the S. enterica subsp. arizonae isolates, Sarc35 and Sarc37. For PagfB, both isolates had a unique G-to-T sequence change in a recently predicted AgfD binding site (GGGTGAGTTA) (12) near the –35 region (Fig. 3). For PagfD, the S. enterica subsp. arizonae isolates both possessed three unique changes in the activating OmpR binding site required for agfD transcription (23, 52) (Fig. 3). Two of the changes were in the most highly conserved nucleotides in the OmpR consensus binding sequence (ACNTTTNGNTACANNTAT) (23, 33).

The SE 3b and ST 3b strains possessed a G-to-T transversion in the activating OmpR site adjacent to the –35 region of the agfD promoter (Fig. 3). This specific promoter change relieves RpoS dependency and allows for agfD transcription by RpoD ({sigma}70) (52). As a result, expression is more constitutive and is increased in magnitude, allowing for Tafi and cellulose production at 37°C. Sarc15 was also capable of producing Tafi and cellulose at 37°C (Table 1), but no changes were detected in the activating OmpR binding site. One unique change was identified in the region containing putative OmpR binding sites D3 to -6 (23) further upstream of the Sarc15 agfD promoter. This binding region has been linked to the repression of agfD transcription by high levels of phosphorylated OmpR (23), and it is possible that the change identified may relieve this repression. The –10 and –35 promoter regions for both agfD and agfB were almost absolutely conserved in all Salmonella isolates (Fig. 3). Sarc16 was the only strain where a change was identified, but this did not prevent transcription (Fig. 2A). Altogether, these results demonstrated that agfD and agfB promoter function was conserved for six of seven Salmonella subgroups, despite sequence differences.

Native agfD and agfB promoter expression in SARC16 isolates. To analyze trans regulatory differences between smooth and rdar-positive SARC16 isolates, expression of each set of functional agfD and agfB promoters was tested in their native strain backgrounds (Fig. 4). Sarc35 and Sarc37 isolates were not included in this analysis, since both isolates possessed nonfunctional agf promoters. In general, agf expression levels in all SARC16 isolates were reduced compared to those in the three subspecies I reference strains (Fig. 4). Differences were observed between the rdar-positive and smooth isolates, however. All rdar-positive SARC isolates had agfD and agfB expression levels above 10,000 cps (Fig. 4, Sarc3, -7, -13, and -15). Sarc10, which had an intermediate rdar phenotype, also had expression of both promoters above 10,000 cps (Fig. 4). All smooth isolates had agfB expression below 10,000 cps (Fig. 4), and only three strains had agfD expression above 10,000 cps (Fig. 4, Sarc1, -8, and -12). On average, expression in the smooth strain backgrounds was reduced 20-fold for agfD and >1,000-fold for agfB compared to expression of the same promoters in the ATCC 14028 background (Fig. 2A). In contrast, expression levels in rdar-positive isolates were reduced only 4-fold for agfD and 20-fold for agfB.


Figure 4
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 4. trans variability of agfD and agfB promoter expression in SARC isolates. Expression of native agfD and agfB promoter::lux reporters in SARC16 and Salmonella subgroup I reference strains is shown. Maximum luminescence (counts per second) values for each reporter strain are represented as the mean and standard deviation from at least three independent experiments. The dotted line marks the threshold level of agfD and agfB expression that correlates with rdar colony morphology. Salmonella strains and group numbers listed below the x axis are as described in the legend to Fig. 2.

RpoS activity in rdar-positive and smooth SARC strains. Since RpoS is one of the central regulators of agfD transcription and its activity can vary among Salmonella isolates (34, 47), we investigated whether reduced agfD expression in the smooth SARC isolates could be correlated with a reduction in RpoS activity. We measured the expression of a synthetic RpoS-dependent promoter::lux fusion (sig38-H4) (68) in each strain background (Fig. 5). ATCC 14028, which is known to be RpoS+, had expression levels of 48,000 cps. In contrast, the known RpoS-deficient strains ATCC 14028 {Delta}rpoS and SE 3b (1) had expression levels below 10,000 cps (Fig. 5). Most SARC16 isolates had expression above 30,000 cps and were assumed to have functional RpoS. Four isolates were identified as putative rpoS mutants (Fig. 5, Sarc4, Sarc12, Sarc15, and Sarc16), and all except Sarc15 had smooth colony morphologies (Table 1). Reduced RpoS activity was confirmed in three of four isolates by an absence of catalase activity when colonies were treated with hydrogen peroxide (data not shown).


Figure 5
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 5. RpoS activity in SARC isolates and Salmonella subgroup I reference strains. Luminescence (counts per second) from a synthetic RpoS-responsive promoter::lux fusion (sig38-H4) was measured in each strain during growth in 1% tryptone for 48 h at 28°C. Bars represent the mean and standard deviation of maximum cps values from at least three independent experiments. The dotted line marks the threshold level of RpoS activity; strains with expression at or below this level are known or assumed to be RpoS deficient. Salmonella strains and group numbers listed below the x axis are as described in the legend to Fig. 2. An isogenic rpoS mutant strain of ATCC 14028 ({Delta}rpoS) and a pACYC/rpoS-complemented strain ({Delta}rpoS+) were included as controls for RpoS activity.

