Journal of Bacteriology, February 2006, p. 1031-1038, Vol. 188, No. 3
0021-9193/06/$08.00+0 doi:10.1128/JB.188.3.1031-1038.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Distribution and Genetic Diversity of the ABC Transporter Lipoproteins PiuA and PiaA within Streptococcus pneumoniae and Related Streptococci
Rachael H. Whalan,1*
Simon G. P. Funnell,2
Lucas D. Bowler,3
Michael J. Hudson,2
Andrew Robinson,2 and
Christopher G. Dowson1
Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom,1
Health Protection Agency Centre for Emergency Preparedness and Response, Porton Down, Salisbury SP4 OJG, United Kingdom,2
Trafford Centre for Medical Research, University of Sussex, Brighton BN1 9RY, United Kingdom3
Received 4 August 2005/
Accepted 26 October 2005
 |
ABSTRACT
|
|---|
Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. The existence of approximately 90 antigenically distinct capsular serotypes has greatly complicated the development of an effective pneumococcal vaccine. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. PiuA and PiaA are the lipoprotein components of two pneumococcal iron ABC transporters and are required for full virulence in mouse models of infection. Here we describe a study of the distribution and genetic diversity of PiuA and PiaA within typical and atypical S. pneumoniae, Streptococcus oralis, and Streptococcus mitis strains. The genes encoding both PiuA and PiaA were present in all typical pneumococci tested, (covering 20 and 27 serotypes, respectively). The piuA gene was highly conserved within the typical pneumococci (0.3% nucleotide divergence), but was also present in "atypical" pneumococci and the closely related species S. mitis and S. oralis, showing up to 10.4% nucleotide divergence and 7.5% amino acid divergence from the typical pneumococcal alleles. Conversely, the piaA gene was found to be specific to typical pneumococci, 100% conserved, and absent from the oral streptococci, including isolates of S. mitis known to possess pneumolysin and autolysin. These are desirable qualities for a vaccine candidate and as a diagnostic tool for S. pneumoniae.
 |
INTRODUCTION
|
|---|
Streptococcus pneumoniae (the pneumococcus) is a common cause of otitis media, septicemia, pneumonia, and meningitis in children, resulting in significant mortality and morbidity throughout the world. The currently available pneumococcal capsule-based nonconjugated vaccines lack efficacy in children under 2 years of age (21) and elicit only serotype-specific protection due to their restricted valency, i.e., they are composed of polysaccharide from 23 capsular types, compared to the 90 different types currently recognized in pneumococci (21). Therefore, while the vaccine composition is likely to protect 85 to 90% of children in the United States, coverage in other parts of the world, particularly in developing countries, could be as low as 43% (19, 20).
The 23-valent polysaccharide vaccine is relatively cheap but elicits neither a strong response in infants nor immunological memory in any age group and thus requires frequent repeat vaccinations. Although conjugate vaccines provide strong immune responses in all age groups and immunological memory, they are of even further limited valency (currently 7-valent, with 11- and 13-valent vaccines in development), a property that could lead to serotype replacement by invasive nonvaccine strains in vaccinated individuals (30) and that may result in an increased incidence of disease from these serotypes (16, 33, 38).
In light of these shortcomings, much attention has recently focused on the development of protein-based S. pneumoniae vaccines. These have the potential advantages of being antigenically conserved across all capsular types and able to induce long-lasting memory responses and would be relatively inexpensive to produce by recombinant DNA techniques. Many proteins have been studied as possible vaccine candidates, with much attention paid not only to their ability to protect against invasive pneumococcal disease but on their distribution and levels of sequence and serological conservation between capsular types (1, 8, 11, 23, 25, 34-36, 39, 42, 47, 48).
In addition to the search for possible vaccine candidates, there is also interest in development of new diagnostic tests for the identification of S. pneumoniae. It is important for the laboratory to be able to differentiate between S. pneumoniae and alpha-hemolytic oral streptococci, such as S. oralis and S. mitis, in order to establish the correct diagnosis and hence administer appropriate treatment. Four phenotypic characteristics are classically used for the identification of S. pneumoniae: colony morphology, optochin sensitivity, bile solubility, and agglutination with antipneumococcal polysaccharide capsule antibodies. However, some S. pneumoniae isolates can give atypical reactions to one or more of these tests and other alpha-hemolytic streptococci can give positive reactions, leading to difficulties in identification. Therefore, the use of PCR as a diagnostic test has recently been developed; this targets the virulence factors pneumolysin (ply) and autolysin (lytA) thought to be unique to the pneumococcus (18, 40, 41, 51). However, these genes have now recently been identified in S. mitis (55).
Recently identified vaccine candidates PiuA and PiaA are the lipoprotein components of two S. pneumoniae iron ABC transport systems called Piu (pneumococcal iron uptake) and Pia (pneumococcal iron acquisition) (9). The Piu and Pia transport systems are essential for iron uptake and full virulence in murine systemic and pulmonary models of infection (9). Immunization of mice with purified recombinant PiuA and PiaA showed that they are capable of eliciting protective immunity against systemic challenge with S. pneumoniae (10), mediated by their likely presence on the bacterial cell surface (46) and hence ability to act as opsonins (26). Human sera from patients with pneumococcal septicemia caused by 8 different capsular serotypes contained anti-PiuA and anti-PiaA antibodies, which cross-reacted with recombinant PiuA and PiaA from a single capsular serotype (53), indicating that this immune response was serotype independent. Moreover, mouse antibodies raised toward recombinant PiuA and PiaA from a serotype 2 S. pneumoniae reacted with PiuA and PiaA from nine other capsular serotypes (10).
