This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by St. John, F. J.
Right arrow Articles by Preston, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by St. John, F. J.
Right arrow Articles by Preston, J. F.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2006, p. 8617-8626, Vol. 188, No. 24
0021-9193/06/$08.00+0     doi:10.1128/JB.01283-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan{triangledown}

Franz J. St. John, John D. Rice, and James F. Preston*

Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida

Received 14 August 2006/ Accepted 28 September 2006


arrow
ABSTRACT
 
Secretion of xylanase activities by Bacillus subtilis 168 supports the development of this well-defined genetic system for conversion of methylglucuronoxylan (MeGAXn [where n represents the number of xylose residues]) in the hemicellulose component of lignocellulosics to biobased products. In addition to the characterized glycosyl hydrolase family 11 (GH 11) endoxylanase designated XynA, B. subtilis 168 secretes a second endoxylanase as the translated product of the ynfF gene. This sequence shows remarkable homology to the GH 5 endoxylanase secreted by strains of Erwinia chrysanthemi. To determine its properties and potential role in the depolymerization of MeGAXn, the ynfF gene was cloned and overexpressed to provide an endoxylanase, designated XynC, which was characterized with respect to substrate preference, kinetic properties, and product formation. With different sources of MeGAXn as the substrate, the specific activity increased with increasing methylglucuronosyl substitutions on the ß-1,4-xylan chain. With MeGAXn from sweetgum as a preferred substrate, XynC exhibited a Vmax of 59.9 units/mg XynC, a Km of 1.63 mg MeGAXn/ml, and a kcat of 2,635/minute at pH 6.0 and 37°C. Matrix-assisted laser desorption ionization—time of flight mass spectrometry and 1H nuclear magnetic resonance data revealed that each hydrolysis product has a single glucuronosyl substitution penultimate to the reducing terminal xylose. This detailed analysis of XynC from B. subtilis 168 defines the unique depolymerization process catalyzed by the GH 5 endoxylanases. Based upon product analysis, B. subtilis 168 secretes both XynA and XynC. Expression of xynA was subject to MeGAXn induction; xynC expression was constitutive with growth on different substrates. Translation and secretion of both GH 11 and GH 5 endoxylanases by the fully sequenced and genetically malleable B. subtilis 168 recommends this bacterium for the introduction of genes required for the complete utilization of products of the enzyme-catalyzed depolymerization of MeGAXn. B. subtilis may serve as a model platform for development of gram-positive biocatalysts for conversion of lignocellulosic materials to renewable fuels and chemicals.


arrow
INTRODUCTION
 
Biocatalyst production of value-added products and fuel ethanol from lignocellulosics is being developed as an alternative to traditional chemical synthesis methods (24, 28, 39, 54, 59, 65). Hardwood and crop residues are attractive underutilized lignocellulosic resources which could be used for the generation of fermentable hexoses and pentoses, the former resulting from the cellulose fraction as glucose and the latter from the hemicellulose fraction as xylose with minor amounts of arabinose. The primary component of hemicellulose in hardwood and crop residue is 4-O-methyl-D-glucuronoxylan (MeGAXn [where n represents the number of xylose residues]), in which xylose residues in the ß-D-1,4-xylan polymer are substituted periodically with {alpha}-1,2-linked 4-O-methyl-D-glucuronopyranosyl (MeGA) residues (27, 49, 61). Significant limitations with current lignocellulose bioconversion lie in the pretreatment process required to liberate utilizable sugars from the complex hemicellulose fraction, and there is increasing interest in developing endoxylanases to enhance the release of fermentable pentoses (49). Enzyme systems in gram-positive spore-forming bacteria, e.g., Geobacillus stearothermophilus (55) and Paenibacillus sp. strain JDR-2 (58; G. Nong, V. Chow, J. D. Rice, F. St. John, and J. F. Preston, Abstr. 105th Gen. Meet. Am. Soc. Microbiol. 2005, abstr. O-055, 2005), that allow efficient depolymerization and assimilation of MeGAXn and complete catabolism of xylose and MeGA have been identified. The expression of these MeGAXn utilization systems in microorganisms is needed to develop biocatalysts for the efficient conversion of the hemicellulose fraction to biobased products and alternative fuels.

Genomic review of Bacillus subtilis 168 reveals the presence of genes encoding enzymes which participate in the degradation of plant cell wall polysaccharides (http://afmb.cnrs-mrs.fr/CAZY/). To characterize the ability of B. subtilis 168 to utilize MeGAXn and determine a starting point for engineering of MeGAXn utilization enzyme systems, we assessed the genomic data available for possible MeGAXn hydrolytic enzymes. We found no protein homolog for a glycosyl hydrolase family 10 (GH 10) ß-xylanase or a GH 67 {alpha}-glucuronidase, both of which are presumed to be required for complete utilization of MeGAXn (49, 55, 58). The xynA gene in B. subtilis 168 has been shown to encode a GH 11 xylanase, XynA (19, 36). Members of this family are known to generate xylobiose and xylotriose, along with the aldopentauronate 4-O-methylglucuronosyl-{alpha}-1,2-xylotetraose (MeGAX4), in which the MeGA is linked to a xylose residue penultimate to the nonreducing terminus (2). MeGAX4 is not known to be assimilated and metabolized without the removal of the xylose residue at the nonreducing terminus first (41, 42, 45). Further review also identified the ynfF gene in the B. subtilis 168 genome. The translated protein product of this gene has 40% identity and 60% similarity to XynA of Erwinia chrysanthemi D1, a GH 5 endoxylanase that has been well characterized (23, 35, 49).

Reports on the occurrence of GH 5 xylanases are not as prevalent as those on GH 10 and GH 11 xylanases, which have been extensively studied (2, 11, 22, 47). Just like GH 10 and GH 11 xylanases, they are presumed to function through a pair of glutamate residues catalyzing hydrolysis by a double-displacement mechanism with retention of anomeric configuration (17, 35). Although their general protein fold is the same as those found for other GH 5-categorized glycosyl hydrolases (20-22), GH 5 xylanases are more similar in primary sequence to GH 30 hydrolases (12). Recently, the first crystal structure of a GH 5 xylanase was published (35). The catalytic domain (CD) contains an {alpha}8 barrel similar to that in the GH 10 xylanases, but closely associated with this domain is a putative carbohydrate binding module (CBM). The ß-sheet structure of the CBM is formed with N-terminal and C-terminal regions, suggesting that the CD and CBM may function synchronously together, rather than having a simple spatial relationship that has been suggested for many other CD and CBM associations (4).

Unlike GH 10 and GH 11 xylanases, GH 5 xylanases have not been linked to the process of MeGAXn degradation and utilization in microbial ecosystems. XynA from the well-characterized pectinolytic phytopathogen Erwinia chrysanthemi D1 was suggested to facilitate access to the pectin component of biomass (7, 23). This XynA showed activity that correlated directly to the degree of substitution (DS) of the glucuronosyl moiety, and that reduction of the carboxyl carbon of MeGA greatly reduced XynA activity, suggesting a role for the MeGA substitution in directing the recognition of the substrate by the enzyme (23). Products resulting from sweetgum wood MeGAXn (SG MeGAXn) hydrolysis by XynA contained a single MeGA moiety as determined by 13C nuclear magnetic resonance (NMR) and biochemical analysis, but early matrix-assisted laser desorption ionization—time of flight mass spectrometry (MALDI-TOF MS) results were difficult to reconcile and interpretation predicted two MeGA substitutions per hydrolysis product (23). Xylanases with sequences homologous to the defined sequence of GH 5 in Erwinia chrysanthemi have been reported, although characterization has been limited with respect to substrate specificities and product formation (25, 46, 60). An earlier report (44) described a 42-kDa xylanase (XynC is 43.9 kDa) purified from a commercial B. subtilis enzyme preparation (Novo Ban L-120). Hydrolysis product analysis comparisons to our observations here suggest that it may have been a GH 5 xylanase with properties similar to those of XynC of B. subtilis 168. In the absence of sequence data and the identity of the B. subtilis strain that served as its source, we are unable to conclude that it was homologous to XynC.

