This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, Z.-C.
Right arrow Articles by Finan, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, Z.-C.
Right arrow Articles by Finan, T. M.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2006, p. 1089-1102, Vol. 188, No. 3
0021-9193/06/$08.00+0     doi:10.1128/JB.188.3.1089-1102.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Regulation and Properties of PstSCAB, a High-Affinity, High-Velocity Phosphate Transport System of Sinorhizobium meliloti

Ze-Chun Yuan, Rahat Zaheer, and Turlough M. Finan*

Center for Environmental Genomics, Department of Biology, McMaster University, Hamilton, Ontario, Canada L8S 4R8

Received 16 June 2005/ Accepted 27 October 2005


arrow
ABSTRACT
 
The properties and regulation of the pstSCAB-encoded Pi uptake system from the alfalfa symbiont Sinorhizobium meliloti are reported. We present evidence that the pstSCAB genes and the regulatory phoUB genes are transcribed from a single promoter that contains two PhoB binding sites and that transcription requires PhoB. S. meliloti strain 1021 (Rm1021) and its derivatives were found to carry a C deletion frameshift mutation in the pstC gene (designated pstC1021) that severely impairs activity of the PstSCAB Pi transport system. This mutation is absent in RCR2011, the parent of Rm1021. Correction of the pstC1021 mutation in Rm1021 by site-directed mutagenesis revealed that PstSCAB is a Pi-specific, high-affinity (Km, 0.2 µM), high-velocity (Vmax, 70 nmol/min/mg protein) transport system. The pstC1021 allele was shown to generate a partial pho regulon constitutive phenotype, in which transcription is activated by PhoB even under Pi-excess conditions that render PhoB inactive in a wild-type background. The previously reported symbiotic Fix phenotype of phoCDET mutants was found to be dependent on the pstC1021 mutation, as Rm1021 phoCDET mutants formed small white nodules on alfalfa that failed to reduce N2, whereas phoCDET mutant strains with a corrected pstC allele (RmP110) formed pink nodules on alfalfa that fixed N2 like the wild type. Alfalfa root nodules formed by the wild-type RCR2011 strain expressed the low-affinity orfA-pit-encoded Pi uptake system and neither the pstSCAB genes nor the phoCDET genes. Thus, metabolism of alfalfa nodule bacteroids is not Pi limited.


arrow
INTRODUCTION
 
The transport of inorganic phosphate or other sources of phosphorus is essential for growth of all living organisms. In most soil environments, the concentration of soluble or biologically available phosphate is in the micromolar range, and it seems likely that many soil microorganisms live under Pi-limiting growth conditions (8, 10). It is known that many microorganisms have the ability to change their metabolism in response to the amount of phosphorus available for cellular growth. The switch in metabolism is mediated through the repression and induction of transcription of various genes whose products are involved in processes ranging from the uptake and acquisition of sources of phosphorus to the de novo synthesis of new cellular components that allows redistribution of, or replacement of, molecules such as phospholipids that represent large reservoirs of phosphorus within the cell (4, 5, 27, 29, 61, 62, 63, 67). In many gram-negative bacteria, phoB regulates expression of genes whose expression responds to exogenous phosphorus concentrations. The response regulator PhoB, together with its cognate sensor histidine kinase, PhoR, has been well studied in Escherichia coli, and genes whose expression is regulated by the PhoB protein are referred to as members of the Pho regulon (11, 47, 71).

Sinorhizobium meliloti is a gram-negative {alpha}-proteobacterium that forms N2-fixing root nodules on alfalfa. Our analysis of the Pi transport systems of S. meliloti resulted from identification of a locus on the pSymB megaplasmid that was required for the development of wild-type N2-fixing nodules (Fix+) (16, 17). This locus comprised the phoCDET genes, which encode an ABC-type high-affinity transport system, and we demonstrated that this system could transport Pi and likely phosphonates (4, 69). S. meliloti strains carrying mutations in the phoCDET genes formed small white nodules on alfalfa that contained few bacteroids and failed to fix N2 (Fix) (4, 16). In further studies, we identified two classes of second-site mutations that suppressed the Fix phenotype of phoCDET mutants to Fix+. Genetic and biochemical analyses revealed that one of the suppressor mutant classes carried mutations that were located in the promoter and increased transcription of the orfA-pit genes, which encode a low-affinity Pi transport system (6, 48, 69). These mutations are close to a putative PhoB binding site in the orfA-pit operon. The other suppressor mutations mapped to the phoB locus, and phoB null alleles were found to suppress the phoCDET Fix phenotype. PhoB was subsequently shown to be a positive regulator of phoCDET transcription and a negative regulator of orfA-pit transcription (5). All of the data suggested the following model for orfA-pit and phoCDET regulation. In S. meliloti cells growing in the presence of excess Pi (2 mM), the orfA-pit genes are expressed, and Pi is transported via the low-affinity OrfA-Pit transport system. Under these Pi-excess conditions, PhoB is inactive, and the phoCDET genes are not expressed. Under Pi-limiting conditions, the orfA-pit genes are repressed by activated PhoB, the phoCDET genes are expressed, and Pi is transported via the high-affinity PhoCDET system.

Our examination of the Pi transport systems of S. meliloti Rm1021 suggested that only two transport systems, PhoCDET and OrfA-Pit, were functional. However, sequence analysis of the region upstream of the S. meliloti phoUB genes revealed the presence of genes homologous to the phosphate-specific transport genes, pstSCAB, that have been best characterized in E. coli (58, 64, 74). Many bacterial strains contain products of pstSCAB homologs that function as high-affinity phosphate transporters (13, 31, 32, 45, 46, 53). The PstSCAB proteins comprise an ABC-type transport system in which PstS is a periplasmic Pi binding protein, PstC and PstA are integral membrane proteins, and PstB is the ATP binding protein (15, 37, 65).