The piuA gene has previously been shown to be present in S. mitis, S. oralis, S. sanguis, and S. milleri, whereas piaA seems to be restricted to S. pneumoniae. Both piuA and piaA have been found in all S. pneumoniae strains tested to date (covering 10 capsular types) (9), suggesting they are not only conserved but also widespread among pneumococci. We therefore carried out a more extensive study of the distribution and, additionally, looked at the diversity of these proteins within typical and a previously well characterized collection of atypical pneumococci and the closely related species S. oralis and S. mitis.
 |
MATERIALS AND METHODS
|
|---|
Bacterial isolates and preparation of chromosomal DNA.
A complete list of the strains used in this study is shown in Table 1. Chromosomal DNA was prepared as described previously (54).
Analysis of piuA and piaA distribution.
Distribution of the piuA and piaA genes was analyzed by PCR. PCR was performed under standard conditions with 30 cycles of 95°C for 1 min and 72°C for 1 min per kb of predicted product. Products were visualized by agarose gel electrophoresis on 1.0% agarose in the presence of 1 µg ml1 ethidium bromide. The following oligonucleotide primer pairs were used for PCR amplification: PiuA For (5' TGGTGCATGTAGTACAAACTCAAG 3') and PiuA Rev (5' AGTCCGCCTCCGCTTAGAT 3'), and PiaA For (5' AGAGCATGCGCCTGATAAAAT 3') and PiaA Rev (5' CATGAGGCTGCTAACGGTGTAT 3').
Analysis of piuA and piaA divergence.
Approximately 5 µl of PCR product was digested by restriction enzymes according to the manufacturer's instructions in a total volume of 25 µl. Digests were then separated on 4 and 8% vertical polyacrylamide gels and visualized under UV illumination after staining for 15 min in 0.3 µg ml1 ethidium bromide. The piuA PCR product was digested with the restriction enzymes Tsp509I, RsaI, MwoI, and ApoI. The piaA PCR product was digested with the restriction enzymes ApoI, MboI, MwoI, HinFI, and StyI. Restriction enzymes were selected such that their combined sites covered 5 to 10% of the gene. Alleles were designated by visual comparison of restriction fragment length polymorphism (RFLP) profiles, and subsequently one strain from each piuA allele was sequenced in full using the Beckman CEQ2000 system according to the manufacturer's instructions and the oligonucleotide primer pair PiuA U+D For (5' TATGGCAGGACTTACAAATGT3') and PiuA U+D Rev (5' CTGCTTAAAGCCATACTAACACAA3').
Bioinformatics.
Nucleotide and amino acid identities between alleles were calculated by the ClustalV method, which groups sequences into clusters by examining sequence distances between all pairs. Clusters are aligned as pairs and then collectively as sequence groups to produce the overall alignment (22). Phylogenetic and molecular evolutionary analysis was conducted using MEGA version 2.1 (29). Sequence information was obtained from the websites www.sanger.ac.uk and www.tigr.org.
 |
RESULTS
|
|---|
Strains included in this study. (i) Typical and acapsular S. pneumoniae.
The typical S. pneumoniae strains selected for this study included one strain each from the 19 clonal groups of pneumococci as determined by Muller-Graf et al., which covers nine invasive isolates and 10 carried isolates (37). The TIGR sequenced strain Jnr7/87 was also included as a positive control, and in the case of the piaA study an additional 14 typical pneumococci were included. These typical pneumococci were chosen as it has been shown that they represent the breadth of genetic diversity within the species (37, 55). Also included were eight acapsular strains (R6, Col 3, Col 6, Col 8, Col 14, Col 11, Col 12, and X158) that represent a cluster of organisms highly related to typical pneumococci based on the sequencing of three housekeeping genes (xpt, recP, and hexB) and are classed as typical pneumococci (55) but are nontypeable and are therefore referred to in this study as acapsulate pneumococci. In the case of the piuA study, only the nontypeable strains Col 11, Col 12, and X158 were included. The piuA study therefore included a total of 25 pneumococcal strains covering 20 serotypes and the piaA study included 42 pneumococcal strains covering 27 serotypes.
(ii) Atypical S. pneumoniae.
Seven atypical pneumococci were included in both the piuA and piaA distribution studies. These strains have been classified as atypical on the basis of producing atypical reactions in one or more of the standard tests for pneumococci (55). These tests include colony morphology, optochin sensitivity, bile solubility, and agglutination with antipneumococcal polysaccharide capsule antibodies. These strains have been shown to be clearly genetically distinct from although closely related to typical pneumococci based on the sequencing of the xpt, recP, and hexB housekeeping genes (55). Although they do not show the classical characteristics of typical pneumococci, they are still associated with disease (55) and it is therefore important to consider these isolates as well as typical pneumococci when identifying possible vaccine targets.
(iii) Other streptococcal strains.