In this study, we expressed and characterized the ynfF gene product (XynC) from B. subtilis 168. This is the second characterization of a true GH 5 xylanase showing no activity on carboxymethyl cellulose (12), and the first complete characterization of an endoxylanase classified as a member of glycosyl hydrolase family 5 from a gram-positive bacterium. The secretion of both XynA and XynC and the utilization of xylooligosaccharides for growth make B. subtilis an attractive candidate to genetically transform and define the requirements for the complete utilization of MeGAXn for conversion to biobased products.


arrow
MATERIALS AND METHODS
 
B. subtilis 168 ynfF cloning and XynC purification. Bacillus subtilis subsp. subtilis strain 168 was obtained from the Bacillus Genetic Stock Center (http://www.bgsc.org). Genomic DNA from overnight cultures grown in Luria-Bertani (LB) broth at 37°C with shaking was extracted using a DNeasy tissue kit (QIAGEN, Valencia, CA). The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). The 5' primer (TTCCATGGCAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) (1) and create an in-frame fusion behind the affinity purification tags of pET 41. The 3' primer (GTTCTCGAGTTAACGATTTACAACAAATGTTGT) contained the last few nucleotides of ynfF, including the stop codon. The expression construct (pET41ynfF#1) contains a glutathione S-transferase (GST) tag, a His tag, a thrombin cleavage site, an S tag, an enterokinase cleavage site, and the ynfF gene which was verified by sequencing. The pET41ynfF#1 construct was introduced into chemically competent Escherichia coli Rosetta (DE3) (EMD Biosciences) and grown overnight at 37°C on LBKC medium (LB agar plates containing 30 µg kanamycin/ml and 34 µg chloramphenicol/ml). Transformants grown on LBKC medium at 35°C were induced with 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) when the optical density at 600 nm reached 0.6 to 0.7 and were processed for XynC purification as recommended in the pET system manual, 10th ed. (EMD Biosciences). Expressed fusion protein was isolated using a HiTrap HP metal-chelating column in the nickel form as per the method outlined in the HiTrap Chelating HP instruction manual (GE Healthcare Bio-Sciences). Xylanase activity was localized in the elution buffer fraction containing 500 mM sodium chloride, 500 mM imidazole, and 20 mM sodium phosphate, pH 7.4. To minimize protein precipitation associated with rapid desalting of this particular protein, the fraction was dialyzed in 10,000 molecular weight cutoff tubing (Pierce Biotechnology) in a five-step series in which the elution buffer was successively diluted twofold with 50 mM Tris-HCl, pH 7.4, at 45-min intervals. The resulting fraction was further dialyzed with two twofold-volume dilutions from the 50 mM Tris-HCl (pH 7.4) and enterokinase cleavage buffer (20 mM Tris-HCl, pH 7.4, 50 mM NaCl, 2 mM CaCl2) and finally with undiluted enterokinase cleavage buffer. Following overnight digestion with enterokinase at room temperature and filtration through a 0.45-µm filter, the preparation was dialyzed against GST-Bind buffer (4.3 mM Na2HPO4, 1.47 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl [pH 7.3]), the GST tag removed with GST-Bind agarose beads, and site-specific protease enterokinase removed with EKapture agarose (EMD Biosciences) equilibrated in GST-Bind buffer. At each step, protein concentrations were determined (6) by using bovine serum albumin (fraction V) as the standard, purity was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis (34), and xylanase activity was determined as described below. The final product was stored at 4°C on ice and exhibited no loss of activity after 11 months.

MeGAXn substrate preparation and carbohydrate analysis. MeGAXn was isolated from sweetgum wood as previously described (29) and characterized by 13C NMR (30). Birch and beech wood xylans were obtained from Sigma-Aldrich. MeGAXn was prepared from these xylans by solubilization of 20 mg (dry weight) xylan/ml deionized water for 5 h at 50°C to 60°C and centrifuged at 30,000 x g for 25 min at room temperature. Supernatants were decanted for carbohydrate analysis and use as reaction substrates. Xylose standards were used for total carbohydrate measurements (13) and determination of reducing termini (43). D-Glucuronic acid standards were used for total uronic acid determination (3). The degree of polymerization (DP) and the degree of uronic acid substitution for each substrate were determined. Xylanolytic activities of XynC toward these substrates were compared using the optimized reaction conditions for SG MeGAXn described below.

Optimization of activity and kinetic evaluation of XynC. XynC activity was determined by measuring the increase in reducing termini (43) resulting from depolymerization of SG MeGAXn substrate (10 mg substrate/ml). Reaction mixtures containing 250 µl substrate in 50 mM potassium phosphate or 50 mM sodium acetate with 200 ng XynC were run from pH 5.0 through pH 6.5 at 37°C. The temperature optimum under the conditions used was determined with reactions in 50 mM sodium acetate, pH 6.0, over the range from 50°C through 70°C. Specific activities are given as units/mg XynC, where one unit equals one micromole of reducing termini generated per minute. The kinetic analyses were determined from 250-µl reaction mixes containing 200 ng XynC in 50 mM sodium acetate, pH 6.0, with SG MeGAXn as substrate at 37°C. Kinetic analysis was performed by the method of Lineweaver and Burk (37). Thermal stability assays were conducted with 250-µl reaction mixes containing 2.5 mg SG MeGAXn and 150 ng XynC in 50 mM sodium acetate, pH 6.0, between 30°C and 60°C. Aliquots were sampled four times in the first hour with decreasing sampling frequencies through 60 h of incubation.

XynC catalyzed depolymerization of MeGAXn for product analysis. A batch reaction mixture of 20 ml consisting of 50 mg SG MeGAXn/ml in 50 mM sodium acetate, pH 6.0, was prepared. The reaction was initiated by the addition of 1 unit of XynC in a volume of 100 µl and maintained for 18 h at 30°C with slow vertical rotation on a roller drum-type rotator. The digest was processed by collecting consecutive filtrates from a Centriprep YM-3 centrifugal filter device (Millipore, Billerica, MA) by centrifugation at 2,000 x g at 20°C in one-hour intervals. After every other centrifugation, the volume in the filter unit was refilled to 15 ml with deionized water and filtrates combined to a total volume of 15 ml. Four 15-ml filtrate fractions, as well as a final 6-ml filtrate fraction, were collected. The resulting retentate was heated to 70°C for 15 min to inactivate XynC and was further processed twice by diluting to 50 ml with deionized water and concentrating in a 50-ml stir cell (Millipore, Billerica, MA) with a YM-3 membrane. The first recovered 15-ml filtrate from the Centriprep YM-3 concentrator (YM-3 filtrate) and the final washed retentate (YM-3 retentate) are the primary foci of the studies reported here. To verify compatibility of XynC with YM-3 membranes, which are made of regenerated cellulose acetate, XynC was checked for endogluconase activity by using carboxymethyl cellulose as the substrate. No activity was detected.