Restoration of the rdar morphotype in Sarc1. To determine the genetic defect(s) in Sarc1 (serovar Typhimurium), we transformed this isolate with an ATCC 14028 genomic DNA library in pBR322. Approximately 10,000 transformants were screened, and three rdar-positive isolates were obtained. Plasmids purified from all three isolates contained mlrA (yehV), a known positive regulator of agfD transcription (13, 22). When Sarc1 was transformed with pBR322 containing only mlrA, this was sufficient to restore the rdar morphotype (Fig. 6A). Overexpression of mlrA resulted in a 50-fold increase in agfD expression and a 200-fold increase in agfB expression (Fig. 6B). The colony morphology of Sarc1 with pBR322/mlrA (Fig. 6A, right panel) was similar to that of SE 3b, which has more constitutive expression of extracellular components (52). Consistent with this, overexpression of mlrA caused an increase in calcofluor binding, indicating that cellulose was produced (data not shown). We also detected a near-twofold increase in RpoS activity in Sarc1 with pBR333/mlrA (Fig. 6B). The significance of increased RpoS activity is not known, but it may reflect changes in cell physiology and growth conditions due to overproduction of Tafi and cellulose.


Figure 6
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 6. Restoration of the rdar morphotype in Sarc1. (A) Colony morphology of Sarc1 with or without pBR322/mlrA grown on T agar at 28°C for 48 h. (B) Luminescence (counts per second) of key promoters in Sarc1 or Sarc1 with pBR322/mlrA was measured during growth in 1% tryptone for 48 h at 28°C. Bars represent the average and standard deviation of maximum values (counts per second) from at least three independent experiments.

Restoring the rdar morphotype in smooth SARC16 strains. When pBR322/mlrA was transformed into additional smooth SARC16 isolates, Sarc2, Sarc8, and Sarc14 were restored to the rdar morphotype (Fig. 7). For each isolate, the change in colony morphology (Fig. 7, images on left) was correlated with an increase in luminescence from a native agfB promoter::lux reporter (Fig. 7, images on right). The rdar morphotype was not restored in RpoS-deficient isolates Sarc4 and Sarc16. When RpoS activity was restored by transformation with pACYC/rpoS, Sarc16 displayed a switch to rdar morphology (Fig. 7). For Sarc4, transformation with both mlrA and rpoS plasmids resulted in partial complementation of the rdar morphotype (Fig. 7). The incomplete pattern observed could reflect the presence of additional regulatory defects that were not fully complemented.


Figure 7
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 7. Restoration of agfB expression and the rdar morphotype in smooth SARC16 isolates. ATCC 14028, Sarc2, Sarc4, Sarc8, Sarc14, and Sarc16 strains containing native agfB::lux reporter plasmids were transformed with pBR322/mlrA, pACYC/rpoS, or both plasmids together. Cells were inoculated onto T agar or LB agar (Sarc4) and grown at 28°C for 48 h. Colony morphology (left columns) was recorded with a reflective light source; luminescence from each colony is represented by images in the right columns. Increased luminescence is predicted to be representative of Tafi production.

mlrA and rpoS expression in smooth SARC16 strains. Garcia et al. (22) recently described a smooth S. enterica serovar Typhimurium isolate with a deficiency in mlrA transcription, resulting in a lack of Tafi and cellulose production. Following from these results, we hypothesized that smooth SARC16 isolates might also have defects in native mlrA expression. However, expression of an ATCC 14028 mlrA promoter::lux reporter was not impaired in Sarc1, Sarc2, Sarc8, and Sarc14. This showed that regulatory networks required for mlrA transcription were intact in each isolate. In addition, PmlrA::lux reporters generated from each isolate had wild-type expression levels in ATCC 14028 (data not shown), indicating that the mlrA promoters were functional. Lastly, the predicted amino acid sequence of MlrA from each isolate was identical to that of MlrA from ATCC 14028 (data not shown). These three experiments gave strong evidence that Sarc1, Sarc2, Sarc8, and Sarc14 were not impaired in mlrA expression and, therefore, presumably had defects in other genes required for agfD transcription. In contrast, reduced mlrA expression was detected in Sarc4 and Sarc16 (Table 2). This can be explained because Sarc4 and Sarc16 were predicted to be RpoS deficient (Fig. 4) and mlrA transcription is dependent upon RpoS (13). Expression of an ATCC 14028 PrpoS::lux fusion was high in Sarc4 but was reduced to background levels in Sarc16 (Table 2). This indicated that Sarc16 had defects in the upstream regulatory network required for rpoS transcription, whereas Sarc4 was primarily intact. Sarc16 also had a deletion of a single T in codon 55 of rpoS, which is predicted to result in a truncated protein. It was assumed that Sarc4 also possessed sequence alterations, but we were unable to PCR amplify rpoS-containing fragments from this isolate.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Variability of PmlrA and PrpoS expression in smooth SARC16 strains

Pellicle formation by smooth SARC strains. Salmonella spp. normally form pellicles at the air-liquid interface in standing liquid cultures; in rich media, this requires production of Tafi and cellulose (51, 56, 70). The air-liquid interface represents a favorable niche that provides bacterial cells with increased access to oxygen. In other bacterial species (e.g., Pseudomonas fluorescens), reversion to pellicle formation, or adaptive divergence, can occur through mutations that increase the production of extracellular polymers (58, 59). Therefore, we investigated whether smooth SARC16 isolates would form pellicles if grown in standing liquid culture for long time periods.

Pellicle formation by ATCC 14028 occurred within 3 days of growth at RT in both LB and 1% tryptone (data not shown). Two smooth isolates, Sarc8 and Sarc14, formed thick pellicles in both media at between 7 and 14 days of growth at RT (data not shown). In contrast, Sarc1 and Sarc2 did not form pellicles for the duration of the experiment. For Sarc4 and Sarc16, pellicle formation was observed between 14 and 21 days, but in only one culture medium (1% tryptone for Sarc4 and LB for Sarc16). When pellicle material from each strain was homogenized and individual cells grown out on T agar, two colony types were observed, smooth (cellulose negative) and rdar like (cellulose positive). When reinoculated into standing liquid culture, the Sarc4 and Sarc16 rdar-like (revertant) isolates formed pellicles within 3 to 4 days of growth, whereas the smooth isolates did not (Fig. 8A and B). DNA sequencing proved that the revertant isolates possessed single-base-pair cis mutations in the agfD promoter region (Fig. 8C). The change for the Sarc4 revertant was within the activating OmpR binding site, whereas the Sarc16 revertant possessed a change in the –35 promoter region (Fig. 8C). Expression levels of the Sarc4 and Sarc16 revertant promoters were increased 3.5-fold and ~18-fold compared to those of the native promoters (Fig. 8C). SE 3b was included for comparison purposes; the agfD promoter change in SE 3b, which is at the same position as in the Sarc4 revertant, caused an 8.6-fold increase in expression levels (Fig. 8C).