S. pneumoniae belongs to the mitis phylogenetic group together with S. mitis, S. oralis, S. gordonii, S. sanguinis, S. parasanguinis, and S. cristatus (28). The most closely related species to S. pneumoniae are S. oralis and S. mitis, with whom it shares over 99% 16S rRNA gene sequence identity, although DNA-DNA similarity values for the entire chromosome are estimated to be less than 60% (27). S. oralis and S. mitis are typically commensals of the human oral cavity; however, more recently members of these species have shown potential as pathogens, being associated with diseases such as bacterial endocarditis (12), and have frequently been isolated from infections in immunocompromised individuals (4, 6, 7, 31). Both piuA and piaA studies included three S. mitis and five S. oralis strains. Three unusual isolates (806, Col 16, and Col 20) included in both the piuA and piaA studies were obtained from patients with respiratory disease (55). They are phenotypically and genetically most closely related to S. mitis but harbor the pneumolysin and autolysin genes classically associated with S. pneumoniae (55); these strains are referred to as atypical oral streptococci.
Genetic distribution of piuA.
The piuA gene was identified by PCR in all 22 typical pneumococcal strains included in the study, which covered 20 serotypes and the three acapsulate pneumococci tested (Col 11, Col 12, and X158). Additionally all atypical pneumococci, S. oralis, and S. mitis strains (except S. mitis K208) were PCR positive for the piuA gene, showing that it is widespread within the mitis streptococci.
Genetic distribution of piaA.
The piaA gene was identified by PCR in all 39 of the typical S. pneumoniae strains tested, which covered 27 serotypes, and in all but Col 12 and X158 of the eight acapsular strains tested. The piaA gene could not be amplified from any of the atypical pneumococci, S. oralis, S. mitis, or atypical oral streptococci. In order to confirm that the piaA gene is confined to typical pneumococci and that it is not present in Col 12 and X158, a Southern blot was carried out, which confirmed the PCR results (data not presented). The piaA gene therefore appears to be confined to typical pneumococci and is not found in the closely related species S. mitis and S. oralis. It is also not present in the acapsulate pneumococci Col 12 and X158, reinforcing the hypothesis that these strains are not completely typical pneumococcal strains (55).
Genetic diversity of piuA.
An RFLP study was conducted on the piuA gene from 20 typical pneumococcal strains, covering 18 serotypes and all 19 clonal groups, and the acapsulate pneumococci (Col 11, Col 12, and X158). Also included were the six atypical pneumococci S. oralis NCTC 11427 and S. mitis NS51T type strains and the three atypical oral streptococci. The restriction profiles seen with the piuA digests for each restriction enzyme were assigned a restriction type (RT). Combined RTs were collated and a different allele was assigned to each RT pattern, and this information is summarized in Table 2.
In order to examine the extent of diversity between different alleles, the piuA gene from one strain representing each allele was subsequently sequenced in full. The nucleotide and amino acid identities between each sequenced piuA allele were calculated by the ClustalV method (22) and are shown in Table 3. Two alleles (alleles 1 and 2) were identified within the 23 typical and acapsulate pneumococci showing only 0.3% (nucleotide divergence) and 0.9% (amino acid divergence) between the two, indicating that the piuA gene is highly conserved within the typical and acapsulate pneumococci. In contrast and unsurprisingly, there were higher levels of variation found within the atypical pneumococci: four alleles present in only six strains (alleles 3, 4, 5, and 6). These alleles differed from those of the typical pneumococci by up to 6.4% (nucleotide divergence) and 5.6% (amino acid divergence).
As expected, both the S. mitis and S. oralis type strains showed novel piuA alleles (alleles 7 and 8, respectively), as these are distinct taxa (27). These differed from the typical pneumococcal alleles by up to 10.4 and 9.6% (nucleotide divergence) and 7.5 and 5% (amino acid divergence), respectively. The atypical oral streptococcal isolates 806, Col 16, and Col 20 each showed an individual allele (alleles 9, 10, and 11, respectively). These differed from the typical pneumococcal alleles by up to 9.4, 8.8, and 7.7% (nucleotide divergence) and 6.8, 5.6, and 5.6% (amino acid divergence), respectively. The important information provided by these results is that homologous recombination between the piuA gene of typical pneumococci and alleles held by S. mitis, S. oralis, atypical pneumococci, or atypical oral streptococci included in this study could introduce into the PiuA protein levels of divergence up to around 7.5, 5, 5.6, and 6.8%, respectively.
Phylogenetic relationships.
Phylogenetic and molecular evolutionary analysis was conducted using MEGA version 2.1 (29) and a dendrogram is shown in Fig. 1. Phylogenetic relationships based on the sequence of the piuA gene are very similar to those found previously based on sequencing of the xpt, recP, and hexB housekeeping genes (55). S. oralis and S. mitis cluster away from S. pneumoniae, with S. oralis then clustering away from S. mitis (bootstrap value, 94). The two piuA alleles shown by typical pneumococci (Jnr7/87 and 91cl18) have been placed together, and are closely related to but distinct from the alleles shown by the atypical pneumococci Col 26, Col 27, and 874. These associations are strongly supported by bootstrapping and fit in with phylogenetic studies previously carried out by Whatmore et al. (55). That study also grouped the atypical oral streptococci Col 16 and Col 20 together with S. mitis type strain 620, as shown here (bootstrap value, 99); however, in that study, the S. mitis-containing group also contained 806, which in this study has been grouped not with the other S. mitis strains, but with the atypical pneumococcus 1916, and is more closely related to typical pneumococci. S. mitis 806 harbors ply and lytA genes, which are not, however, pneumococcal alleles (55). It is therefore possible that S. mitis 806 represents an evolutionary progenitor from which S. pneumoniae evolved.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1. Dendrogram of genetic relationship between streptococcal isolates examined in this study constructed from the piuA gene sequence data by using the neighbor-joining method (29). S.p, Streptococcus pneumoniae; S.m, Streptococcus mitis; S.o, Streptococcus oralis.
|
|
Tandem duplications within piuA.