MALDI-TOF MS analysis of XynC-generated MeGAXn hydrolysis products. Samples for MALDI-TOF MS analysis were prepared as described previously (53), using a solution of DHBA (2,5-dihydroxybenzoic acid) dissolved to 2.5 mg/ml in 50% acetonitrile. Carbohydrate solutions, 1 to 2 mg/ml containing 0.1% trifluoroacetic acid, were prepared just prior to analysis, mixed with an equal volume of DHBA solution, and spotted (1 µl) onto the MALDI-TOF MS plate. Mass spectra were collected using Voyager-DE Pro (Applied Biosystems, Foster City, CA) at the University of Florida Protein Core facility. The mass spectrometer was set for positive polarity in the reflector mode and the acceleration voltage set to 18,000 V with a laser intensity of 2,500. Data were converted into ASCII format and analyzed in Excel.

NMR analysis of XynC-generated MeGAXn hydrolysis products. Samples for 1H NMR were prepared by three successive dissolutions in 4 ml 99.9 atom% D2O (Sigma-Aldrich), each with subsequent lyophilization. Each time the lyophilized MeGAXn XynC hydrolysate residue was dissolved in D2O, it was warmed to 50°C for 15 min to enhance 1H displacement with deuterium. Final carbohydrate samples were prepared by dissolving the lyophilized carbohydrate powder to a concentration of 15 mg/ml in D2O. To 750 µl of these preparations, 2.5 µl of acetone was added as the reference, and the final samples were transferred to 505-PS NMR tubes (Wilmad, Buena, NJ). 1H NMR data collection was performed using a Bruker Avance 500 MHz spectrometer with a 5-mm TXI probe at the Advanced Magnetic Resonance Imaging and Spectroscopy facility at the McKnight Brain Institute, University of Florida. NMR data were analyzed and images prepared using Nuts Lite (Acorn NMR Inc., Livermore, CA).

Fractionation and analysis of xylanase activities secreted by B. subtilis 168. A single colony of B. subtilis 168 from an overnight LB agar plate was inoculated into 25 ml of 1% yeast extract (YE), Spizizen salts (56) in a 250-ml baffle flask and grown for 15 h at 37°C with rotation on a New Brunswick G-2 gyratory shaker at 200 rpm. Twenty milliliters of this culture was inoculated into a Fernbach flask containing 1 liter of prewarmed medium and incubated as described above until an optical density of 600 nm of approximately 1.5 absorbance units was obtained. Cells were removed by centrifugation at 13,200 x g for 20 min at 4°C. The supernatant was filtered through a 0.45-µm filter and 1 ml of protease inhibitor cocktail for bacterial cell extracts (Sigma, St. Louis, MO) added. This preparation was concentrated/dialyzed using a 350-ml Amicon stir cell with a YM-3 membrane (Millipore, Billerica, MA) with 20 mM sodium phosphate, pH 6.0, containing 150 mM NaCl. The YM-3 retentate (B. subtilis spent medium concentrate [BSC]) was concentrated to less than 5 ml and loaded onto a calibrated BioGel P-60 chromatography column (60 cm by 0.75 cm) in the buffer system described above. Fractions comprising two peaks of xylanase activity (fraction A and fraction B) were concentrated/dialyzed separately to less than 1 ml against 20 mM sodium phosphate, pH 6.0, with Amicon YM-3 centrifugal filtration devices (Millipore, Billerica, MA). Equal volumes of each fraction were reacted with 20 mg SG MeGAXn/ml in 50 mM sodium acetate, pH 6.0, and incubated overnight at 37°C. Thin-layer chromatography (TLC) was performed as previously described (5, 58). Controls for TLC included undigested SG MeGAXn, SG MeGAXn digested with recombinantly expressed XynC (330-nmol xylose equivalents loaded for samples and controls), MeGAX1 to MeGAX4 oligomers, and xylooligomers with one to four xyloses (25-nmol xylose equivalents for each oligomer).

Quantification of levels of xylanase transcripts by Q-RT-PCR. Primers for quantitative reverse transcriptase PCR (Q-RT-PCR) were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) (52) with simultaneous secondary structure analysis using mfold (http://www.bioinfo.rpi.edu/applications/mfold/) to avoid DNA secondary structure in priming sites (66). Primers of approximately 20 nucleotides were designed to have an annealing temperature of 60°C, and mfold secondary structure modeling was performed at 59°C under simulated conditions normal for PCR (50 mM Na+ and 3 mM Mg2+). All primer pairs yielded efficiencies between 85% and 95%, and all amplicons were less than 200 bp. High-quality genomic DNA of B. subtilis 168 was obtained for use in making primer set standard curves (63). Standard curves were prepared from 102 to 106 gene copies for all genes. The reference genes were extended to 108 copies based on their possible relative level to the genes of interest. All RT data collections were performed using an iCycler (Bio-Rad Laboratories, Hercules, CA). For primer set optimization and standard curve analysis, iQ SYBR green supermix was used, and for Q-RT-PCR, the iScript one-step RT-PCR kit (Bio-Rad Laboratories) was used. Reaction volumes were 16 µl for both kits. Cultures for RNA extraction (25 ml) contained glucose, arabinose, arabinose and xylose, SG MeGAXn, or Birch MeGAXn at 0.5% (xylose was at 0.28%) supplemented with 0.1% YE and 0.005% tryptophan in Spizizen minimal salt base (56). RNA was extracted from early- to mid-log-phase cultures by using an RNeasy RNA extraction kit (QIAGEN, Valencia, CA), treated with RQ1 DNase (Promega, Madison, WI) and repurified using an RNeasy column. RNA (10 ng) without reverse transcriptase treatment was used to amplify the rpoA gene to check for DNA contamination. All data obtained from Q-RT-PCR were based on a 10-ng RNA starting quantity as determined by absorbance at 260 nm. The housekeeping genes rpoA and atpA were used to provide a reference for relative expression in response to glucose and xylan, using triplicate measurements of each growth condition averaged together. Threshold values for atpA under all conditions averaged 17.37 (cycle threshold [CT]) with a standard deviation of 0.31. For the rpoA gene, the CT average was 15.53 with a standard deviation of 0.53. Transcript data were analyzed with Gene Expression Macro V1.1 software available through Bio-Rad (http://www.Bio-Rad.com/LifeScience/jobs/2004/04-0684/genex.xls) (38, 64).


arrow
RESULTS
 
Cloning, overexpression, and characterization of XynC. Following cloning and expression in pET 41, protein was produced in quantities sufficient for enzyme purification. The N-terminal His tag was used for affinity purification and resulted in a protein which was relatively insoluble at low ionic strengths. Qualitatively, solubility was maintained in tertiary amine buffers, such as 50 mM Tris-HCl or imidazole, containing 20 mM NaCl. After enterokinase protease release of the affinity tag fusion product from XynC, there were no further apparent problems with solubility.