Figure 8
View larger version (67K):
[in this window]
[in a new window]

 
FIG. 8. Pellicle formation by smooth SARC16 strains. Revertant isolates capable of pellicle formation were isolated from the air-liquid interface of standing liquid cultures of Sarc4 and Sarc16. (A and B) Pellicle-forming ability was tested for native isolates and revertant isolates during growth in 1% tryptone (A) or LB (B) for 3 days at RT. (C) agfD promoter sequences were compared between ATCC 14028, SE 3b, Sarc4, Sarc16, and the two revertant (rev) isolates. The activating OmpR binding site is underlined, and the –35 promoter sequence is in boldface. The fold increases in agfD transcription represents the relative expression levels of promoter::lux fusions from each isolate measured in the SE 3b {Delta}agfD (26), Sarc4, or Sarc16 strain background. Values represent the maximum luminescence of SE 3b divided by that of ATCC 14028, the maximum luminescence of Sarc4rev divided by that of Sarc4, and the maximum luminescence of Sarc16rev divided by that of Sarc16 (means and standard deviations from at least three independent experiments).

The S. bongori isolate Sarc11 was also included in the pellicle formation experiment. Between 14 and 21 days of growth, a thin pellicle began to form at the air-liquid interface in the 1% tryptone culture. Two different colony types were isolated from the pellicle material, nonaggregative and smooth (82%) and rdar (18%) (Fig. 9B). When reinoculated into 1% tryptone, rdar isolates formed a thin pellicle at the air-liquid interface, whereas smooth isolates did not (Fig. 9A). The difference in pellicle-forming ability was not attributed to agfD promoter (cis) mutations, since the native and revertant isolates had identical sequences. To determine whether native Sarc11 and the revertant isolate differed in their levels of trans regulators, we tested the expression of the same agfD and agfB promoter fusions in each strain background (Fig. 9C). In the revertant isolate, agfD expression was increased 16-fold and agfB expression was increased 2,000-fold above native levels, whereas RpoS activity remained the same (Fig. 9C). This suggested that a change(s) in trans regulatory factors in Sarc11 had occurred upstream of agfD, rather than reversion within the agfDEFG or agfBAC operons.


Figure 9
View larger version (53K):
[in this window]
[in a new window]

 
FIG. 9. Reversion of multicellular aggregation in Sarc11 (S. bongori). Native Sarc11 and a pellicle-forming revertant isolate were tested for (A) pellicle-forming ability when grown in 1% tryptone at RT for 7 days, (B) colony morphology when grown on T agar at 28°C for 48 h, and (C) levels of gene expression. For panel C, luminescence (counts per second) of native agfD and agfB promoter::lux fusions and the sig38-H4 RpoS-responsive reporter was measured in each strain background during growth in 1% tryptone at 28°C for 48 h. Bars represent the means and standard deviations of maximum values (counts per second) from at least three independent experiments.


arrow
DISCUSSION
 
The primary aim of this study was to determine the conservation of Tafi production and rdar morphotype formation throughout the salmonellae. In total, 80% of 96 isolates from all phylogenetic lineages of Salmonella were capable of production of thin aggregative fimbriae (Tafi or curli) and cellulose and were rdar positive. This extends previous reports on conservation of the rdar morphotype within S. enterica subgroup I: it was found in >90% of 800 serovar Typhimurium and Enteritidis isolates (50), 70% of 204 serovar Enteritidis isolates (56), and 72% of 71 isolates from 28 different serovars (57) from clinical, food, animal, and environmental sources. S. enterica subgroup I isolates primarily infect warm-blooded hosts and are responsible for most human disease cases, whereas the other subgroups, including S. bongori, are primarily associated with cold-blooded hosts (11). Conservation of Tafi production and rdar morphotype formation in these other subgroups suggests an important role in the life cycles of diverse Salmonella isolates. Due to characteristic growth conditions (growth under 30°C, nutrient limitation, low osmolarity) (16, 25) and increased resistance to desiccation (26, 68) and antimicrobial agents (2, 55, 56, 68), we hypothesize that the rdar morphotype has a fundamental role for Salmonella survival outside host environments. This may contribute to contamination of different food products (4, 30) and passage between susceptible hosts.

The SARC16 isolates were analyzed in more detail to assess the genetic conservation of the agfDEFG and agfBAC operons within the entire Salmonella genus. Despite a large amount of sequence divergence, agfD and agfB promoter function was conserved in 14 isolates from six of seven Salmonella groups. In addition, the magnitude and profile of expression did not vary greatly between promoters from diverse isolates. The estimated evolutionary distances calculated from alignment of the entire 780-bp region between the agfDEFG and agfBAC operons closely matched SARC strain comparisons based on over 12,000 bases of coding sequence (10). We interpret these results to indicate that most of the changes in the agf intergenic region that exist between isolates are "neutral" and representative of genetic drift, while essential regulatory regions required for agfD and agfB expression have been conserved. The divergence observed agrees with recent sequence comparisons by Hu et al. (32) showing that intergenic regions have higher mutation rates than coding sequences within serovar Typhimurium.