Sequence analysis of the piuA gene revealed perfect tandem duplication events in the atypical pneumococci Col 26, 874, and Col 27 and in the S. oralis type strain NCTC 11427. S. mitis 806 contained a nonperfect duplication, suggesting the occurrence of a single base substitution after the duplication event (Fig. 2). All duplications were situated at position 1777335 of the TIGR4 annotated genome sequence, which is bp 78 of the piuA gene. All duplications were six nucleotides in length and therefore do not disrupt the translational reading frame of the PiuA protein. The duplication instead leads, in all cases, to the insertion of extra amino acids threonine (T) and asparagine (N). The impact on the function of the PiuA protein of the insertion of these two amino acids, whether they are deleterious, advantageous, or without effect, is unknown. This is most likely an example of occasional duplication events occurring within functional loci, which have been hinted at previously (52). The duplication may have occurred long ago and has been lost from some strains by slip-strand mispairing, or it may have arisen independently. These duplications did not define the dendrogram shown in Fig. 1, as removal of the duplication from each strain harboring it had no effect on the structure of the dendrogram.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2. Tandem duplications found within the piuA gene of atypical S. pneumoniae and other oral streptococci. A) Sequence of the piuA gene (corresponding to nucleotides 1777315 to 1777362 of ORF SP1872) of TIGR4 sequenced strain Jnr7/87. B) Sequence of S. pneumoniae Col 26 with a perfect 6-bp tandem duplication. The duplicated sequence is shown in bold with the duplication shown in bold and underlined. S. pneumoniae Col 27 and 874 and S. oralis 542 have the same duplicated sequence. C) Sequence of S. mitis 806 with a nonperfect tandem duplication. The duplicated sequence is shown in bold, with the duplication shown in bold and underlined. In all cases the amino acid sequence is indicated below the nucleotide sequence, showing the incorporation of an additional threonine (T) and asparagine (N) residue as a result of the tandem duplications.
|
|
Genetic diversity of piaA.
All strains that proved positive for the piaA gene by PCR were included in the RFLP study. This analysis included all typical and acapsular strains except Col 12 and X158 (which are piaA negative), giving a total of 40 pneumococcal strains covering 24 serotypes. All strains showed the same allele for the piuA gene. Initially, distribution and divergence studies were carried out on the same strains as used for the piuA gene study; however, on finding that all the piaA genes from these strains had 100% identity based on RFLP, the study was extended to determine the extent of this conservation. This was the reasoning behind the inclusion of more typical pneumococcal strains in the piaA study than in the piuA study. We therefore showed that piaA is confined to typical pneumococci, where it is 100% conserved, based on RFLP analysis.
 |
DISCUSSION
|
|---|
A major drawback of the currently used pneumococcal polysaccharide-based vaccines is that they impart only serotype-specific immunity to the serotypes included in the vaccine. Much attention has therefore recently focused on the possibility of developing vaccines based on genetically conserved pneumococcal proteins present in all serotypes (45). Such proteins would not only induce more effective and durable humoral immune responses but also could potentially protect against all clinically relevant capsular types. In addition, components identified as being unique to S. pneumoniae are possible candidates for pneumococcal diagnostic tests. The work presented in this paper is therefore a study of the distribution and genetic diversity among S. pneumoniae of PiuA and PiaA, two recently identified lipoprotein components of the Piu and Pia iron uptake ABC transporters (9) which have been proposed as vaccine candidates (10).
It is also important to consider the possibility of vaccine candidates' evolving via intra- and interspecies recombination to a point where they escape vaccine coverage. Some 20 different species of streptococci reside within the nasopharynx, many of which are naturally transformable and are readily able to exchange genes with the pneumococcus (32). Hence, the selective pressures exerted on pneumococci during nasopharyngeal carriage by mass vaccination could select for recombinational escapes.
Included in this study were S. oralis and S. mitis strains, as these are the two species most closely related to S. pneumoniae (27) and have previously been shown to exchange genes with pneumococci in the evolution of penicillin resistance (14, 43). Three unusual isolates were included in this study, all clinical isolates from patients with respiratory tract disease (55). They are phenotypically and genetically most closely related to S. mitis but harbor the pneumolysin and autolysin genes classically associated with S. pneumoniae (55), which are commonly used in pneumococcal diagnostic PCR (18, 40, 41, 51). Additionally, it has been shown that some of these atypical oral streptococci (including Col 16) also possess competence-stimulating peptides much more closely related to those of S. pneumoniae than those of S. mitis strains (55). These organisms may therefore have an increased likelihood of donating DNA to S. pneumoniae by horizontal gene transfer events, as their own competence-stimulating peptides may induce a degree of competence in S. pneumoniae. They are also important organisms to consider when looking at strategies of vaccination against S. pneumoniae, as they clearly possess the potential to be pathogenic, yet may be resistant to immune responses generated by immunogens of typical pneumococci. It was therefore necessary to establish whether these species harbor the piuA and piaA genes, and if so, how divergent they are. This would indicate whether these species represent a readily available source of divergent piuA and piaA genes for the pneumococcus (13-15).