Optimization of reaction conditions and kinetic evaluation of XynC. The relationship between activity and pH showed similarly broad optima of pH 6 with 50 mM potassium phosphate or 50 mM sodium acetate buffers (Fig. 1A). The relationship between temperature and activity (Fig. 1B) showed that the maximum amount of reducing terminus formation for a 15-min digestion was obtained at 65°C. The relationship between stability and temperature was evaluated by half-life stability analysis (Fig. 1C), with half the activity retained for 25 h at 40°C and for 5 h at 50°C. All further studies, including kinetic analyses, were performed at 37°C in 50 mM sodium acetate, pH 6.0, for 15 min with 0.012 units (200 ng) XynC.


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 1. Optimization of XynC was performed using standard reaction conditions described in Materials and Methods. Buffer and pH conditions were optimized and were applied for determination of the optimal reaction temperature and half-life analyses. These results were used to define the reaction conditions for kinetic analysis. (A) Buffer and pH optimization using 50 mM buffers with a pH between 5.0 and 6.5. Diamonds, potassium phosphate; squares, sodium acetate. (B) Temperature optimization using 50 mM sodium acetate, pH 6.0. (C) Half-life analysis determined by preincubating XynC at the specified temperatures and measuring remaining activity over time. Data are presented as the half-lives obtained from the linear regression of inactivation at each temperature. (D) Lineweaver-Burk kinetic analysis was based on a reaction velocity versus substrate concentration data set which was fit to a logarithmic equation.

Kinetic analysis (Fig. 1D) of XynC using SG MeGAXn as the substrate showed it to have a Km of 1.63 mg/ml and a Vmax of 59.5 units/mg XynC, which correspond to a kcat of 2,635/minute. As seen in Table 1, measurements of XynC activity on different MeGAXn sources indicate that activity is directly correlated to the degree of substitution of the glucuronosyl moiety on the xylan chain.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Relationship of XynC activity to the degree of MeGA substitution on MeGAXn

Mass analysis of SG MeGAXn XynC hydrolysis products. YM-3 filtrate and retentate fractions of the SG MeGAXn XynC hydrolysate were analyzed by MALDI-TOF MS. As shown in Fig. 2, clusters of peaks were observed, with each cluster being a defined aldouronate with the individual peaks being some salt adduct form of the specific aldouronate. Table 2 lists the mass-to-charge ratios and designated products along with the ion adducts. In each case, the species with a single Na adduct was the most prominent. Based upon these assignments, the YM-3 filtrate and YM-3 retentate fractions contain detectable xylooligosaccharides ranging in DP from 4 to 12 and from 4 to 20, respectively, each with a single MeGA substitution. There was no evidence for the presence of unsubstituted xylooligosaccharides in these fractions.


Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 2. MALDI-TOF MS analysis of the YM-3 filtrate (A) and YM-3 retentate (B) resulting from 3-kDa ultrafiltration of an SG MeGAXn XynC digest. Peak m/z values were tabulated and show that each cluster of peaks is composed of various single- and double-salt adducts which differ from the previous cluster by a single xylose residue. Each chemical species is composed of the designated number of xylose residues containing a single MeGA residue. Complements of different sodium and/or potassium adducts comprise designated clusters.


View this table:
[in this window]
[in a new window]

 
TABLE 2. MALDI-TOF peak assignments

NMR analysis of SG MeGAXn XynC hydrolysis products. Analysis of the YM-3 filtrate fraction by 1H NMR (Fig. 3A) yielded the expected distribution of peaks based on previous proton shift assignments for similar xylooligomers substituted with methylglucuronosyl residues (8, 15, 30). The integration ratio of the signals for the proton on carbon five of the MeGA, the proton on carbon five of the nonreducing xylose, and the proton on carbon one of the reducing xylose ({alpha} and ß configurations) was 1.0:1.1:0.9, establishing that the products of XynC depolymerization contained a single MeGA moiety {alpha}-1,2 linked to ß-1,4-xylooligosaccharides. The signals ascribed to the proton of carbon one for the MeGA residue ({alpha}/ß-U1) appear as two doublets, the first at 5.31 and 5.30 ppm and the second at 5.29 and 5.28 ppm. The integrated ratio for these two doublets is 0.23:0.77. This is nearly identical to the {alpha}/ß intensity split of 0.26:0.74 for the integrated signals from the proton on the {alpha} anomer of carbon one (doublet at 5.18 and 5.17 ppm) and the proton on the ß anomer of carbon one (doublet at 4.58 ppm and 4.63 ppm) for the reducing terminal xylose. Thus, the doublet shift values for {alpha}/ß-U1 that is {alpha}-1,2 linked to a xylose residue are split to a ratio that reflects the equilibrium of the {alpha} and ß anomers of the xylose residue at the reducing terminus. As stated above, this interpretation is consistent with other published interpretations of 1H NMR spectra of xylooligomers substituted with MeGA and indicates that the substitution is penultimate to the reducing terminal xylose (8, 15). Figure 3B represents the predicted limit products based on the 1H NMR observations described above and shows the expected positioning of the MeGA moiety with respect to the reducing end xylose and some number of ß-1,4-linked xylose residues.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 3. 1H NMR of SG MeGAXn 3-kDa filtrate revealing the general action of XynC hydrolysis of MeGAXn and the predicted limit product of XynC MeGAXn digestion. Integrated intensity values for specific shift positions have been used to determine the product of an XynC digestion, establishing that there is a single MeGA substitution for every reducing terminal xylose and every nonreducing terminal xylose and that this substitution is penultimate to the reducing terminal xylose. (A) Shift assignments are labeled as follows: {alpha},ß-U1, 4-O-methylglucuronic acid carbon one hydrogen; U5, 4-O-methylglucuronic acid carbon five hydrogen; {alpha},ßr-X1, reducing terminal xylose carbon one hydrogen; nr-X5, nonreducing terminal xylose carbon five hydrogen; int-X5, internal xylose carbon five hydrogen. (B) Limit product generated by XynC-catalyzed hydrolysis of MeGAXn. X, xylose; MeGA, 4-O-methylglucuronic acid; n, some number of ß-1,4-linked xylose residues.

Fractionation of xylanases secreted by B. subtilis 168. The resolution of extracellular xylanase activities was achieved following concentration of medium by YM-3 filtration, and chromatographic separation of 2.9 units of the BSC with a BioGel P-60 column as described in Materials and Methods. Two xylanase-positive peaks, fraction A and fraction B, were collected, concentrated as described above, and evaluated by TLC for products generated by their respective actions on SG MeGAXn (Fig. 4). Fraction A eluted at a position expected for a globular protein with a molecular mass of approximately 31 kDa. The activity in this fraction catalyzed the depolymerization of SG MeGAXn to form aldouronate products resolved by TLC that were identical to those generated by the recombinantly expressed XynC protein, with the notable absence of xylobiose or xylotriose (Fig. 4). Fraction B eluted at a position that corresponded to a molecular mass, extrapolated from the relationship of log Mr to elution position for standards, of approximately 3 kDa, indicating adsorption to the acrylamide matrix. This activity catalyzed the generation of products from SG MeGAXn that would be expected for a typical GH 11 xylanase, releasing xylobiose, xylotriose, and aldopentauronate (MeGAX4) as primary limit products (2). SG MeGAXn digestion with unfractionated BSC generated products that were primarily a result of XynA hydrolysis but also included aldotetrauronate (MeGAX3) (Fig. 4).