Here we describe genetic and biochemical studies that were performed to determine the role of the pstSCAB gene cluster in gene regulation and Pi assimilation in S. meliloti. We found that the pstC gene in S. meliloti strain 1021 carries a frameshift C deletion mutation, designated pstC1021, that can be corrected by insertion of a cytosine at the original mutant site or through addition of a guanine base 42 nucleotides upstream of the original C deletion. Regulatory and phenotypic effects of the pstC1021 mutation were investigated, and the previously reported Fix phenotype of phoCDET mutants was shown to be dependent on the pstC1021 allele found in all Rm1021-derived strains. The biochemical properties of the wild-type PstSCAB transport system were determined, and the implications of the new data for the previous analysis of the phoCDET and orfA-pit genes of S. meliloti are discussed below.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, media, and growth conditions. The strains and plasmids employed in this work are listed in Table 1. The E. coli strains were grown in Luria-Bertani (LB) medium, and the S. meliloti strains were grown in LB medium containing 2.5 mM MgSO4 and 2.5 mM CaCl2 (LBmc). The phosphate-free medium was morpholinopropanesulfonic acid (MOPS)-buffered minimal medium (4) containing 0.3 µg/ml biotin and 10 ng/ml CoCl2 (72) supplemented with an appropriate filter-sterilized carbon source. For growth experiments we used the protocol described by Bardin and Finan (5). S. meliloti cultures were grown overnight in LBmc and washed with MOPS medium with no phosphate added (MOPS P0); 20 µl of the cells was used to inoculate 5 ml of MOPS P0 (optical density at 600 nm [OD600], ~0.05). The cells were grown for 24 h with agitation, and the OD600 of the resulting cultures were adjusted to 0.2; 200-µl portions of these cultures were then used to inoculate 20 ml of MOPS medium supplemented with 2 mM orthophosphate (MOPS P2) or MOPS P0 in disposable tissue culture bottles.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains, phage, and plasmids

When necessary, media were supplemented with the following antibiotics: ampicillin (100 µg/ml), chloramphenicol (10 µg/ml), gentamicin (8 µg/ml for E. coli and 30 µg/ml for S. meliloti), kanamycin (20 µg/ml for E. coli), neomycin (200 µg/ml for S. meliloti), streptomycin (200 µg/ml for S. meliloti), and tetracycline (10 µg/ml for S. meliloti and 7 µg/ml for E. coli).

DNA manipulation and genetic techniques. Cloning procedures, including DNA isolation, restriction digestion, ligation, and transformation, were performed as described by Sambrook et al. (59). Conjugal mating with MT616 as the helper strain was performed as previously described (18). {phi}M12 generalized transduction was carried out as described by Finan et al. (25).

To isolate the 7.5-kb HindIII DNA fragment containing S. meliloti phoR-pstSCAB and a partial phoU region, we first isolated an R-prime plasmid carrying this region by using the protocol described by Osteras et al. (49). Construction of R-prime plasmids is based on the ability of plasmid R68.45 to mobilize the DNA of the host strain at a high frequency (57). The R68.45 derivative pJB3JI (Tcr) was transferred into RmH615 (phoB3::TnV), and the resulting strain was used as the donor in conjugational mating with rifampin-resistant (Rifr) E. coli recipient strain MT620. Transconjugants were selected on LB medium with rifampin (20 µg/ml) and kanamycin (20 µg/ml). Plasmid DNA was isolated from these transconjugants, and the transconjugants carrying R-prime plasmids with genomic DNA contiguous with the phoB3::TnV insertion in RmH615 were identified with reference to the DNA sequence of TnV and the phoR-pstSCAB-phoU region. The 7.5-kb HindIII gene fragment from one R-prime plasmid was subcloned into pUC119 to obtain pTH691, and the border sequence of this fragment was confirmed by sequencing using the –48 universal primer.

To make lacZ-aacC1 cassette (9) or {Omega}Sp cassette (52) insertions in the S. meliloti pstB gene, the 2.7-kb HindIII-EcoRI DNA fragment containing the pstAB region was subcloned from pTH691 into the pK18GIImob vector (34) to obtain plasmid pTH659, and the lacZ-aacC1 cassette was inserted into the SmaI site of the pstB gene in two orientations to obtain plasmids designated pTH663 (lacZ-aacC1 in the orientation opposite that of pstB) and pTH664 (lacZ-aacC1 in same orientation as pstB). The {Omega}Sp cassette was inserted into the same SmaI site of pTH659 to obtain plasmid pTH665 (Fig. 1A). S. meliloti strains RmK385, RmK386, and RmK390 carrying the mutations described above were identified following transfer of the appropriate Gmr plasmid into RmG212 and subsequent screening for double-crossover recombinants with subsequent loss of the Nmr vector marker. This generated strains. RmK426 was constructed by transducing neomycin resistance from RmH615 (phoB3::TnV) into RmK385 and screening for neomycin-resistant transductants.


Figure 1
View larger version (70K):
[in this window]
[in a new window]
 
FIG. 1. (A) Schematic diagram of the gene cluster that is between nucleotide positions 565,044 and 573,164 on the S. meliloti 1021 chromosome. The SMc02146 gene is referred to as pstS. Triangle 1 indicates the position of the lazZ-aaC1 or {Omega}Sp cassettes in the pstB fusion and insertion mutant strains RmK385, RmK386, RmK390, and RmK426, whereas triangle 2 indicates the location of the phoB::TnV insertion in the RmK426 strain (see Materials and Methods). (B) DNase I footprint of the pstS promoter. Lane 1, PhoB protein incubated with 191-bp PCR product of 32P-labeled forward primer and unlabeled reverse primer and digested with DNase I; lane 2, PhoBDBD protein incubated with 191-bp PCR (primers ML3171 and ML3172) product and digested with DNase I; lane 3, PCR product digested with DNase I; lane 4, undigested PCR product. The DNA sequence ladder was generated by using forward primer ML3171 and the pTH1892 plasmid as the template. (C) Determination of transcriptional start sites of the pstS promoter in S. meliloti strain Rm1021 through extension of 32P-labeled ML4128 primer. Lane 1, RNA obtained from Rm1021 cells grown in LB medium; lane 2, RNA obtained from RmH615 (Rm1021 phoB) cells grown in LB medium. (D) Electrophoretic mobility shift assays of 191-bp PCR product (primers ML3171 and ML3172) containing pstS promoter region. Lane 1, 191-bp 32P-end-labeled PCR; lane 2, labeled probe incubated with 100 ng full-length PhoB protein; lane 3, labeled probe; lane 4, labeled probe incubated with 50 ng PhoBDBD. (E) Sequence of pstS promoter region, showing the locations of Pho boxes, the DNase I protected region, transcription initiation sites, and the primers used.