PCR and Southern blot revealed that all atypical pneumococci, S. oralis, and S. mitis strains included in the study were piaA negative; however, the piaA gene was identified in all typical pneumococci tested (39 strains covering 27 serotypes) and all acapsulate pneumococci except Col 12 and X158. The identity of Col 12 and X158 is ambiguous; as well as being acapsular, X158 is also bile insoluble. Perhaps these two strains therefore represent a middle ground between the typical and atypical pneumococci, in that they share very similar housekeeping genes but do not share some of the major characteristics of the pneumococcus, one of which could possibly be possession of the piaA gene.
Distribution studies carried out by Brown et al. confirm the absence of piaA in a single strain of S. oralis and S. mitis but also showed that the piaA gene is not harbored by S. gordonii, S. sanguis, S. milleri, or S. pyogenes (9). The presence of the piaA gene in S. pneumoniae, which is the most pathogenic of the mitis group streptococci, but its absence from closely related nonpathogenic species such as S. oralis has, among other evidence, led to the hypothesis that piaA lies within an S. pneumoniae pathogenicity island (9).
RFLP analysis revealed the presence of only one piaA allele among the typical pneumococci, suggesting 100% conservation within the piaA gene. To corroborate this result S. pneumoniae piaA sequences available on the Internet were compared. The sequences available came from S. pneumoniae Jnr7/87 (serotype 4) and R6 (acapsular) from the TIGR website (24, 49), S. pneumoniae type 23F (Spanish 23F-1), INV200 (serotype 14), OXC141 (serotype 3), and INV104B (serotype 1; the sequencing of this gene is not finished to date and therefore only 91% of the gene was available for comparison) from the Sanger Institute. The piaA sequences from strains Jnr7/87, R6, type 23F, and OXC141 and that available for the INV104B gene were identical at the nucleotide level. The sequence from strain INV200 was 99.8% conserved at the nucleotide level and 100% conserved at the amino acid level. Therefore, all these sequences are identical at the protein level. This further supports the RFLP evidence in this paper that the gene is highly conserved and displays little if any polymorphism between strains.
This high level of conservation suggests that PiaA would induce a serologically conserved immune response, and indeed this has been observed in both humans and mice (10, 53). Use of PiaA as a vaccine antigen would therefore overcome a major problem encountered by the polysaccharide-based vaccines of eliciting only serotype-specific immunity. The absence of piaA from divergent pneumococci and closely related streptococcal species means that it will not be subject to interspecies recombination as there are no sources of divergent piaA alleles with which homologous recombination can occur. This would greatly increase the shelf life of a PiaA-based vaccine, as point mutation is the only method by which the piaA gene will evolve; this process generates new alleles at a frequency 10-fold less than recombinational exchanges in the pneumococcus (17). In this respect, PiaA is an encouraging vaccine candidate against typical pneumococci; it would, however, be ineffective against atypical pneumococci and oral streptococci harboring the pneumolysin and autolysin genes, examples of which have been isolated from cases of respiratory disease (55). Although these unusual strains are currently a minor problem in contrast to disease caused by typical pneumococci, elimination of disease and possibly nasopharyngeal colonization by typical S. pneumoniae by a PiaA-based vaccine may lead to an increase in carriage and incidence of disease by these unusual isolates.
The discovery that piaA seems to be present strictly in typical pneumococci warrants further investigation of it not only as a vaccine candidate but also as a possible diagnostic target, which may prove more specific for pneumococci than the currently favored pneumolysin and autolysin genes (18, 40, 41, 51). The high level of conservation within the piaA gene also makes it a good candidate for PCR diagnosis, as sequence divergence will not lead to inaccuracies in amplification.
Distribution analysis showed that the piuA gene, unlike piaA, is present in all streptococcal strains included in the study except S. mitis K208. These strains included 22 typical pneumococci, covering 20 serotypes, three acapsulate pneumococci, six atypical pneumococci, two S. mitis, five S. oralis, and three atypical oral streptococci. This confirms previous reports of the presence of piuA in S. oralis and S. mitis as well as S. sanguis (9). The piuA gene is therefore clearly widespread among the mitis streptococci, although it has not been detected in S. gordonii (9). The piuA gene has also been found in S. milleri, showing that it is present not only in the mitis streptococci, but also in other viridans streptococci (9).
The piuA gene is highly conserved within the typical pneumococci, showing only 0.3% nucleotide and 0.9% amino acid divergence. This low level of divergence leads to a serologically conserved immune response in both humans and mice (10, 53) among typical pneumococci. The piuA genes of atypical pneumococci, S. mitis, and S. oralis strains included in this study represent a readily available source of divergent piuA alleles for the pneumococcus were it to come under the selective pressures of a vaccine. The piuA alleles held by atypical pneumococci, S. mitis, and S. oralis have over 70% nucleotide homology with those of typical pneumococci and are therefore conserved enough to allow homologous recombination to occur (44). Horizontal transfer events could therefore introduce into the pneumococcal PiuA protein levels of amino acid divergence of up to 5.6% (from atypical pneumococci), 5% (from S. oralis), 6.8% (from atypical oral streptococci), and 7.5% (from S. mitis). Whether this level of protein divergence would cause serological variation of the PiuA protein, and hence the possibility of vaccine failure, would require investigation.