Figure 4
View larger version (47K):
[in this window]
[in a new window]

 
FIG. 4. Identification of products generated by XynA (GH 11) and XynC (GH 5) secreted by B. subtilis 168. Spent medium from a mid-log-phase culture of B. subtilis 168 was concentrated by YM-3 filtration to provide the BSC fraction. This was fractionated using a BioGel P-60 column to provide fractions A and B, which were used to digest SG MeGAXn and identify the xylanase hydrolysis pattern by TLC. SG MeGAXn and an SG MeGAXn digested with recombinantly expressed XynC were used as controls. Lanes: 1, SG MeGAXn; 2, SG MeGAXn digestion with fraction A; 3, SG MeGAXn digestion with recombinant XynC; 4, MeGAX1 to MeGAX4 aldouronate standards; 5, xylooligomer standards with one to four xyloses; 6, SG MeGAXn digestion with fraction B; 7, SG MeGAXn digestion with BSC.

Relative levels of xylanase transcripts determined by Q-RT-PCR. To study xylanase gene expression in B. subtilis 168, the genes xynA, xynB, xynC, abnA, and gapA were analyzed. The abnA gene codes for an extracellular arabinofuranosidase and is well studied, being highly expressed while B. subtilis is growing on arabinose and repressed by glucose (50). The gapA gene, which codes for the glycolytic glyceraldehyde-3-phosphate dehydrogenase in B. subtilis, was reported to be upregulated while B. subtilis was growing on glucose (16, 40). The abnA and gapA genes thus served as internal controls. This was confirmed in our studies in which abnA showed the greatest dynamic range of all genes analyzed (Table 3). Our results also support previous findings for the xynB gene, showing that expression was greatest during growth on xylose. However, the same effect was not observed for xynA (36) and xynC. Changes in transcript levels for xynA and especially for xynC were modest with respect to abnA (Fig. 5). The xynA transcript was in greatest quantity while cells were growing on MeGAXn as the substrate and lowest while cells were growing on glucose, suggesting that xynA expression may be activated by growth on MeGAXn. In contrast, the xynC transcript was constitutively expressed without significant changes in regulation observed while growing on the different sugars.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Relative transcript quantity measured by Q-RT-PCR for gapA, abnA, xynA, and xynC genes


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 5. Regulation of expression of xynA and xynC genes in early- to mid-exponential-phase growth cultures of B. subtilis 168 with different sugars as the substrate, measured by using Q-RT-PCR. G, glucose; A, arabinose; B, birch wood MeGAXn; S, sweetgum wood MeGAXn; 1, xynA; 2, xynC.


arrow
DISCUSSION
 
XynC from B. subtilis 168 is the first GH 5 xylanase from a gram-positive bacterium to be fully characterized with respect to substrate requirements and resulting hydrolysis products. The turnover rate of 2,635/minute is close to the rate observed for the GH 5 xylanase (XynA) from the gram-negative bacterium Erwinia chrysanthemi strain PI (data not shown). A review of publications concerning GH 10 and GH 11 xylanases in which a Vmax or kcat is given reveals a very broad range of catalytic rates (9, 10, 14, 18, 31, 47, 49). In general, the GH 5 xylanases have a catalytic rate which is at the lower range of those reported for GH 10 and GH 11 xylanases.

Both the MALDI-TOF MS data and the 1H NMR data indicate that XynC catalyzes the depolymerization of MeGAXn to release products in which ß-1,4-linked xylooligosaccharides are substituted with a single {alpha}-1,2-linked 4-O-methylglucuronate. MALDI-TOF MS analysis of products generated by XynC revealed an array of peak clusters, each differing by a single xylose residue. Tabulation of mass data showed that single-salt adducts differed from double-salt adducts by a single mass unit, indicating that formation of adducts results from proton displacement. Studies in which this technique for carbohydrate analysis was developed (57) reported single-salt adducts for neutral polysaccharides but no double-salt adducts. The occurrence of double-salt adducts may result from the presence of the carboxylic acid. The generation of xylooligosaccharides with a single MeGA substitution calls into question the interpretation of the MALDI-TOF MS data for products generated from the action of the GH 5 endoxylanase from Erwinia chrysanthemi strain D1 (23). Recent studies with the GH 5 endoxylanase from Erwinia chrysanthemi strain PI have applied MALDI-TOF MS to identify the products generated from the depolymerization of SG MeGAXn along with potassium ion supplements (J. Rice, G. Nong, A. Ragunathan, F. St. John, and J. P. Preston, Abstr. 105th Gen. Meet. Am. Soc. Microbiol. 2005, abstr. B-138, 2005). These results support the assignments made in Table 2 and the interpretation provided here. Further support for this interpretation comes from the ratio 1.0:1.1:0.9 of the integrated signals for the proton on carbon five of the MeGA, the proton on carbon five of the nonreducing terminal xylose, and the proton on carbon one of the reducing terminal xylose.

The evidence for the position of the xylose residue that is substituted with MeGA in XynC-generated products is circumstantial in that it is based upon the NMR shift assignment peak intensities ascribed to an induction of an {alpha}/ß resonance split in the {alpha}-1,2-linked MeGA moiety. This induction can be rationalized by a direct interaction with the proton on carbon one of the reducing terminal xylose residue, which is in anomeric equilibrium between {alpha} and ß configurations. Such an effect has been interpreted to explain the observations obtained from the 1H NMR and two-dimensional 1H/13C NMR analyses of aldouronates in which the nonreducing terminal xylose in ß-1,4-xylobiose and the internal xylose in ß-1,4-xylotriose are substituted with {alpha}-1,2-linked 4-O-methylglucuronate (8, 15). The products generated by a xylanase purified from a commercial preparation of Bacillus subtilis were previously characterized by methylation analysis that identified the MeGA substitution on the xylose residue penultimate to xylose at the reducing terminus (44), and this activity may have been encoded by a gene homologous to xynC. These data identify a site of cleavage that is different from that indicated by previous studies of the GH 5 endoxylanase secreted by the D1 strain of Erwinia chrysanthemi (23), which was based upon 13C NMR and limited digestion by ß-xylosidase. Two-dimensional heteronuclear multiple-quantum coherence NMR spectra of the products generated by the GH 5 xylanase secreted by Erwinia chrysanthemi PI (J. Rice et al., Abstr. 105th Gen. Meet. Am. Soc. Microbiol. 2005) support the interpretation provided for the products generated by the XynC GH 5 endoxylanase secreted by B. subtilis 168. From this, it may be concluded that GH 5 endoxylanases from both B. subtilis 168 and the Erwinia chrysanthemi strains catalyze the exclusive cleavage of a ß-1,4-xylosidic bond penultimate to that linking carbon one of the xylose residue that is substituted with {alpha}-1,2-linked MeGA as depicted in Fig. 3B.

Previous studies on expression of xylanase activity in B. subtilis have focused on the xynA gene, whose protein product (XynA) has long been thought to be the primary extracellular xylanase (36). The xynA gene is constitutively expressed even while cells are growing on glucose, suggesting that xynA regulation may not be subject to catabolite repression (36, 40). The xynC gene was originally identified by genome sequencing of B. subtilis 168 (33, 51). Analysis of the fractions derived from the BioGel P-60 chromatography of BSC indicates that B. subtilis 168 produces XynC as a xylanase activity separable from that of XynA. These results are supported by a recent proteomic evaluation of the B. subtilis secretome which identifies XynA and XynC (and XynD) as being present as secreted protein products (62).