The most divergent sequences were obtained from S. enterica subsp. arizonae (group IIIa) and S. bongori (group V) isolates. This is consistent with previous DNA microarray studies (14, 45). However, only S. enterica subsp. arizonae isolates possessed inactive agfD and agfB promoters. Clear sequence changes were identified in both Sarc35 and Sarc37: mutation of the activating OmpR binding site for PagfD and mutation of a predicted AgfD binding site (GGGTGAGTTA) (12) for PagfB (Table 3). These sequence changes likely prevent AgfD and OmpR binding and or subsequent activation of transcription. We could not amplify promoter regions from five additional S. enterica subsp. arizonae isolates, including Sarc5 and Sarc6, possibly due to larger sequence differences. We believe that these cis changes are strong evidence of selection against Tafi production and the rdar morphotype in S. enterica subsp. arizonae. One of the major differences from other Salmonella groups is that S. enterica subsp. arizonae isolates are common gut inhabitants of reptiles and snakes and could be part of the commensal microflora in these animals (40). Thus, S. enterica subsp. arizonae isolates may not need to survive outside their hosts for long time periods. In addition, S. enterica subsp. arizonae isolates are known to cause disease primarily in patients who are immunocompromised (40). Whether the difference in agf promoter function in S. enterica subsp. arizonae can be related to decreased infectivity has yet to be determined.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Summary of cis and trans mutations contributing to the smooth phenotypes of selected SARC isolates

Even though most SARC16 isolates possessed functional agf promoters, 11 of 16 isolates did not produce Tafi and cellulose when grown on T agar. The rdar morphotype was restored in six smooth isolates by increased copy numbers of known trans regulators of agfD transcription (Table 3). Each of the four isolates in which rdar was restored by increased copy number of mlrA had normal levels of native mlrA expression, and the precise mutations were not identified. To explain our results, we concluded that overexpression of mlrA compensated for other trans regulatory defects, resulting in increased expression of agfD and production of downstream extracellular components. We assume that the trans defects are in the same upstream pathway required for agfD transcription but do not affect mlrA transcription. The other isolates, Sarc4 and Sarc16, were identified as being RpoS deficient. Mutations in rpoS have been detected in other Salmonella isolates and are thought to reflect either natural variation or laboratory-induced changes (34, 47, 60).

Adaptive divergence (i.e., pellicle formation) was observed for three smooth SARC16 isolates previously unable to colonize the air-liquid interface of standing cultures. Each isolate acquired mutations that elevated agfD expression, either directly through cis mutations in the PagfD region (Sarc4 and Sarc16) or through trans regulatory changes upstream of agfD (Sarc11) (Table 3). The nucleotide change in Sarc4 was at the same position as the PagfD change in SE 3b (52) and may represent a mutational hotspot within the OmpR binding region (ACNTTTNGNTACANNTAT) (23). For Sarc16, the change was in the –35 region and shifted the PagfD sequence closer to the {sigma}70 consensus (39). In E. coli, enhanced Tafi (curli) production has been linked to PagfD (PcsgD) mutations in the –10 region that move the sequence closer to the {sigma}70 consensus (62). The changes that occurred in Sarc4 and Sarc16 were also predicted to allow for {sigma}70-based transcription of agfD. Sarc15 had properties similar to those of the revertant isolates and was also predicted to be RpoS deficient. Our results suggest that Salmonella isolates lacking native RpoS activity can easily revert to rdar formation by acquiring cis promoter mutations that activate agfD transcription. For Sarc11, the precise regulatory change was not identified and may have occurred through several different pathways, although the defect was determined not to be in mlrA (data not shown).

The high prevalence of trans regulatory mutations in the SARC16 isolates may be the result of domestication. Mycobacterium bovis bacillus Calmette-Guérin (BCG) is one well-documented example of this phenomenon (6), which has also occurred in several commonly studied bacterial pathogens (21). The initial descriptions of curli (Tafi) (43) and the positive regulators crl (3) and mlrA (13) were for E. coli HB101, a commonly used strain with trans regulatory mutations. Garcia et al. (22) have also recently described a variant of the commonly used S. enterica serovar Typhimurium SL1344 with a trans regulatory mutation. Furthermore, repeated subculturing of E. coli OH157:H7 (62) and S. enterica serovar Typhimurium (52; C. D. Davidson, A. P. White, and M. G. Surette, unpublished data) is known to induce phenotype switching with respect to the rdar morphotype. The discovery of trans mutations was surprising since the 4.4-kb agfDEFG/BAC (Tafi) and 14.2-kb bcsABZC/EFG (cellulose) operons represent large regions where inactivating mutations could accumulate. It is possible that cis mutations and/or structural gene mutations are more indicative of a change in lifestyle, such as what has been observed in Shigella spp. (53). Collectively, our experiments show that SARC16 phenotypes are not representative of the salmonellae and that the rdar morphotype may be more prevalent than we have measured.

In the modular description of cellular organization (28), the whole Tafi, cellulose, and extracellular matrix network could exist as a single "survival" module under the control of AgfD (CsgD). With the discovery of BapA (38) and an O-antigen capsule (26), the network of AgfD-regulated extracellular components is growing. Our results demonstrate that loss of the rdar morphotype in Salmonella results primarily from regulatory mutations affecting AgfD expression and not from mutation in genes for Tafi or cellulose biosynthesis. Thus, AgfD is the point of integration of multiple physiological and environmental inputs. Detailed promoter sequence and function comparisons allowed us to separate cis and trans effects on regulation. Overall, diverse isolates within the Salmonella genus have retained the genetic capacity and phenotypic ability to produce the extracellular matrix, which may contribute to the worldwide persistence of these important pathogens.


arrow
ACKNOWLEDGMENTS
 
We thank Ken Sanderson for providing access to SARC strains at the Salmonella Genetic Stock Centre (University of Calgary) E. Allen-Vercoe and P. Banser for assistance with experiments, and Ken Sanderson, M. Elowitz, B. Bassler, W. Kay, and E. Crump for critical reading of the manuscript.