Both PiuA and PiaA appear to fulfill one of the initial criteria of a vaccine candidate in that piuA is present in all pneumococci tested, typical and atypical, and that piaA is present in all typical pneumococci tested. In terms of distribution and divergence, PiaA is a desirable vaccine and diagnostic candidate due to its conservation within typical pneumococci and its inability to evolve via horizontal gene transfer. PiuA, on the other hand, may evolve by interspecies and intraspecies recombination, leading to an inability to elicit a serologically conserved immune response and necessitating the inclusion in a vaccine of multiple PiuA alleles, perhaps those affording the most cross-protective immune responses. However, the wider distribution of piuA would enable a vaccine to also protect against more divergent yet disease-causing streptococcal strains. This, together with the proven synergistic protective effect of covaccination with these antigens (10), makes a good argument for inclusion of both PiuA and PiaA in a vaccine.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported through funding from the UK Department of Health by the Health Protection Agency, Porton Down (formerly the Centre for Applied Microbiology and Research).
L. D. Bowler is grateful for the support of the Meningitis Research Foundation.
 |
FOOTNOTES
|
|---|
* Corresponding author. Present address: Division of Mycobacterial Research, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom. Phone: 44 20 8816 2224. Fax: 44 20 8816 2564. E-mail: rwhalan{at}nimr.mrc.ac.uk. 
 |
REFERENCES
|
|---|
- Alexander, J. E., R. A. Lock, C. C. Peeters, J. T. Poolman, P. W. Andrew, T. J. Mitchell, D. Hansman, and J. C. Paton. 1994. Immunization of mice with pneumolysin toxoid confers a significant degree of protection against at least nine serotypes of Streptococcus pneumoniae. Infect. Immun. 62:5683-5688.[Abstract/Free Full Text]
- Avery, O. T., C. M. MacLeod, and M. McCarty. 1944. Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Induction of transformation by a desoxyribonucleic acid from pneumococcus type III. J. Exp. Med. 79:137-158.[Abstract]
- Barcus, V. A., K. Ghanekar, M. Yeo, T. J. Coffey, and C. G. Dowson. 1995. Genetics of high level penicillin resistance in clinical isolates of Streptococcus pneumoniae. FEMS Microbiol. Lett. 126:299-303.[CrossRef][Medline]
- Beighton, D., A. D. Carr, and B. A. Oppenheim. 1994. Identification of viridans streptococci associated with bacteraemia in neutropenic cancer patients. J. Med. Microbiol. 40:202-204.[Abstract]
- Beighton, D., J. M. Hardie, and R. A. Whiley. 1991. A scheme for the identification of viridans streptococci. J. Med. Microbiol. 35:367-372.[Abstract]
- Bochud, P. Y., T. Calandra, and P. Francioli. 1994. Bacteremia due to viridans streptococci in neutropenic patients: a review. Am. J. Med. 97:256-264.[CrossRef][Medline]
- Bochud, P. Y., P. Eggiman, T. Calandra, G. Van Melle, L. Saghafi, and P. Francioli. 1994. Bacteremia due to viridans streptococcus in neutropenic patients with cancer: clinical spectrum and risk factors. Clin. Infect. Dis. 18:25-31.[Medline]
- Brooks-Walter, A., D. E. Briles, and S. K. Hollingshead. 1999. The pspC gene of Streptococcus pneumoniae encodes a polymorphic protein, PspC, which elicits cross-reactive antibodies to PspA and provides immunity to pneumococcal bacteremia. Infect. Immun. 67:6533-6542.[Abstract/Free Full Text]
- Brown, J. S., S. M. Gilliland, and D. W. Holden. 2001a. A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol. Microbiol. 40:572-585.[CrossRef][Medline]
- Brown, J. S., A. D. Ogunniyi, M. C. Woodrow, D. W. Holden, and J. C. Paton. 2001b. Immunization with components of two iron uptake ABC transporters protects mice against systemic Streptococcus pneumoniae infection. Infect. Immun. 69:6702-6706.[Abstract/Free Full Text]
- Crain, M. J., W. D. Waltman, 2nd, J. S. Turner, J. Yother, D. F. Talkington, L. S. McDaniel, B. M. Gray, and D. E. Briles. 1990. Pneumococcal surface protein A (PspA) is serologically highly variable and is expressed by all clinically important capsular serotypes of Streptococcus pneumoniae. Infect. Immun. 58:3293-3299.[Abstract/Free Full Text]
- Douglas, C. W., J. Heath, K. K. Hampton, and F. E. Preston. 1993. Identity of viridans streptococci isolated from cases of infective endocarditis. J. Med. Microbiol. 39:179-182.[Abstract]
- Dowson, C. G., V. Barcus, S. King, P. Pickerill, A. Whatmore, and M. Yeo. 1997. Horizontal gene transfer and the evolution of resistance and virulence determinants in Streptococcus. Soc, Appl. Bacteriol. Symp. Ser. 26:42S-51S.[Medline]