Expression of xynC is unresponsive to metabolite-mediated induction or repression while B. subtilis 168 is growing on a variety of carbohydrates. In contrast, xynA expression appears to be activated by growth on MeGAXn. Transcriptome analyses of xynA and xynC in the B. subtilis wild type (strain ST100) and a ccpA mutant (strain ST101) showed little change with and without glucose as the substrate (40) (http://www.biology.ucsd.edu/~imsaier/regulation/). Unlike the xylose utilization operon of B. subtilis (19, 26, 32) and the Q-RT-PCR control genes mentioned above, neither of the two secreted xylanases of B. subtilis 168 seems to be repressed by glucose via the CcpA/cre-mediated mechanism. XynA may be upregulated threefold while growing on MeGAXn by a process as yet undefined, and XynC is strictly constitutive.

GH 11 xylanases, e.g., XynA, are known to release xylobiose as a major limit product which may be utilized by B. subtilis (19). However, the products of XynC hydrolysis of MeGAXn are too large for direct utilization. The hydrolysis of MeGAXn by XynA and XynC together (in the BSC) releases a unique aldouronate smaller than those generated by the individual xylanases (Fig. 6). This aldotetrauronate (MeGAX3), with a MeGA substitution on the second xylose of xylotriose, is distinct from the well-studied MeGAX3 limit product of a GH 10 xylanase, which is substituted with MeGA directly on the nonreducing terminal xylose of ß-1,4-xylotriose (2, 48). The MeGAX3 generated by GH 10 xylanases may be readily assimilated and metabolized by some gram-positive bacteria (55, 58), while the assimilation and metabolism of MeGAX3 generated by the combined action of a GH 11 and a GH 5 endoxylanase have yet to be demonstrated.


Figure 6
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 6. Limit aldouronates expected from an SG MeGAXn digestion with a GH 11 xylanase and a GH 5 xylanase cosecreted in the growth medium of B. subtilis 168. (A) MeGAX4 with a MeGA substitution penultimate to the nonreducing terminal xylose, the smallest aldouronate product resulting from a GH 11 hydrolysis of MeGAXn (4). (B) The predicted hydrolysis limit product of a GH 5 xylanase as presented in this publication, having a single MeGA substitution penultimate to the reducing terminal xylose. (C) MeGAX3 with a MeGA substitution on the second of three xylose residues positioned penultimate to the reducing and nonreducing ends.

In summary, XynC of B. subtilis 168 is a GH 5 endoxylanase that, based on substrate preference and product analysis, cleaves at positions that are directed by the glucuronosyl substitution on the MeGAXn chain. Hydrolysis products are decorated with a single MeGA moiety penultimate to the reducing end xylose as proposed by Nishitani and Nevins (44), and there are no detectable neutral xylooligosaccharides released. With its unique mode of action and moderate thermotolerance, XynC may complement GH 10 and GH 11 xylanases for pretreatment of lignocellulosic. B. subtilis 168 may be engineered for aldouronate utilization and help define genetic requirements for efficient enzymatic pretreatment of hemicellulose. Selection or engineering of fermentative strains of B. subtilis 168 may then allow development of second-generation gram-positive biocatalysts for efficient conversion of MeGAXn to "green" chemicals and fuel ethanol.


arrow
ACKNOWLEDGMENTS
 
We thank James R. Rocca at the University of Florida Advanced Magnetic Resonance Imaging and Spectroscopy Facility (AMRIS) for instruction and assistance provided in obtaining NMR data and Alfred Chung at the University of Florida Interdisciplinary Center for Biotechnology Research (ICBR) for guidance in obtaining quality MALDI-TOF MS spectra. Further, we thank L. O. Ingram, J. Maupin-Furlow, and K. T. Shanmugan for helpful suggestions and review of this work.

This research was supported by U.S. Department of Energy grants DE FC36-99GO10476 and DE FC36-00GO10594, The Consortium for Plant Biotechnology Research Project grant GO12026-198 (DE FG36-02GO12026), the Florida Center for Renewable Fuels and Chemicals, and the Institute of Food and Agricultural Sciences, University of Florida Experiment Station, as CRIS Project MCS 3763.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: University of Florida, Department of Microbiology and Cell Science, Box 110700, Bldg. 981, Museum Rd., Gainesville, FL 32611. Phone: (352) 392-5923. Fax: (352) 392-5922. E-mail: jpreston{at}ufl.edu. Back