The pstS-pstC intergenic regions from Rm1021, RmG212, RCR2011, Rm5000, RmG830, and the suppressor mutant RmP101 were PCR amplified and sequenced using primers ML3344 (5'-ACGATCAGATGATCGGCCCCGAC-3') and ML3345 (5'-CCCAGACCGTGCCGAAGAA GAAC-3'), as shown in Fig. 1A. All primers were synthesized at the McMaster University MOBIX facility, and all the sequences were obtained from this facility.

The promoter regions of pstS, orfA-pit, and phoC were PCR amplified and cloned into pTH1582, a modified version of the parAB gusA reporter vector pJP2 (51, 77), to generate pTH1734, pTH1735, and pTH1736, respectively. The primers for pstS were ML6254 (5'-CGAAGCTTAGCATATCCTCACGCGTCACCG-3') and ML6255: (5'-AACTCGAGATCAGAGCAGGTTGCCTGCCTC-3'); the primers for phoC were ML7605 (5'-CGAAGCTTCTATGCGGTCCAACTCGCTCGC-3') and ML7606 (5'-AACTCGAGTTGAGCGAGGAGACCTGTAGGC-3'); and the primers for orfA-pit were ML7607 (5'-CGAAGCTTGAGTGCCCGTGCCGATCTCC-3') and ML7608 (5'-GATTTCGTCGGCCTCATTCTCGAGCG-3').

Site-directed mutagenesis. To convert the pstC1021 mutation to the wild type, the 1.4-kb PstI-EcoRI fragment containing the pstS-pstC intergenic region (Fig. 1A) was cloned into the pJQ200-SK vector (54) to obtain plasmid pTH1906. Using pTH1906 as the template, PCR mutagenesis was performed using primers ML3567 (5'-ACCCGATTGCGGGCACGGAAACGGACGTCG-3') and ML3568 (5'-ACGTCCGTTTCCGTGCCCGCAATCGGGTGG-3'). Pfu Turbo DNA polymerase from Stratagene was used in the PCR, and the PCR product was digested with DpnI (New England Biolabs). The sequences of inserts in pTH1906 carrying the pstC1021 mutation and the corrected plasmid designated pTH1907 carrying the wild-type RCR2011 pstC allele were confirmed by DNA sequencing. Plasmid pTH1907 was transferred into RmG212, RmG490, and Rm1021, and single-crossover recombinants were selected on LB medium containing 40 µg/ml gentamicin. Double-crossover integrants were subsequently obtained by growing cells on LBmc with 5% sucrose and screening for gentamicin-sensitive (Gms) colonies as described by Quandt and Hynes (54). Strains Rm1021, RmG212, and RmG490 carrying the corrected wild-type pstC gene were designated RmP110, RmP111, and RmP371, respectively. In the same way, pTH1096, which contained the pstC1021 allele, was integrated into Rm5000, and a recombinant in which the wild-type pstC gene was replaced by the pstC1021 allele was designated RmP379. The DNA sequence of the pstS-C region in strains RmP110, RmP111, RmP371, and RmP379 was confirmed following PCR amplification and sequencing with primers ML3344 and ML3345 as described above.

Plant growth, alkaline phosphatase, ß-galactosidase, and ß-glucuronidase assays. Alkaline phosphatase and ß-galactosidase activities were measured as described previously (5). ß-Glucuronidase assays were performed as described by Reeve et al. (56). Plant growth experiments in a nitrogen-deficient growth medium were performed as described previously (4). To measure ß-glucuronidase activity in nodules, plants were harvested 4 weeks following inoculation, and 7 to 10 nodules were put into a 1.5-ml tube containing 750 µl ice-cold MMS buffer (40 mM MOPS, 20 mM KOH, 2 mM MgSO4, 0.3 M sucrose; pH 7.0). The nodules were crushed and then centrifuged for 2 min at 2,000 rpm. Five hundred microliters of the supernatant was transferred to a new tube, and sodium dodecyl sulfate was added to a final concentration 0.01%. Ten microliters was removed to determine the total protein concentration using the Bio-Rad assay. One hundred microliters of the nodule extract was used in the ß-galactosidase assay as described previously (56).

For histochemical GusA staining, the protocol described by Boivin et al. (12) was used, with modifications. Fresh nodules were manually sectioned using a razor blade to obtain 0.5- to 1-mm-thick sections. Fifty microliters of GusA staining solution was added to cover the sections. One hundred milliliters of staining solution contained 50 ml of 0.2 M phosphate buffer (pH 7), 43 ml of double-distilled H2O, 50 µl of Triton X-100, 4 ml of 0.25 M EDTA (pH 7.0), 1.5 ml of 0.1 M K3Fe(CN)6 instead of 0.5 ml, and 1.5 ml of 0.1 M K4Fe(CN)6 instead of 0.5 ml. Five milligrams of X-Gluc (5-bromo-4-chloro-3-indolyl-ß-glucuronide) was added to 5 ml of the staining solution. After staining for 2 to 3 h at room temperature (a vacuum could have aided in penetration of the X-Gluc solution), the sections were rinsed two or three times in the staining solution without X-Gluc. Photographs were taken using a Leitz Laborlux-12 microscope (magnification, x40) and a Nikon Dxm1200F digital camera system.