- Dowson, C. G., T. J. Coffey, C. Kell, and R. A. Whiley. 1993. Evolution of penicillin resistance in Streptococcus pneumoniae; the role of Streptococcus mitis in the formation of a low affinity PBP2B in S. pneumoniae. Mol. Microbiol. 9:635-643.[Medline]
- Dowson, C. G., T. J. Coffey, and B. G. Spratt. 1994. Origin and molecular epidemiology of penicillin-binding-protein- mediated resistance to beta-lactam antibiotics. Trends Microbiol. 2:361-366.[CrossRef][Medline]
- Eskola, J., T. Kilpi, A. Palmu, J. Jokinen, J. Haapakoski, E. Herva, A. Takala, H. Kayhty, P. Karma, R. Kohberger, G. Siber, and P. H. Makela. 2001. Efficacy of a pneumococcal conjugate vaccine against acute otitis media. N. Engl. J. Med. 344:403-409.[Abstract/Free Full Text]
- Feil, E. J., J. M. Smith, M. C. Enright, and B. G. Spratt. 2000. Estimating recombinational parameters in Streptococcus pneumoniae from multilocus sequence typing data. Genetics 154:1439-1450.[Abstract/Free Full Text]
- Gillespie, S. H., C. Ullman, M. D. Smith, and V. Emery. 1994. Detection of Streptococcus pneumoniae in sputum samples by PCR. J. Clin. Microbiol. 32:1308-1311.[Abstract/Free Full Text]
- Hausdorff, W. P., J. Bryant, C. Kloek, P. R. Paradiso, and G. R. Siber. 2000. The contribution of specific pneumococcal serogroups to different disease manifestations: implications for conjugate vaccine formulation and use, part II. Clin. Infect. Dis. 30:122-140.[CrossRef][Medline]
- Hausdorff, W. P., J. Bryant, P. R. Paradiso, and G. R. Siber. 2000. Which pneumococcal serogroups cause the most invasive disease: implications for conjugate vaccine formulation and use, part I. Clin. Infect. Dis. 30:100-121.[CrossRef][Medline]
- Henrichsen, J. 1995. Six newly recognized types of Streptococcus pneumoniae. J. Clin. Microbiol. 33:2759-2762.[Abstract]
- Higgins, D. G., and P. M. Sharp. 1989. Fast and sensitive multiple sequence alignments on a microcomputer. Comput. Appl. Biosci. 5:151-153.[Abstract/Free Full Text]
- Hollingshead, S. K., R. Becker, and D. E. Briles. 2000. Diversity of PspA: mosaic genes and evidence for past recombination in Streptococcus pneumoniae. Infect. Immun. 68:5889-5900.[Abstract/Free Full Text]
- Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S. T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H. Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W. Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young-Bellido, G. Zhao, C. A. Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J. Bacteriol. 183:5709-5717.[Abstract/Free Full Text]
- Iannelli, F., M. R. Oggioni, and G. Pozzi. 2002. Allelic variation in the highly polymorphic locus pspC of Streptococcus pneumoniae. Gene 284:63-71.[CrossRef][Medline]
- Jomaa, M., J. Yuste, J. C. Paton, C. Jones, G. Dougan, and J. S. Brown. 2005. Antibodies to the iron uptake ABC transporter lipoproteins PiaA and PiuA promote opsonophagocytosis of Streptococcus pneumoniae. Infect. Immun. 73:6852-6859.[Abstract/Free Full Text]
- Kawamura, Y., X. G. Hou, F. Sultana, H. Miura, and T. Ezaki. 1995. Determination of 16S rRNA sequences of Streptococcus mitis and Streptococcus gordonii and phylogenetic relationships among members of the genus Streptococcus. Int. J. Syst. Bacteriol. 45:406-408.[Abstract]
- Kilian, M. 1998. Streptococcus and lactobacillus, p. 633-667. In A. Balows and B. I. Duerden (ed.), Topley and Wilson's microbiology and microbial infections, 9th ed., vol. 2. Arnold, London, England.
- Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17:1244-1245.[Abstract/Free Full Text]
- Lipsitch, M. 1997. Vaccination against colonizing bacteria with multiple serotypes. Proc. Natl. Acad. Sci. USA 94:6571-6576.[Abstract/Free Full Text]
- Lucas, V. S., D. Beighton, G. J. Roberts, and S. J. Challacombe. 1997. Changes in the oral streptococcal flora of children undergoing allogeneic bone marrow transplantation. J. Infect. 35:135-141.[CrossRef][Medline]
- Majewski, J., P. Zawadzki, P. Pickerill, F. M. Cohan, and C. G. Dowson. 2000. Barriers to genetic exchange between bacterial species: Streptococcus pneumoniae transformation. J. Bacteriol. 182:1016-1023.[Abstract/Free Full Text]
- Mbelle, N., R. E. Huebner, A. D. Wasas, A. Kimura, I. Chang, and K. P. Klugman. 1999. Immunogenicity and impact on nasopharyngeal carriage of a nonavalent pneumococcal conjugate vaccine. J. Infect. Dis. 180:1171-1176.[CrossRef][Medline]
- McDaniel, L. S., J. S. Sheffield, P. Delucchi, and D. E. Briles. 1991. PspA, a surface protein of Streptococcus pneumoniae, is capable of eliciting protection against pneumococci of more than one capsular type. Infect. Immun. 59:222-228.[Abstract/Free Full Text]
- Mitchell, T. J., F. Mendez, J. C. Paton, P. W. Andrew, and G. J. Boulnois. 1990. Comparison of pneumolysin genes and proteins from Streptococcus pneumoniae types 1 and 2. Nucleic Acids Res. 18:4010.[Free Full Text]