{triangledown} Published ahead of print on 6 October 2006. Back


arrow
REFERENCES
 
    1
  1. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783-795.[CrossRef][Medline]
  2. 2
  3. Biely, P., M. Vrsanska, M. Tenkanen, and D. Kluepfel. 1997. Endo-beta-1,4-xylanase families: differences in catalytic properties. J. Biotechnol. 57:151-166.[CrossRef][Medline]
  4. 3
  5. Blumenkrantz, N., and G. Asboe-Hansen. 1973. New method for quantitative determination of uronic acids. Anal. Biochem. 54:484-489.[CrossRef][Medline]
  6. 4
  7. Boraston, A. B., D. N. Bolam, H. J. Gilbert, and G. J. Davies. 2004. Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem. J. 382:769-781.[CrossRef][Medline]
  8. 5
  9. Bounias, M. 1980. N-(1-naphthyl)ethylenediamine dihydrochloride as a new reagent for nanomole quantification of sugars on thin-layer plates by a mathematical calibration process. Anal. Biochem. 106:291-295.[CrossRef][Medline]
  10. 6
  11. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
  12. 7
  13. Braun, E. J., and C. A. Rodrigues. 1993. Purification and properties of an endoxylanase from a corn stalk rot strain of Erwinia chrysanthemi. Phytopathology 83:332-337.[CrossRef]
  14. 8
  15. Cavagna, F., H. Deger, and J. Puls. 1984. 2D-N.M.R. analysis of the structure of an aldotriouronic acid obtained from birch wood. Carbohydr. Chem. 129:1-8.
  16. 9
  17. Charnock, S. J., J. H. Lakey, R. Virden, N. Hughes, M. L. Sinnott, G. P. Hazlewood, R. Pickersgill, and H. J. Gilbert. 1997. Key residues in subsite F play a critical role in the activity of Pseudomonas fluorescens subspecies cellulosa xylanase A against xylooligosaccharides but not against highly polymeric substrates such as xylan. J. Biol. Chem. 272:2942-2951.[Abstract/Free Full Text]
  18. 10
  19. Chaudhary, P., and D. N. Deobagkar. 1997. Characterization of cloned endoxylanase from Cellulomonas sp. NCIM 2353 expressed in Escherichia coli. Curr. Microbiol. 34:273-279.[CrossRef][Medline]
  20. 11
  21. Clarke, J. H., J. E. Rixon, A. Ciruela, H. J. Gilbert, and G. P. Hazlewood. 1997. Family-10 and family-11 xylanases differ in their capacity to enhance the bleachability of hardwood and softwood paper pulps. Appl. Microbiol. Biotechnol. 48:177-183.[CrossRef][Medline]
  22. 12
  23. Collins, T., C. Gerday, and G. Feller. 2005. Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiol. Rev. 29:3-23.[CrossRef][Medline]
  24. 13
  25. Dubois, M., K. A. Gilles, J. K. Hamilton, P. A. Rebers, and F. Smith. 1956. Colorimetric method for the determination of sugars and related substances. Anal. Chem. 28:350-356.[CrossRef]
  26. 14
  27. Elegir, G., G. Szakacs, and T. W. Jeffries. 1994. Purification, characterization, and substrate specificities of multiple xylanases from Streptomyces sp. strain B-12-2. Appl. Environ. Microbiol. 60:2609-2615.[Abstract/Free Full Text]
  28. 15
  29. Excoffier, G., R. Nardin, and M. R. Vignon. 1986. Determination de la structure primaire d'un acide tri-D-xylo-4-O-methyl-D-glucuronique par R. M. N. a deux dimensions. Carbohydr. Chem. 149:319-328.
  30. 16
  31. Fillinger, S., S. Boschi-Muller, S. Azza, E. Dervyn, G. Branlant, and S. Aymerich. 2000. Two glyceraldehyde-3-phosphate dehydrogenases with opposite physiological roles in a nonphotosynthetic bacterium. J. Biol. Chem. 275:14031-14037.[Abstract/Free Full Text]
  32. 17
  33. Gebler, J., N. Gilkes, M. Claeyssens, D. Wilson, P. Beguin, W. Wakarchuk, D. Kilburn, R. Miller, R. Warren, and S. Withers. 1992. Stereoselective hydrolysis catalyzed by related beta-1,4-glucanases and beta-1,4-xylanases. J. Biol. Chem. 267:12559-12561.[Abstract/Free Full Text]
  34. 18
  35. Gupta, S., B. Bhushan, and G. S. Hoondal. 2000. Isolation, purification and characterization of xylanase from Staphylococcus sp. SG-13 and its application in biobleaching of kraft pulp. J. Appl. Microbiol. 88:325-334.[CrossRef][Medline]
  36. 19
  37. Hastrup, S. 1988. Analysis of the Bacillus subtilis xylose regulon, p. 79-83. In A. T. Ganesan and J. A. Hoch (ed.), Genetics and biotechnology of bacilli, vol. 2. Academic Press, Inc., New York, N.Y.
  38. 20
  39. Henrissat, B., and A. Bairoch. 1993. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J. 293:781-788.
  40. 21
  41. Henrissat, B., I. Callebaut, S. Fabrega, P. Lehn, J. P. Mornon, and G. Davies. 1995. Conserved catalytic machinery and the prediction of a common fold for several families of glycosyl hydrolases. Proc. Natl. Acad. Sci. USA 92:7090-7094.[Abstract/Free Full Text]
  42. 22
  43. Henrissat, B., and G. Davies. 1997. Structural and sequence-based classification of glycoside hydrolases. Curr. Opin. Struct. Biol. 7:637-644.[CrossRef][Medline]
  44. 23
  45. Hurlbert, J. C., and J. F. Preston. 2001. Functional characterization of a novel xylanase from a corn strain of Erwinia chrysanthemi. J. Bacteriol. 183:2093-2100.[Abstract/Free Full Text]
  46. 24
  47. Ingram, L. O., H. C. Aldrich, A. C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou. 1999. Enteric bacterial catalysts for fuel ethanol production. Biotechnol. Prog. 15:855-866.[CrossRef][Medline]
  48. 25
  49. Ito, Y., T. Tomita, N. Roy, A. Nakano, N. Sugawara-Tomita, S. Watanabe, N. Okai, N. Abe, and Y. Kamio. 2003. Cloning, expression, and cell surface localization of Paenibacillus sp. strain W-61 xylanase 5, a multidomain xylanase. Appl. Environ. Microbiol. 69:6969-6978.[Abstract/Free Full Text]
  50. 26
  51. Jacob, S., R. Allmansberger, D. Gartner, and W. Hillen. 1991. Catabolite repression of the operon for xylose utilization from Bacillus subtilis W23 is mediated at the level of transcription and depends on a cis site in the xylA reading frame. Mol. Gen. Genet. 229:189-196.[CrossRef][Medline]
  52. 27
  53. Jacobs, A., P. T. Larsson, and O. Dahlman. 2001. Distribution of uronic acids in xylans from various species of soft- and hardwood as determined by MALDI mass spectrometry. Biomacromolecules 2:979-990.[CrossRef][Medline]
  54. 28
  55. Jeffries, T. W., and Y. S. Jin. 2004. Metabolic engineering for improved fermentation of pentoses by yeasts. Appl. Microbiol. Biotechnol. 63:495-509.[CrossRef][Medline]
  56. 29
  57. Jones, J. K. N., C. B. Purves, and T. E. Timell. 1961. Constitution of 4-O-methylglucuronoxylan from the wood of trembling aspen (Populus tremuloides Michx). Can. J. Chem. 39:1059-1066.[CrossRef]
  58. 30
  59. Kardosova, A., M. Matulova, and A. Malovikova. 1998. (4-O-methyl-alpha-D-glucurono)-D-xylan from Rudbeckia fulgida, var. sullivantii (Boynton et Beadle). Carbohydr. Res. 308:99-105.[CrossRef][Medline]
  60. 31
  61. Khasin, A., I. Alchanati, and Y. Shoham. 1993. Purification and characterization of a thermostable xylanase from Bacillus stearothermophilus T-6. Appl. Environ. Microbiol. 59:1725-1730.[Abstract/Free Full Text]
  62. 32
  63. Kraus, A., C. Hueck, D. Gartner, and W. Hillen. 1994. Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts additional xylR-dependent repression. J. Bacteriol. 176:1738-1745.[Abstract/Free Full Text]
  64. 33
  65. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.[CrossRef][Medline]
  66. 34
  67. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  68. 35
  69. Larson, S. B., J. Day, A. P. Barba de la Rosa, N. T. Keen, and A. McPherson. 2003. First crystallographic structure of a xylanase from glycoside hydrolase family 5: implications for catalysis. Biochemistry 42:8411-8422.[CrossRef][Medline]
  70. 36