Phosphate transport assays. The Pi uptake assay was performed essentially as described previously (69). S. meliloti strains were grown in LBmc overnight to OD600 of around 1.0, washed three times in Pi-free MOPS-buffered medium, and subcultured 1:50 into MOPS minimal medium with or without phosphate. Cells were grown for 10 to 12 h, harvested, washed once in Pi-free MOPS medium, and resuspended in MOPS medium to an OD600 of around 1.0 for strains with the pstC wild-type allele and to OD600 of around 10.0 for strains carrying the pstC1021 allele. Thirty microliters of cells was added to 450 µl of Pi-free MOPS medium and equilibrated for 5 min at 30°C in a water bath. Twenty-microliter portions of various concentrations of 33P-labeled K2HPO4 ([33P]orthophosphoric acid prepared with a specific activity of 135 Ci/mol; NEN Research Products) was added to initiate Pi transport. Aliquots (100 µl) were removed from the assay mixture at different times, placed on nitrocellulose filters (pore size, 0.45 mm; HAWP 025 00; Millipore, Bedford, Mass.) that had been presoaked in 1 M K2HPO4/KH2PO4 (pH 7.0), and immediately washed with Pi- and carbon-free MOPS medium. The filters were dried, placed in scintillation liquid (BCS; Amersham, Little Chalfont, England), and counted. For competition experiments, cells were equilibrated for 4 min at 30°C before 4 µM or 40 µM inhibitor was added (1 min before [33P]orthophosphate was added at a final concentration of 1 µM). All the transport assays were performed in triplicate, and the values reported below are the means of three assays.

Isolation of total RNA and primer extension analysis. Total RNA was prepared as described by MacLellan et al. (39). Briefly, overnight cultures of S. meliloti Rm1021 and RmH615 (phoB3::TnV) (5) were used to inoculate 100-ml portions of LBmc. Cultures were grown with shaking at 30°C to OD600 of 0.4 to 0.6. Without delay, cultures were supplemented with 0.1 volume of cell stop solution (39) and immediately centrifuged to pellet the cells. The cell pellets were flash frozen in liquid nitrogen and stored at –80°C until use. Thawed pellets from 50 ml of culture were resuspended in 960 µl of RNase-free water and split into two portions (480 µl each). Cells were lysed by addition of an equal volume of hot phenol buffer (39) at room temperature, and each suspension was vortexed vigorously and heated at 95°C for 1 min. The lysed cell suspension was centrifuged for 10 min at high speed to pellet debris, and the aqueous supernatant was subjected to two phenol-chloroform extractions (using a 1:1 ratio of unbuffered phenol and chloroform) and one final chloroform extraction. Nucleic acids were precipitated with 0.1 volume of 3 M sodium acetate (pH 5.2) and 2 volumes of isopropyl alcohol on ice for 30 min. DNA in the sample was removed by digestion with RNase-free DNase I, and RNA was recovered after phenol-chloroform extraction by precipitation as described above.

To identify the transcriptional start site through primer extension, a 27-mer oligonucleotide primer (5'-CCAGCGCCGCTACTGTGAGTTTAAGAG-3') complementary to nucleotide positions 8 to 34 of the protein coding region was end labeled with [{gamma}-32P]ATP (Amersham) using T4 polynucleotide kinase (New England Biolabs) at 37°C for 45 min, followed by removal of unincorporated label by passage through a QIAGEN oligopurification column. In a typical primer extension reaction, ~40 µg of total S. meliloti RNA was supplemented with 2 x 105 cpm of end-labeled primer, 4 µl of 5x reverse transcriptase buffer, 0.8 µl of a deoxynucleoside triphosphate mixture containing all four nucleotides (25 mM each), and enough RNase-free water to bring the volume to 16 µl. The mixture was heated at 65°C in a water bath for 10 min, allowed to cool slowly to room temperature, and then placed on ice. The annealed mixture was supplemented with 2 µl of 100 mM dithiothreitol (DTT) and 1 µl of RNaseOUT (Invitrogen) and was incubated at 50°C for 2 min before addition of 1 µl (200 U) of SuperScript III reverse transcriptase (Invitrogen) and further incubation at 50°C for 50 min. The reaction was stopped with an equal volume of formamide containing 2x loading dye. The primer extension product was loaded onto a 6% acrylamide-7 M urea sequencing gel and run alongside a sequencing ladder generated by using the same primer with plasmid template pTH1892 (1.25-kb PCR product containing the pstS coding region and the upstream promoter region in the pGEM-T TA cloning vector from Promega and a Sequenase version 2 DNA sequencing kit [Amersham]).

Overexpression and purification of PhoB and PhoBDBD. The S. meliloti PhoB protein coding region and PhoB DNA binding domain (23) and the PhoBDBD (amino acids 126 to 227) coding sequences were PCR amplified using primers ML1636 (forward) (CGAGTTACCATATGTTGCCGAAGATTGCCG) and ML1637 (reverse) (CGTAAGCTTGCTCTCCAGCGAATAGCCC) and primers ML2723 (forward) (GGAATTCCATATGGAGGTTCTGTCGACGCTCCTG) and ML2724 (reverse) (CGTAAGCTTGCTC TCCAGCGAATAGCCC), respectively, and cloned into NdeI and HindIII restriction sites of the pET21a vector (Novagen). The resulting plasmids, pTH825 and pTH1457, were transformed into BL21(DE3)/pLysS to develop the J841 and M341 bacterial strains for PhoB and PhoBDBD, respectively. Cultures were grown in LB medium containing 100 µg/ml of ampicillin and 30 µg/ml of chloramphenicol at 37°C until the OD600 was ~0.5 and induced with 0.3 to 0.5 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for 3 h at 30°C. Proteins were purified on Ni-nitrilotriacetic acid resin (QIAGEN) used according to manufacturer's instructions. Eluted fractions containing purified proteins were pooled and dialyzed against 50 mM HEPES (pH 8.0)-300 mM NaCl-10% glycerol-1 mM DTT. The purities of the two proteins were verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and quantities were measured using the Bio-Rad dye reagent.