This work was supported by grants from the Canadian Institutes of Health Research to M.G.S. and through Genome Prairie, Genome BC, and Inimex Pharmaceuticals through the "Functional Pathogenomics of Mucosal Immunity" project. M.G.S. is supported as an Alberta Heritage Foundation for Medical Research (AHFMR) Senior Scholar and Canada Research Chair in Microbial Gene Expression. A.P.W. is supported by a postdoctoral fellowship from AHFMR.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Infectious Diseases, University of Calgary, Calgary, Alberta T2N 4N1, Canada. Phone: (403) 220-2744. Fax: (403) 270-2772. E-mail: surette{at}ucalgary.ca. Back

{triangledown} Published ahead of print on 29 September 2006. Back


arrow
REFERENCES
 
    1
  1. Allen-Vercoe, E., R. Collighan, and M. J. Woodward. 1998. The variant rpoS allele of S. enteritidis strain 27655R does not affect virulence in a chick model nor constitutive curliation but does generate a cold-sensitive phenotype. FEMS Microbiol. Lett. 167:245-253.[CrossRef][Medline]
  2. 2
  3. Anriany, Y. A., R. M. Weiner, J. A. Johnson, C. E. De Rezende, and S. W. Joseph. 2001. Salmonella enterica serovar Typhimurium DT104 displays a rugose phenotype. Appl. Environ. Microbiol. 67:4048-4056.[Abstract/Free Full Text]
  4. 3
  5. Arnqvist, A., A. Olsen, J. Pfeifer, D. G. Russell, and S. Normark. 1992. The Crl protein activates cryptic genes for curli formation and fibronectin binding in Escherichia coli HB101. Mol. Microbiol. 6:2443-2452.[Medline]
  6. 4
  7. Barak, J. D., L. Gorski, P. Naraghi-Arani, and A. O. Charkowski. 2005. Salmonella enterica virulence genes are required for bacterial attachment to plant tissue. Appl. Environ. Microbiol. 71:5685-5691.[Abstract/Free Full Text]
  8. 5
  9. Baumler, A. J., A. J. Gilde, R. M. Tsolis, A. W. van der Velden, B. M. Ahmer, and F. Heffron. 1997. Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J. Bacteriol. 179:317-322.[Abstract/Free Full Text]
  10. 6
  11. Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane, and P. M. Small. 1999. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 284:1520-1523.[Abstract/Free Full Text]
  12. 7
  13. Bjarnason, J., C. M. Southward, and M. G. Surette. 2003. Genomic profiling of iron-responsive genes in Salmonella enterica serovar Typhimurium by high-throughput screening of a random promoter library. J. Bacteriol. 185:4973-4982.[Abstract/Free Full Text]
  14. 8
  15. Bokranz, W., X. Wang, H. Tschape, and U. Romling. 2005. Expression of cellulose and curli fimbriae by Escherichia coli isolated from the gastrointestinal tract. J. Med. Microbiol. 54:1171-1182.[Abstract/Free Full Text]
  16. 9
  17. Bougdour, A., C. Lelong, and J. Geiselmann. 2004. Crl, a low temperature-induced protein in Escherichia coli that binds directly to the stationary phase sigma subunit of RNA polymerase. J. Biol. Chem. 279:19540-19550.[Abstract/Free Full Text]
  18. 10
  19. Boyd, E. F., F. S. Wang, T. S. Whittam, and R. K. Selander. 1996. Molecular genetic relationships of the salmonellae. Appl. Environ. Microbiol. 62:804-808.[Abstract]
  20. 11
  21. Brenner, F. W., R. G. Villar, F. J. Angulo, R. Tauxe, and B. Swaminathan. 2000. Salmonella nomenclature. J. Clin. Microbiol. 38:2465-2467.[Free Full Text]
  22. 12
  23. Brombacher, E., C. Dorel, A. J. Zehnder, and P. Landini. 2003. The curli biosynthesis regulator CsgD co-ordinates the expression of both positive and negative determinants for biofilm formation in Escherichia coli. Microbiology 149:2847-2857.[Abstract/Free Full Text]
  24. 13
  25. Brown, P. K., C. M. Dozois, C. A. Nickerson, A. Zuppardo, J. Terlonge, and R. Curtiss III. 2001. MlrA, a novel regulator of curli (AgF) and extracellular matrix synthesis by Escherichia coli and Salmonella enterica serovar Typhimurium. Mol. Microbiol. 41:349-363.[CrossRef][Medline]
  26. 14
  27. Chan, K., S. Baker, C. C. Kim, C. S. Detweiler, G. Dougan, and S. Falkow. 2003. Genomic comparison of Salmonella enterica serovars and Salmonella bongori by use of an S. enterica serovar typhimurium DNA microarray. J. Bacteriol. 185:553-563.[Abstract/Free Full Text]
  28. 15
  29. Chirwa, N. T., and M. B. Herrington. 2003. CsgD, a regulator of curli and cellulose synthesis, also regulates serine hydroxymethyltransferase synthesis in Escherichia coli K-12. Microbiology 149:525-535.[Abstract/Free Full Text]
  30. 16
  31. Collinson, S. K., L. Emody, K. H. Muller, T. J. Trust, and W. W. Kay. 1991. Purification and characterization of thin, aggregative fimbriae from Salmonella enteritidis. J. Bacteriol. 173:4773-4781.[Abstract/Free Full Text]
  32. 17
  33. de Rezende, C. E., Y. Anriany, L. E. Carr, S. W. Joseph, and R. M. Weiner. 2005. Capsular polysaccharide surrounds smooth and rugose types of Salmonella enterica serovar Typhimurium DT104. Appl. Environ. Microbiol. 71:7345-7351.[Abstract/Free Full Text]
  34. 18
  35. Doran, J. L., S. K. Collinson, J. Burian, G. Sarlos, E. C. Todd, C. K. Munro, C. M. Kay, P. A. Banser, P. I. Peterkin, and W. W. Kay. 1993. DNA-based diagnostic tests for Salmonella species targeting agfA, the structural gene for thin, aggregative fimbriae. J. Clin. Microbiol. 31:2263-2273.[Abstract/Free Full Text]
  36. 19
  37. Ferrieres, L., and D. J. Clarke. 2003. The RcsC sensor kinase is required for normal biofilm formation in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid surface. Mol. Microbiol. 50:1665-1682.[CrossRef][Medline]
  38. 20
  39. Feutrier, J., W. W. Kay, and T. J. Trust. 1986. Purification and characterization of fimbriae from Salmonella enteritidis. J. Bacteriol. 168:221-227.[Abstract/Free Full Text]
  40. 21
  41. Fux, C. A., M. Shirtliff, P. Stoodley, and J. W. Costerton. 2005. Can laboratory reference strains mirror "real-world" pathogenesis? Trends Microbiol. 13:58-63.[CrossRef][Medline]
  42. 22