- Morrison, K. E., D. Lake, J. Crook, G. M. Carlone, E. Ades, R. Facklam, and J. S. Sampson. 2000. Confirmation of psaA in all 90 serotypes of Streptococcus pneumoniae by PCR and potential of this assay for identification and diagnosis. J. Clin. Microbiol. 38:434-437.[Abstract/Free Full Text]
- Muller-Graf, C. D., A. M. Whatmore, S. J. King, K. Trzcinski, A. P. Pickerill, N. Doherty, J. Paul, D. Griffiths, D. Crook, and C. G. Dowson. 1999. Population biology of Streptococcus pneumoniae isolated from oropharyngeal carriage and invasive disease. Microbiology 145:3283-3293.[Abstract/Free Full Text]
- Obaro, S. K., R. A. Adegbola, W. A. Banya, and B. M. Greenwood. 1996. Carriage of pneumococci after pneumococcal vaccination. Lancet 348:271-272.[Medline]
- Roche, H., B. Ren, L. S. McDaniel, A. Hakansson, and D. E. Briles. 2003. Relative roles of genetic background and variation in PspA in the ability of antibodies to PspA to protect against capsular type 3 and 4 strains of Streptococcus pneumoniae. Infect. Immun. 71:4498-4505.[Abstract/Free Full Text]
- Rudolph, K. M., A. J. Parkinson, C. M. Black, and L. W. Mayer. 1993. Evaluation of polymerase chain reaction for diagnosis of pneumococcal pneumonia. J. Clin. Microbiol. 31:2661-2666.[Abstract/Free Full Text]
- Salo, P., A. Ortqvist, and M. Leinonen. 1995. Diagnosis of bacteremic pneumococcal pneumonia by amplification of pneumolysin gene fragment in serum. J. Infect. Dis. 171:479-482.[Medline]
- Sampson, J. S., Z. Furlow, A. M. Whitney, D. Williams, R. Facklam, and G. M. Carlone. 1997. Limited diversity of Streptococcus pneumoniae psaA among pneumococcal vaccine serotypes. Infect. Immun. 65:1967-1971.[Abstract]
- Sibold, C., J. Wang, J. Henrichsen, and R. Hakenbeck. 1992. Genetic relationships of penicillin-susceptible and -resistant Streptococcus pneumoniae strains isolated on different continents. Infect. Immun. 60:4119-4126.[Abstract/Free Full Text]
- Spratt, B. G. 1994. Resistance to antibiotics mediated by target alterations. Science 264:388-393.[Abstract/Free Full Text]
- Swiatlo, E., and D. Ware. 2003. Novel vaccine strategies with protein antigens of Streptococcus pneumoniae. FEMS Immunol. Med. Microbiol. 38:1-7.[CrossRef][Medline]
- Tai, S. S., C. Yu, and J. K. Lee. 2003. A solute binding protein of Streptococcus pneumoniae iron transport. FEMS Microbiol. Lett. 220:303-308.[CrossRef][Medline]
- Talkington, D. F., B. G. Brown, J. A. Tharpe, A. Koenig, and H. Russell. 1996. Protection of mice against fatal pneumococcal challenge by immunization with pneumococcal surface adhesin A (PsaA). Microb. Pathog. 21:17-22.[CrossRef][Medline]
- Tart, R. C., L. S. McDaniel, B. A. Ralph, and D. E. Briles. 1996. Truncated Streptococcus pneumoniae PspA molecules elicit cross- protective immunity against pneumococcal challenge in mice. J. Infect. Dis. 173:380-386.[Medline]
- Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506.[Abstract/Free Full Text]
- Throup, J. P., K. K. Koretke, A. P. Bryant, K. A. Ingraham, A. F. Chalker, Y. Ge, A. Marra, N. G. Wallis, J. R. Brown, D. J. Holmes, M. Rosenberg, and M. K. Burnham. 2000. A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol. Microbiol. 35:566-576.[CrossRef][Medline]
- Ubukata, K., Y. Asahi, A. Yamane, and M. Konno. 1996. Combinational detection of autolysin and penicillin-binding protein 2B genes of Streptococcus pneumoniae by PCR. J. Clin. Microbiol. 34:592-596.[Abstract]
- Waite, R. D., J. K. Struthers, and C. G. Dowson. 2001. Spontaneous sequence duplication within an open reading frame of the pneumococcal type 3 capsule locus causes high-frequency phase variation. Mol. Microbiol. 42:1223-1232.[CrossRef][Medline]
- Whalan, R. H., S. G. Funnell, L. D. Bowler, M. J. Hudson, A. Robinson, and C. G. Dowson. 2005. PiuA and PiaA, iron uptake lipoproteins of Streptococcus pneumoniae, elicit serotype independent antibody responses following human pneumococcal septicaemia. FEMS Immunol. Med. Microbiol. 43:73-80.[CrossRef][Medline]
- Whatmore, A. M., V. A. Barcus, and C. G. Dowson. 1999. Genetic diversity of the streptococcal competence (com) gene locus. J. Bacteriol. 181:3144-3154.[Abstract/Free Full Text]
- Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D. Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of "atypical" pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factor-encoding genes. Infect. Immun. 68:1374-1382.[Abstract/Free Full Text]
Journal of Bacteriology, February 2006, p. 1031-1038, Vol. 188, No. 3
0021-9193/06/$08.00+0 doi:10.1128/JB.188.3.1031-1038.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.