DNase I footprinting. DNase I footprinting assays were based on the method described by Schmitz and Galas (60), with modifications. The target DNA fragment from the pstS promoter was obtained by PCR amplification with 5'-32P-labeled forward primer ML3171 (CAAGGTCCGCTTCTGACACAC) and unlabeled reverse primer ML3172 (GCTTGTGTTGGTGCGCCAGG), using pTH1892 as the template, which yielded a 191-bp DNA fragment. The labeled PCR product was purified using QIAGEN PCR purification columns to remove unincorporated [{gamma}-32P]ATP. DNase I footprinting was performed by incubating ~50,000 cpm of labeled PCR product with protein binding buffer [20 mM HEPES (pH 8.0), 5 mM magnesium acetate, 80 mM KCl, 0.2 mM EDTA, 1 mM DTT, 0.5 mM CaCl2, 200 µg/ml bovine serum albumin, 100 ng of poly(dI-dC), and 2% glycerol), 250 ng of full-length PhoB protein or 125 ng of PhoBDBD protein, and 0.25 U of DNase I enzyme (Invitrogen) for 1 min. Reaction products were resolved on an 8% acrylamide-7 M urea sequencing gel alongside a sequencing ladder generated by using the ML3171 primer with plasmid template pTH1892.

Electrophoretic mobility shift assay. The basic gel shift protocol used was based on the methods of Garner and Revzin (28). The DNA probe was derived from a 191-bp PCR product of primers ML3171 and ML3172 (see above). This PCR product was labeled at both ends using [{gamma}-32P]ATP and T4 polynucleotide kinase and was subsequently purified with a QIAGEN PCR purification column to remove unincorporated label. Protein-DNA binding reaction mixtures contained approximately 6,000 cpm DNA probe in 15 µl (final volume) of DNA binding buffer [20 mM HEPES (pH 8.0), 5 mM magnesium acetate, 50 mM KCl, 0.5 mM EDTA, 2 mM dithiothreitol, 200 µg of bovine serum albumin/ml, 100 ng of poly(dI-dC), and 4% glycerol] with or without 50 to 100 ng of purified PhoB or PhoBDBD. The reaction mixtures were incubated on ice for 10 min, and this was followed by 20 min of incubation at 25°C. The reaction mixtures were resolved onto nondenaturing 5 to 6% polyacrylamide gels in 0.5x Tris-borate-EDTA at room temperature. Following electrophoresis, the probes were detected either using a Storm820 phosphorimager (Amersham Pharmacia Inc.) or by radiography.


arrow
RESULTS
 
Expression of pstSCAB-phoUB in Rm1021. Strain Rm1021 is a streptomycin-resistant derivative of S. meliloti wild-type strain Rm2011 (43). Rm2011 and RCR2011 are alternative laboratory names given to nodule isolate SU47, which was originally isolated in 1939 in New South Wales, Australia (68).

Rm1021 grows well in MOPS-buffered minimal medium containing 2 mM Pi, while an Rm1021 phoC mutant and a phoC pit double mutant grow very poorly in a medium containing 2 mM Pi (4, 5, 6). While these data suggested that the phoCDET and orfA-pit genes encode the major Pi transporters in S. meliloti, the sequence of the S. meliloti chromosome upstream of the phoUB genes revealed a gene cluster with similarity to the pstSCAB Pi transport genes of E. coli, and this prompted us to investigate this region further. This gene cluster lies at nucleotides 565,258 to 573,066 on the S. meliloti 1021 chromosome and includes the genes annotated as phoR, SMc02146, SMc02145, pstC, pstA, phoU, and phoB (Fig. 1A) (14). SMc02146 is similar in terms of sequence and gene location to the previously annotated phosphate-binding periplasmic proteins (PstS) in many organisms, and below we refer to the SMc02146 gene as pstS. SMc02145 is annotated to encode a 201-amino-acid signal peptide hypothetical protein, and this open reading frame overlaps the pstC gene by 31 nucleotides. PstC and PstA are annotated as phosphate transport permeases, and PstB is the transport ATP binding protein. PhoU is predicted to be involved in regulation, and PhoB is the response regulator believed to be activated by phosphorylation by its cognate sensor protein PhoR (40, 41, 42, 65).

In initial experiments, we constructed a pstB::{Omega}Spr insertion mutant and found that the mutation abolished alkaline phosphatase activity in cells grown under Pi-limiting conditions. This suggested that pstB or a gene(s) downstream of pstB (such as phoB) was required for Pi-regulated alkaline phosphatase synthesis (Fig. 1A). To address this issue and also to monitor expression of the S. meliloti pstSCAB gene cluster, we constructed the nonpolar chromosomal pstB::lacZ-aacCI gene fusion strain RmK385, in which transcription of genes downstream of pstB was driven from the aacCI promoter (see Materials and Methods). Cultures of this strain grown in MOPS medium with 2 mM Pi had high ß-galactosidase activities (~160 Miller units) and low alkaline phosphatase activities (<5 Miller units), while cultures grown in MOPS medium with no added Pi had both high ß-galactosidase activities (~160 Miller units) and high alkaline phosphatase activities (50 Miller units). Moreover, disruption of phoB (phoB3::TnV) in the pstB::lacZ-aacCI strain was found to eliminate ß-galactosidase activity (<7 Miller units) and alkaline phosphatase activity (<5 Miller units). These data revealed that expression of alkaline phosphatase in Rm1021 required PhoB and was responsive to the concentration of available Pi and that pstB expression required PhoB but paradoxically was unresponsive to Pi in the medium.

Identification of PhoB binding sites in the pstS promoter. Since pstB transcription appeared to be dependent on PhoB, we searched the phoR-phoB DNA region for motifs with sequence similarity to the PhoB binding sites, as described previously for E. coli (35). Two such sites were located upstream of the pstS gene (Fig. 1E). To investigate the functionality of these sites, we cloned a DNA fragment made up of sequences 250 bp upstream of the pstS translation start codon and 30 bp downstream into the reporter plasmid pFUS1 (56). ß-Glucuronidase activity from this plasmid was found to be expressed constitutively (400 Miller units) in Rm1021 cells grown in the presence of high and low Pi concentrations, but only background activity (20 Miller units) was observed in the Rm1021 phoB mutant strain, RmH615. Thus, pstS transcription in Rm1021 appears to be unresponsive to the Pi concentration in the medium, yet pstS transcription required the pho regulator PhoB.