  71. Lindner, C., J. Stulke, and M. Hecker 1994. Regulation of xylanolytic enzymes in Bacillus subtilis. Microbiology 140:753-757.[Abstract/Free Full Text]
  72. 37
  73. Lineweaver, H., and D. Burk 1934. The determination of enzyme dissociation constants. J. Am. Chem. Soc. 56:658-666.[CrossRef]
  74. 38
  75. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the Formula method. Methods 25:402-408.[CrossRef][Medline]
  76. 39
  77. Lynd, L. R., W. H. van Zyl, J. E. McBride, and M. Laser. 2005. Consolidated bioprocessing of cellulosic biomass: an update. Curr. Opin. Biotechnol. 16:577-583.[CrossRef][Medline]
  78. 40
  79. Moreno, M. S., B. L. Schneider, R. R. Maile, W. Weyler, and M. H. Saier, Jr. 2001. Catabolite repression mediated by the CcpA protein in Bacillus subtilis: novel modes of regulation revealed by whole-genome analyses. Mol. Microbiol. 39:1366-1381.[CrossRef][Medline]
  80. 41
  81. Nagy, T., K. Emami, C. M. Fontes, L. M. Ferreira, D. R. Humphry, and H. J. Gilbert. 2002. The membrane-bound alpha-glucuronidase from Pseudomonas cellulosa hydrolyzes 4-O-methyl-D-glucuronoxylooligosaccharides but not 4-O-methyl-D-glucuronoxylan. J. Bacteriol. 184:4925-4929.[Abstract/Free Full Text]
  82. 42
  83. Nagy, T., D. Nurizzo, G. J. Davies, P. Biely, J. H. Lakey, D. N. Bolam, and H. J. Gilbert. 2003. The alpha-glucuronidase, GlcA67A, of Cellvibrio japonicus utilizes the carboxylate and methyl groups of aldobiouronic acid as important substrate recognition determinants. J. Biol. Chem. 278:20286.[Abstract/Free Full Text]
  84. 43
  85. Nelson, N. 1944. A photometric adaptation of the somogyi method for the determination of glucose. J. Biol. Chem. 153:375-380.[Free Full Text]
  86. 44
  87. Nishitani, K., and D. J. Nevins. 1991. Glucuronoxylan xylanohydrolase. A unique xylanase with the requirement for appendant glucuronosyl units. J. Biol. Chem. 266:6539-6543.[Abstract/Free Full Text]
  88. 45
  89. Nurizzo, D., T. Nagy, H. J. Gilbert, and G. J. Davies. 2002. The structural basis for catalysis and specificity of the Pseudomonas cellulosa alpha-glucuronidase, GlcA67A. Structure 10:547-556.[Medline]
  90. 46
  91. Okai, N., M. Fukasaku, J. Kaneko, T. Tomita, K. Muramoto, and Y. Kamio. 1998. Molecular properties and activity of a carboxyl-terminal truncated form of xylanase 3 from Aeromonas caviae W-61. Biosci. Biotechnol. Biochem. 62:1560-1567.[CrossRef][Medline]
  92. 47
  93. Pell, G., L. Szabo, S. J. Charnock, H. Xie, T. M. Gloster, G. J. Davies, and H. J. Gilbert. 2004. Structural and biochemical analysis of Cellvibrio japonicus xylanase 10C: how variation in substrate-binding cleft influences the catalytic profile of family GH-10 xylanases. J. Biol. Chem. 279:11777-11788.[Abstract/Free Full Text]
  94. 48
  95. Pell, G., E. J. Taylor, T. M. Gloster, J. P. Turkenburg, C. M. Fontes, L. M. Ferreira, T. Nagy, S. J. Clark, G. J. Davies, and H. J. Gilbert. 2004. The mechanisms by which family 10 glycoside hydrolases bind decorated substrates. J. Biol. Chem. 279:9597-9605.[Abstract/Free Full Text]
  96. 49
  97. Preston, J. F., J. C. Hurlbert, J. D. Rice, A. Ragunathan, and F. J. St. John. 2003. Microbial strategies for the depolymerization of glucuronoxylan: leads to biotechnological applications of endoxylanases, p. 191-210. In S. D. Mansfield and J. N. Saddler (ed.), Applications of enzymes to lignocellulosics. American Chemical Society, Washington, D.C.
  98. 50
  99. Raposo, M. P., J. M. Inacio, L. J. Mota, and I. de Sa-Nogueira. 2004. Transcriptional regulation of genes encoding arabinan-degrading enzymes in Bacillus subtilis. J. Bacteriol. 186:1287-1296.[Abstract/Free Full Text]
  100. 51
  101. Rose, M., and K. D. Entian. 1996. New genes in the 170 degrees region of the Bacillus subtilis genome encode DNA gyrase subunits, a thioredoxin, a xylanase and an amino acid transporter. Microbiology 142:3097-3101.[Abstract/Free Full Text]
  102. 52
  103. Rozen, S., and H. Skaletsky. 2000. Primer3 on the www for general users and for biologist programmers. Methods Mol. Biol. 132:365-386.[Medline]
  104. 53
  105. Rydlund, A., and O. Dahlman. 1997. Oligosaccharides obtained by enzymatic hydrolysis of birch kraft pulp xylan: analysis by capillary zone electrophoresis and mass spectrometry. Carbohydr. Res. 300:95-102.[CrossRef][Medline]
  106. 54
  107. Sedlak, M., and N. W. Ho. 2004. Production of ethanol from cellulosic biomass hydrolysates using genetically engineered Saccharomyces yeast capable of cofermenting glucose and xylose. Appl. Biochem. Biotechnol. 113-116:403-416.
  108. 55
  109. Shulami, S., O. Gat, A. L. Sonenshein, and Y. Shoham. 1999. The glucuronic acid utilization gene cluster from Bacillus stearothermophilus T-6. J. Bacteriol. 181:3695-3704.[Abstract/Free Full Text]
  110. 56
  111. Spizizen, J. 1958. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc. Natl. Acad. Sci. USA 44:1072-1078.[Free Full Text]
  112. 57
  113. Stahl, B., M. Steup, M. Karas, and F. Hillenkamp. 1991. Analysis of neutral oligosaccharides by matrix-assisted laser desorption/ionization mass spectrometry. Anal. Chem. 63:1463-1466.[CrossRef]
  114. 58
  115. St. John, F. J., J. D. Rice, and J. F. Preston. 2006. Paenibacillus sp. strain JDR-2 and XynA1: a novel system for methylglucuronoxylan utilization. Appl. Environ. Microbiol. 72:1496-1506.[Abstract/Free Full Text]
  116. 59
  117. Sun, Y., and J. Cheng. 2002. Hydrolysis of lignocellulosic materials for ethanol production: a review. Bioresour. Technol. 83:1-11.[CrossRef][Medline]
  118. 60
  119. Suzuki, T., K. Ibata, M. Hatsu, K. Takamizawa, and K. Kawai. 1997. Cloning and expression of a 58-kDa xylanase VI gene (xynD) of Aeromonas caviae ME-1 in Escherichia coli which is not categorized as a family F or family G xylanase. J. Ferm. Bioeng. 84:86-89.[CrossRef]
  120. 61
  121. Timell, T. E. 1967. Recent progress in the chemistry of wood hemicelluloses. Wood Sci. Technol. 1:45-70.
  122. 62
  123. Tjalsma, H., H. Antelmann, J. D. Jongbloed, P. G. Braun, E. Darmon, R. Dorenbos, J. Y. Dubois, H. Westers, G. Zanen, W. J. Quax, O. P. Kuipers, S. Bron, M. Hecker, and J. M. van Dijl. 2004. Proteomics of protein secretion by Bacillus subtilis: separating the "secrets" of the secretome. Microbiol. Mol. Biol. Rev. 68:207-233.[Abstract/Free Full Text]
  124. 63
  125. Tsai, Y. L., and B. H. Olson. 1991. Rapid method for direct extraction of DNA from soil and sediments. Appl. Environ. Microbiol. 57:1070-1074.[Abstract/Free Full Text]
  126. 64
  127. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:1-12.[Medline]
  128. 65
  129. Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam, and L. O. Ingram. 2003. Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110. Appl. Environ. Microbiol. 69:399-407.[Abstract/Free Full Text]
  130. 66
  131. Zuker, M. 2003. mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406-3415.[Abstract/Free Full Text]


Journal of Bacteriology, December 2006, p. 8617-8626, Vol. 188, No. 24
0021-9193/06/$08.00+0     doi:10.1128/JB.01283-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Fukuda, M., Watanabe, S., Kaneko, J., Itoh, Y., Kamio, Y. (2009). The Membrane Lipoprotein LppX of Paenibacillus sp. Strain W-61 Serves as a Molecular Chaperone for Xylanase of Glycoside Hydrolase Family 11 during Secretion across the Cytoplasmic Membrane. J. Bacteriol. 191: 1641-1649 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by St. John, F. J.
Right arrow Articles by Preston, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by St. John, F. J.
Right arrow Articles by Preston, J. F.