  43. Garcia, B., C. Latasa, C. Solano, F. Garcia-del Portillo, C. Gamazo, and I. Lasa. 2004. Role of the GGDEF protein family in Salmonella cellulose biosynthesis and biofilm formation. Mol. Microbiol. 54:264-277.[CrossRef][Medline]
  44. 23
  45. Gerstel, U., C. Park, and U. Romling. 2003. Complex regulation of csgD promoter activity by global regulatory proteins. Mol. Microbiol. 49:639-654.[CrossRef][Medline]
  46. 24
  47. Gerstel, U., and U. Romling. 2003. The csgD promoter, a control unit for biofilm formation in Salmonella typhimurium. Res. Microbiol. 154:659-667.[Medline]
  48. 25
  49. Gerstel, U., and U. Romling. 2001. Oxygen tension and nutrient starvation are major signals that regulate agfD promoter activity and expression of the multicellular morphotype in Salmonella typhimurium. Environ. Microbiol. 3:638-648.[CrossRef][Medline]
  50. 26
  51. Gibson, D. L., A. P. White, S. D. Snyder, S. Martin, C. Heiss, P. Azadi, M. G. Surette, and W. W. Kay. 2006. Salmonella produces an O-antigen capsule regulated by AgfD and important for environmental persistence. J. Bacteriol. 188:7722-7730.[Abstract/Free Full Text]
  52. 27
  53. Hammar, M., A. Arnqvist, Z. Bian, A. Olsen, and S. Normark. 1995. Expression of two csg operons is required for production of fibronectin- and Congo red-binding curli polymers in Escherichia coli K-12. Mol. Microbiol. 18:661-670.[CrossRef][Medline]
  54. 28
  55. Hartwell, L. H., J. J. Hopfield, S. Leibler, and A. W. Murray. 1999. From molecular to modular cell biology. Nature 402:C47-52.[CrossRef][Medline]
  56. 29
  57. Hashimoto-Gotoh, T., F. C. Franklin, A. Nordheim, and K. N. Timmis. 1981. Specific-purpose plasmid cloning vectors. I. Low copy number, temperature-sensitive, mobilization-defective pSC101-derived containment vectors. Gene 16:227-235.[CrossRef][Medline]
  58. 30
  59. Hiramatsu, R., M. Matsumoto, K. Sakae, and Y. Miyazaki. 2005. Ability of Shiga toxin-producing Escherichia coli and Salmonella spp. to survive in a desiccation model system and in dry foods. Appl. Environ. Microbiol. 71:6657-6663.[Abstract/Free Full Text]
  60. 31
  61. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68.[CrossRef][Medline]
  62. 32
  63. Hu, H., R. Lan, and P. R. Reeves. 2006. Adaptation of multilocus sequencing to study variation within a major clone: evolutionary relationships of Salmonella enterica serovar Typhimurium. Genetics 172:743-750.[Abstract/Free Full Text]
  64. 33
  65. Huang, K. J., and M. M. Igo. 1996. Identification of the bases in the ompF regulatory region which interact with the transcription factor OmpR. J. Mol. Biol. 262:615-628.[CrossRef][Medline]
  66. 34
  67. Jorgensen, F., S. Leach, S. J. Wilde, A. Davies, G. S. Stewart, and T. Humphrey. 2000. Invasiveness in chickens, stress resistance and RpoS status of wild-type Salmonella enterica subsp. enterica serovar typhimurium definitive type 104 and serovar enteritidis phage type 4 strains. Microbiology 146 Pt. 12:3227-3235.[Abstract/Free Full Text]
  68. 35
  69. Jubelin, G., A. Vianney, C. Beloin, J. M. Ghigo, J. C. Lazzaroni, P. Lejeune, and C. Dorel. 2005. CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli. J. Bacteriol. 187:2038-2049.[Abstract/Free Full Text]
  70. 36
  71. Kimura, S., H. P. Chen, I. M. Saxena, R. M. Brown, Jr., and T. Itoh. 2001. Localization of c-di-GMP-binding protein with the linear terminal complexes of Acetobacter xylinum. J. Bacteriol. 183:5668-5674.[Abstract/Free Full Text]
  72. 37
  73. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5:150-163.[Abstract/Free Full Text]
  74. 38
  75. Latasa, C., A. Roux, A. Toledo-Arana, J. Ghigo, C. Gamazo, J. R. Penadés, and I. Lasa. 2005. BapA, a large secreted protein required for biofilm formation and host colonization of Salmonella enterica serovar Enteritidis. Mol. Microbiol. 58:1522-1539.
  76. 39
  77. Lisser, S., and H. Margalit. 1993. Compilation of E. coli mRNA promoter sequences. Nucleic Acids Res. 21:1507-1516.[Abstract/Free Full Text]
  78. 40
  79. Mahajan, R. K., S. A. Khan, D. S. Chandel, N. Kumar, C. Hans, and R. Chaudhry. 2003. Fatal case of Salmonella enterica subsp. arizonae gastroenteritis in an infant with microcephaly. J. Clin. Microbiol. 41:5830-5832.[Abstract/Free Full Text]
  80. 41
  81. McClelland, M., K. E. Sanderson, S. W. Clifton, P. Latreille, S. Porwollik, A. Sabo, R. Meyer, T. Bieri, P. Ozersky, M. McLellan, C. R. Harkins, C. Wang, C. Nguyen, A. Berghoff, G. Elliott, S. Kohlberg, C. Strong, F. Du, J. Carter, C. Kremizki, D. Layman, S. Leonard, H. Sun, L. Fulton, W. Nash, T. Miner, P. Minx, K. Delehaunty, C. Fronick, V. Magrini, M. Nhan, W. Warren, L. Florea, J. Spieth, and R. K. Wilson. 2004. Comparison of genome degradation in Paratyphi A and Typhi, human-restricted serovars of Salmonella enterica that cause typhoid. Nat. Genet. 36:1268-1274.[CrossRef][Medline]
  82. 42
  83. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856.[CrossRef][Medline]
  84. 43
  85. Olsen, A., A. Jonsson, and S. Normark. 1989. Fibronectin binding mediated by a novel class of surface organelles on Escherichia coli. Nature 338:652-655.[CrossRef][Medline]
  86. 44
  87. Parkhill, J., G. Dougan, K. D. James, N. R. Thomson, D. Pickard, J. Wain, C. Churcher, K. L. Mungall, S. D. Bentley, M. T. Holden, M. Sebaihia, S. Baker, D. Basham, K. Brooks, T. Chillingworth, P. Connerton, A. Cronin, P. Davis, R. M. Davies, L. Dowd, N. White, J. Farrar, T. Feltwell, N. Hamlin, A. Haque, T. T. Hien, S. Holroyd, K. Jagels, A. Krogh, T. S. Larsen, S. Leather, S. Moule, P. O'Gaora, C. Parry, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848-852.[CrossRef][Medline]
  88. 45
  89. Porwollik, S., R. M. Wong, and M. McClelland. 2002. Evolutionary genomics of Salmonella: gene acquisitions revealed by microarray analysis. Proc. Natl. Acad. Sci. USA 99:8956-8961.[Abstract/Free Full Text]