The nature of the PhoB-like binding sites was examined further in DNA gel shift experiments. For these experiments, we employed a full-length PhoB protein with a C-terminal His tag and a truncated protein consisting of PhoB C-terminal amino acids 125 to 227 followed by six histidine residues (70). In gel shift experiments with a 191-bp DNA fragment from the pstS promoter, these proteins produced two distinct products with reduced mobility in polyacrylamide gels (Fig. 1B). To investigate the site(s) to which PhoB bound, DNase I footprinting of the pstS promoter region in the presence and absence of PhoB or PhoBDBD was performed (Fig. 1C). Both PhoB and PhoBDBD were found to protect a 50-nucleotide region that included all of predicted PhoB binding site I and all but four nucleotides at PhoB site II (Pho box 1 and 2 sequences in Fig. 1E). The pstS promoter was subsequently mapped by primer extension with mRNA from Rm1021 cells (Fig. 1C). A prominent extension product was detected, and analysis of the DNA sequence revealed that this site was 45 nucleotides downstream of the first of the two predicted PhoB binding sites. In summary, data from the analysis of the pstS-phoB gene cluster in Rm1021 suggested that this region was transcribed as an operon with a single pstS promoter that was PhoB dependent but, unusually, was apparently not responsive to changing Pi concentrations in the medium.

pit phoC suppressor mutation restores a full-length reading frame to the pstC gene in Rm1021. Examination of the symbiotic phenotype of the S. meliloti pit phoC double mutant (RmG830) revealed that it formed small white nodules that failed to fix nitrogen (Fix). This was expected as Rm1021 phoC mutants alone are Fix (4, 16). Thus, when grown in the absence of fixed nitrogen, alfalfa plants inoculated with RmG830 were stunted and yellow and died about 5 weeks after inoculation. However, among 30 such plants, a single green plant was observed, and the roots of this plant had a single pink nodule. Isolation and characterization of bacteria from this nodule revealed that they contained the antibiotic resistance markers (Nmr and Spr) associated with the pit310::Tn5 and phoC490::{Omega}Sp insertion mutations of the RmG830 inoculant strain. Moreover, when alfalfa seedlings were inoculated with the purified nodule isolate (designated RmP101), the resulting plants formed pink nitrogen-fixing root nodules that appeared to be indistinguishable from wild-type Fix+ nodules. In addition, the nodule isolate RmP101 grew like the wild type in MOPS medium containing 2 mM Pi. These results suggested that this strain contained a suppressor mutation that restored PI uptake and N2-fixing ability to the phoC pit double mutant. To investigate this further, the SMc02145-pstC intergenic region was amplified by PCR from suppressor strain RmP101 and its parent strain RmG830 (see Materials and Methods). The sequences of this region showed that the RmG830 sequence was identical to the annotated Rm1021 GenBank sequence. However, examination of the suppressor mutant sequence showed that it differed from the Rm1021 and RmG830 sequences by a single G insertion between nucleotides 512 and 513 of the annotated 606-bp SMc02145 gene. This single-nucleotide addition to the SMc02145 sequence altered the amino acid reading frame from residues 171 to 201, and the new reading frame was in frame with the annotated pstC gene. The resulting new pstC gene was 1,485 nucleotides long and encoded a 494-amino-acid PstC protein (Fig. 2).


Figure 2
View larger version (54K):
[in this window]
[in a new window]
 
FIG. 2. Nucleotide and amino acid sequences showing the 3' 105-nucleotide region from SMc02145 and 34 nucleotides from the 5' region of the pstC gene in S. meliloti 1021 and its derivative RmG830 (Rm1021 pit310::Tn5 phoC490::{Omega}Sp). Schematic diagrams of the pstSCAB region with the annotated SMc02145 gene and truncated pstC gene in strain Rm1021 and its derivative RmG830 are at the top; also shown is the position of the full-length pstC gene in wild-type strain RCR2011, Rm5000, and RmP101 (Fix+ derivative of RmG830). The aligned nucleotide sequences with the C nucleotide (boldface type and underlined) present in RCR2011 and Rm5000 but absent in Rm1021 and its derivatives are shown. The single G insertion in the RmP101 sequence is also indicated by boldface type and underlining. In the translated sequences for the Rm1021 SMc02145 and SMc02146 proteins (PstC') and PstC from RCR2011 (similar to Rm5000) and the sequence resulting from the G frameshift mutation in RmP101, the amino acids that differ from those in RCR2011 are indicated by boldface type. The underlined ATG indicates the translation start site for the truncated pstC gene in Rm1021 and RmG830.

These data led us to suspect that this locus may contain a mutation, and detailed examination of this region revealed that the SMc02145 gene (nucleotides 567841 to 568443), annotated as a gene encoding a hypothetical signal peptide protein, had a 31-bp overlap with the 5' end of the pstC gene (nucleotides 568413 to 569324). Moreover, searches of the GenBank database with the SMc02145 sequence revealed similarity between it and sequences encoding the N-terminal region of PstC proteins from various bacteria. This suggested that SMc02145 and pstC may be a single gene but that a mutation resulted in their annotation as two distinct genes (Fig. 2). Comparison of the sequence of the SMc02145-pstC gene region from RCR2011, following its amplification by PCR, revealed that RCR2011 and Rm1021 differed by a single C addition between nucleotides 552 and 553 of the reported Rm1021 SMc02145 sequence (Fig. 2). The C deletion mutation in Rm1021 was also recently reported by Krol and Becker; however, these authors did not establish that the Pho regulon phenotypes examined resulted from the deletion mutation (36). As in the case of suppressor strain RmP101, the reading frame deduced from the RCR2011 sequence, which contained the single C nucleotide insertion, fused the SMc02145 and pstC genes to generate a PstC protein containing 494 amino acid residues. The sequences of the predicted RCR2011 and RmP101 PstC proteins differed over a 13-amino-acid region as the G insertion in RmP101 occurred 42 nucleotides upstream of the C deletion mutation (Fig. 2).

Amplification of the SMc02145-pstC region from the Lac Rm1021 derivative RmG212 revealed that its sequence was the same as that of Rm1021. On the other hand, the sequence of this region obtained from the rifampin-resistant SU47 derivative Rm5000 was the same as the sequence obtained from RCR2011; i.e., it contained an additional C compared with the Rm1021 sequence. Thus, Rm1021 and its derivatives carry a C deletion mutation that generates a truncated PstC protein and the SMC02145 protein. Below we refer to the pstC allele in Rm1021 as pstC1021.

Confirmation and extent of the Pho phenotype resulting from the pstC1021 deletion mutation. To confirm that the C deletion mutation in Rm1021 alone was responsible for the Pho phenotype of this strain, we tried to correct the mutation in Rm1021 by site-directed mutagenesis. Accordingly, a PstI-EcoRI fragment carrying the Rm1021 pstS-C region was cloned into the gentamicin-resistant sacB suicide plasmid pJQ200-SK (54) to obtain pTH1906. Oligonucleotides ML3567 and ML3568 were then employed to convert the pstC1021 mutation to the wild type, which yielded plasmid pTH1907. Single-crossover Smr Gmr recombinants were selected following transfer of pTH1907 to Rm1021, RmG212 (Rm1021 Lac), and RmG490 (Rm1021 phoC490::{Omega}Sp). Resolution of the cointegrate by recombination resulted in loss of the plasmid, and a proportion of the Gms recombinants carried the additional C residue of the wild-type pstC allele, as identified by PCR amplification and sequencing of this region from Gms recombinants. In a similar manner, plasmid pTH1906 was used to introduce the pstC1021 allele into Rm5000. Following purification of Rifr Gmr transconjugant cointegrates, Gms recombinants that carried the pstC1021 allele, such as RmP379, were identified following PCR amplification and sequencing. The Pho phenotype of the resulting strains was assessed by measuring pstS promoter activity (see below) and by measuring the alkaline phosphatase activity in cultures grown for 12 h in LBmc. Strains carrying the pstC1021 allele had high alkaline phosphatase activities, whereas very low activities were observed in strains carrying the "wild-type" pstC locus. Thus, Rm1021 and the pstC1021 derivative of Rm5000 (RmP379) had 29.6 ± 2.1 and 27.5 ± 2.6 U of alkaline phosphatase activity, respectively, whereas the pstC+ derivative of Rm1021, RmP110, and Rm5000 had 4.9 ± 1.0 and 2.6 ± 0.4 U of activity, respectively. The alkaline phosphatase activity of RmG490 (Rm1021 phoC490::{Omega}Sp) was very high (48.4 ± 3.0 U); however, the alkaline phosphatase activity was dramatically lower in the phoC pstC+ derivative RmP371 (2.3 ± 0.3 U).

To investigate the influence of the chromosomal pstC allele on transcription from the pstS promoter, plasmid pTH1002 carrying a pstS-gusA fusion was introduced into RCR2011, RmP110, and Rm1021, and ß-glucoronidase activity was measured in cells cultured in MOPS media with 2 mM Pi and no added Pi (Table 2). As indicated above, in the Rm1021 (pstC1021) background, pstS-gusA was transcribed at a high level in cells grown with excess or limiting Pi, and this transcription was PhoB dependent as only background activity was detected in the phoB mutant RmH615. However, in RCR2011 and RmP110, which carried the wild-type pstC allele, pstS transcription was highly induced in Pi-starved cultures, whereas very low ß-glucoronidase activity and hence little pstS transcription were detected in cultures grown with excess Pi (Table 2). Thus, the presence of the pstC1021 allele appeared to override the dependence of pstS transcription on the availability of Pi in the medium.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Expression of a plasmid-borne pstS::gusA gene fusion in S. meliloti strains carrying pstC1021 or pstC wild-type alleles following growth in minimal medium with limiting and excess Pi

Fix phenotype of phoC mutations is dependent on the pstC1021 allele. The effects of the pstC1021 and pstC+ alleles on the alkaline phosphatase activity of phoC mutant cells prompted us to investigate the effects of pstC alleles on the symbiotic Fix phenotype of phoC mutant cells. Thus, phoC mutant strains and derivatives that carried the wild-type pstC+ and pstC1021 alleles were inoculated onto alfalfa seedlings. Their symbiotic N2 fixation phenotypes were measured by determining the plant dry weight following growth for 28 days in Leonard jars under nitrogen-deficient conditions (Table 3). The dry weights of plants inoculated with pstC+ phoC strains were the same as the dry weights of plants inoculated with Fix+ parent strains RCR2011, Rm1021, and Rm5000. This contrasts with the Fix phenotype of plants inoculated with the Rm1021 (pstC1021) phoC mutant strains RmG490 and RmG830, whose dry weights were similar to those of the uninoculated control plants which failed to fix nitrogen (Table 3). We concluded that the Fix phenotype resulting from phoC mutations depended on the presence of the pstC1021 mutation. Moreover, the slow growth of RmG490 (Rm1021 phoC490::{Omega}Sp) in MOPS-buffered minimal medium containing 2 mM Pi was also dependent on the pstC1021 allele since RmP636 and RmP371 grew like the wild type in medium containing 2 mM Pi.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Symbiotic phenotypes of S. meliloti strainsa

What is the biochemical role of pstSCAB? The effects of pstC1021 and the wild-type pstC allele on the growth phenotype of phoC mutant strains suggested that the wild-type pstSCAB locus encodes a Pi transport system. We assumed that the partial function of this system allowed sufficient Pi uptake to enable phoC pit double mutants to grow, albeit slowly, in MOPS-buffered minimal medium containing 2 mM Pi (6). To investigate this further, we constructed a phoC pit double mutant carrying the wild-type pstSCAB genes. The resulting strain, RmP636, grew like parent strains RmP110 and Rm1021 in MOPS medium containing 2 mM Pi. In uptake assays with Pi-starved cells and a substrate concentration of 4 µM Pi, 33Pi was rapidly transported into the RmP110 phoC pit double mutant, RmP636, and into RmP110 (Fig. 3). In contrast to RmP636 and RmP110, which had the wild-type pstSCAB locus, the rate of Pi transport into Rm1021 was low. This is consistent with the modest Vmax (6.8 and 1 to 2 nmol/min/mg protein for Pi transport via the PhoCDET and OrfA-Pit systems, respectively) (6, 69). A time course for Pi uptake into RmG830 (Rm1021 phoC pit) and RmP101 revealed that the pstC1021 frameshift suppressor mutation resulted in substantial Pi transport via the modified PstSCAB transport system (Fig. 3). As might be expected from the 13-amino-acid difference between the PstC sequences in RmP101 and RmP110, the rate of uptake in RmP101 was not restored to wild-type RmP110 levels.