  90. 46
  91. Prigent-Combaret, C., E. Brombacher, O. Vidal, A. Ambert, P. Lejeune, P. Landini, and C. Dorel. 2001. Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene. J. Bacteriol. 183:7213-7223.[Abstract/Free Full Text]
  92. 47
  93. Robbe-Saule, V., G. Algorta, I. Rouilhac, and F. Norel. 2003. Characterization of the RpoS status of clinical isolates of Salmonella enterica. Appl. Environ. Microbiol. 69:4352-4358.[Abstract/Free Full Text]
  94. 48
  95. Robbe-Saule, V., V. Jaumouille, M. C. Prevost, S. Guadagnini, C. Talhouarne, H. Mathout, A. Kolb, and F. Norel. 2006. Crl activates transcription initiation of RpoS-regulated genes involved in the multicellular behavior of Salmonella enterica serovar Typhimurium. J. Bacteriol. 188:3983-3994.[Abstract/Free Full Text]
  96. 49
  97. Romling, U., Z. Bian, M. Hammar, W. D. Sierralta, and S. Normark. 1998. Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J. Bacteriol. 180:722-731.[Abstract/Free Full Text]
  98. 50
  99. Romling, U., W. Bokranz, W. Rabsch, X. Zogaj, M. Nimtz, and H. Tschape. 2003. Occurrence and regulation of the multicellular morphotype in Salmonella serovars important in human disease. Int. J. Med. Microbiol. 293:273-285.[CrossRef][Medline]
  100. 51
  101. Romling, U., M. Rohde, A. Olsen, S. Normark, and J. Reinkoster. 2000. AgfD, the checkpoint of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least two independent pathways. Mol. Microbiol. 36:10-23.[CrossRef][Medline]
  102. 52
  103. Romling, U., W. D. Sierralta, K. Eriksson, and S. Normark. 1998. Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfD promoter. Mol. Microbiol. 28:249-264.[CrossRef][Medline]
  104. 53
  105. Sakellaris, H., N. K. Hannink, K. Rajakumar, D. Bulach, M. Hunt, C. Sasakawa, and B. Adler. 2000. Curli loci of Shigella spp. Infect. Immun. 68:3780-3783.[Abstract/Free Full Text]
  106. 54
  107. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  108. 55
  109. Scher, K., U. Romling, and S. Yaron. 2005. Effect of heat, acidification, and chlorination on Salmonella enterica serovar Typhimurium cells in a biofilm formed at the air-liquid interface. Appl. Environ. Microbiol. 71:1163-1168.[Abstract/Free Full Text]
  110. 56
  111. Solano, C., B. Garcia, J. Valle, C. Berasain, J. M. Ghigo, C. Gamazo, and I. Lasa. 2002. Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol. Microbiol. 43:793-808.[CrossRef][Medline]
  112. 57
  113. Solomon, E. B., B. A. Niemira, G. M. Sapers, and B. A. Annous. 2005. Biofilm formation, cellulose production, and curli biosynthesis by Salmonella originating from produce, animal, and clinical sources. J. Food Prot. 68:906-912.[Medline]
  114. 58
  115. Spiers, A. J., J. Bohannon, S. M. Gehrig, and P. B. Rainey. 2003. Biofilm formation at the air-liquid interface by the Pseudomonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. Mol. Microbiol. 50:15-27.[CrossRef][Medline]
  116. 59
  117. Spiers, A. J., S. G. Kahn, J. Bohannon, M. Travisano, and P. B. Rainey. 2002. Adaptive divergence in experimental populations of Pseudomonas fluorescens. I. Genetic and phenotypic bases of wrinkly spreader fitness. Genetics 161:33-46.[Abstract/Free Full Text]
  118. 60
  119. Sutton, A., R. Buencamino, and A. Eisenstark. 2000. rpoS mutants in archival cultures of Salmonella enterica serovar Typhimurium. J. Bacteriol. 182:4375-4379.[Abstract/Free Full Text]
  120. 61
  121. Townsend, S. M., N. E. Kramer, R. Edwards, S. Baker, N. Hamlin, M. Simmonds, K. Stevens, S. Maloy, J. Parkhill, G. Dougan, and A. J. Baumler. 2001. Salmonella enterica serovar Typhi possesses a unique repertoire of fimbrial gene sequences. Infect. Immun. 69:2894-2901.[Abstract/Free Full Text]
  122. 62
  123. Uhlich, G. A., J. E. Keen, and R. O. Elder. 2001. Mutations in the csgD promoter associated with variations in curli expression in certain strains of Escherichia coli O157:H7. Appl. Environ. Microbiol. 67:2367-2370.[Abstract/Free Full Text]
  124. 63
  125. Vianney, A., G. Jubelin, S. Renault, C. Dorel, P. Lejeune, and J. C. Lazzaroni. 2005. Escherichia coli tol and rcs genes participate in the complex network affecting curli synthesis. Microbiology 151:2487-2497.[Abstract/Free Full Text]
  126. 64
  127. Walsh, P. S., D. A. Metzger, and R. Higuchi. 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 10:506-513.[Medline]
  128. 65
  129. White, A. P., E. Allen-Vercoe, B. W. Jones, R. DeVinney, W. W. Kay, and M. G. Surette. An efficient system for markerless gene replacement applicable in a wide variety of enterobacterial species. Can. J. Microbiol., in press.
  130. 66
  131. White, A. P., S. K. Collinson, J. Burian, S. C. Clouthier, P. A. Banser, and W. W. Kay. 1999. High efficiency gene replacement in Salmonella enteritidis: chimeric fimbrins containing a T-cell epitope from Leishmania major. Vaccine 17:2150-2161.[CrossRef][Medline]
  132. 67
  133. White, A. P., D. L. Gibson, S. K. Collinson, P. A. Banser, and W. W. Kay. 2003. Extracellular polysaccharides associated with thin aggregative fimbriae of Salmonella enterica serovar Enteritidis. J. Bacteriol. 185:5398-5407.[Abstract/Free Full Text]
  134. 68
  135. White, A. P., D. L. Gibson, W. Kim, W. W. Kay, and M. G. Surette. 2006. Thin aggregative fimbriae and cellulose enhance long-term survival and persistence of Salmonella. J. Bacteriol. 188:3219-3227.[Abstract/Free Full Text]
  136. 69
  137. Zogaj, X., W. Bokranz, M. Nimtz, and U. Romling. 2003. Production of cellulose and curli fimbriae by members of the family Enterobacteriaceae isolated from the human gastrointestinal tract. Infect. Immun. 71:4151-4158.[Abstract/Free Full Text]
  138. 70
  139. Zogaj, X., M. Nimtz, M. Rohde, W. Bokranz, and U. Romling. 2001. The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39:1452-1463.[CrossRef][Medline]


Journal of Bacteriology, December 2006, p. 8395-8406, Vol. 188, No. 24
0021-9193/06/$08.00+0     doi:10.1128/JB.00798-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Jeon, J., Kim, H., Yun, J., Ryu, S., Groisman, E. A., Shin, D. (2008). RstA-Promoted Expression of the Ferrous Iron Transporter FeoB under Iron-Replete Conditions Enhances Fur Activity in Salmonella enterica. J. Bacteriol. 190: 7326-7334 [Abstract] [Full Text]  
  • White, A. P., Gibson, D. L., Grassl, G. A., Kay, W. W., Finlay, B. B., Vallance, B. A., Surette, M. G. (2008). Aggregation via the Red, Dry, and Rough Morphotype Is Not a Virulence Adaptation in Salmonella enterica Serovar Typhimurium. Infect. Immun. 76: 1048-1058 [Abstract] [Full Text]  
  • Stocki, S. L., Annett, C. B., Sibley, C. D., McLaws, M., Checkley, S. L., Singh, N., Surette, M. G., White, A. P. (2007). Persistence of Salmonella on Egg Conveyor Belts Is Dependent on the Belt Type but Not on the rdar Morphotype. Poult. Sci. 86: 2375-2383 [Abstract] [Full Text]  
  • Cabeza, M. L., Aguirre, A., Soncini, F. C., Vescovi, E. G. (2007). Induction of RpoS Degradation by the Two-Component System Regulator RstA in Salmonella enterica. J. Bacteriol. 189: 7335-7342 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, A. P.
Right arrow Articles by Surette, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, A. P.
Right arrow Articles by Surette, M. G.