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Time course of 33Pi uptake for various S. meliloti strains. S. meliloti cells were grown as described in Materials and Methods and were subcultured in MOPS medium without added Pi for 10 h prior to the assay. The concentration of Pi in the transport assay buffer was 4 µM. The strains used were Rm1021 (carrying the pstC1021 allele), RmG830 (Rm1021 phoC490::{Omega}Sp pit310::Tn5), RmP101 (suppressor mutant of RmG830), RmP110 (same as Rm1021 but with the corrected pstC allele), RmP636 (RmP110 phoC490::{Omega}Sp pit310::Tn5), and RmP626 (RmP110 phoB3::TnV). The symbols indicate the means of triplicate assays. The Pi uptake line for RmP626 (RmP110 phoB3::TnV) was similar to the line for RmG830 (the line located on the bottom of the graph), and for clarity the line for RmP626 is not shown.

Examination of the kinetics of Pi transport into RmP636 revealed Michaelis-Menton-type kinetics with a Km for PstSCAB-mediated Pi uptake of 0.2 µM and a Vmax of 70 nmol/min/mg protein (Fig. 4). The specificity of PstSCAB transport was determined by addition of potential competitors at 4 and 40 times the concentration of labeled Pi. The addition of phosphonates had minimal effects on the rate of Pi transport, whereas the Pi analogue arsenate severely reduced Pi uptake into the RmP636 cells (Table 4). From these data we concluded that PstSCAB encodes a high-affinity, high-velocity Pi transport system and that in contrast to Pi uptake via the PhoCDET system (69), phosphonates do not compete for Pi uptake via the PstSCAB system.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 4. Kinetics of PstSCAB-mediated 33Pi uptake by S. meliloti. Strain RmP636 (RmP110 phoC490::{Omega}Sp pit310::Tn5) was subcultured in phosphate-free MOPS minimal medium for 10 h prior to the assay. A Michaelis-Menten plot and a Hanes-Woolf plot for the same data (inset) are shown. The Km was calculated to be 0.2 µM, and the Vmax was 70 nmol/min/mg protein. The assays were performed as described in Materials and Methods, and each symbol indicates the mean of triplicate values; the error bars indicate standard errors. The alkaline phosphatase activity for the cells used in this experiment was 60 U.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Specificity of PstSCAB-directed 33Pi uptake

Expression of pit, phoC, and pstS in nodules. To monitor expression of the three S. meliloti Pi transporters in symbiotic conditions, the promoter regions of phoC, orfA-pit, and pstS were cloned into the modified parAB-stabilized pJP2 vector to produce plasmids pTH1734, pTH1735, and pTH1736, respectively. The resulting promoter-gusA fusion plasmids were introduced into wild-type strain RCR2011 and its derivative RCR2011 phoB3::TnV (RmP559). Expression in the phoB mutant was examined since orfA-pit expression is negatively regulated by PhoB, while expression of the pstSCAB and phoCDET genes requires PhoB. Alfalfa seedlings inoculated with these strains were grown for 4 weeks, and the ß-glucuronidase activities in the crude nodule extracts were determined (Fig. 5). In addition, the expression patterns of the three Pi transporters were examined by using histochemical staining for ß-glucuronidase in root nodules (Fig. 6). Both assays revealed that the orfA-pit system was highly expressed in nodules, while very little phoCDET or pstSCAB expression was detected, irrespective of whether the nodules were induced by wild-type strain RCR2011 or the RCR2011 phoB mutant. The even distribution of the stain in nodules carrying the orfA-pit::gusA fusion plasmid revealed no zone-specific expression, and neither phoC nor pstS expression was detected in any nodule zone (Fig. 6). These data strongly suggest that bacteroid metabolism within alfalfa nodules is not Pi limited.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5. Expression of S. meliloti Pi transporter genes in alfalfa root nodules. The phoC, orfA-pit, and pstS promoter regions were fused to the gusA reporter gene in pTH1582 to obtain plasmids pTH1734, pTH1735, and pTH1736, respectively. The plasmid-borne fusions were introduced into wild-type strain RCR2011 and RCR2011 phoB3::TnV. The empty vector introduced into RCR2011 was used as a negative control. Nodules were harvested 28 days after inoculation, and ß-glucuronidase activities (ß-Gluc. Act.) were determined as described in Materials and Methods. Each bar indicates the mean of an assay performed in triplicate, and the error bars indicate standard errors.


Figure 6
View larger version (60K):
[in this window]
[in a new window]
 
FIG. 6. Photographs of longitudinal sections of 4-week-old alfalfa nodules stained for ß-glucuronidase activity. Nodules were obtained from plants inoculated with wild-type strain RCR2011 and its phoB3::TnV derivatives containing promoter gusA fusions, including RCR2011 (orfA-pit::gusA) (A), RCR2011 (phoB3::TnV orfA-pit::gusA) (B), RCR2011 (pstS::gusA), and RCR2011 (phoC::gusA) (D). The photographs were taken with a Leitz Laborlux-12 microscope (magnification, 4 x 10) and a Nikon Dxm1200F digital camera system.


arrow
DISCUSSION
 
Our characterization of the pstSCAB gene cluster in S. meliloti revealed that these genes encode a high-affinity Pi-specific transport system. We examined the kinetics and specificity of PstSCAB-mediated Pi uptake by utilizing a phoC pit double mutant in which the wild-type (corrected pstC gene) pstSCAB genes are expressed. In this strain Pi uptake exhibited Michaelis-Menton kinetics with a Vmax of 70 nmol/min/mg protein and a Km of 0.2 µM. The Km value is similar to that reported for Pi uptake via the S. meliloti PhoCDET system and is 10-fold higher than the Km value of the low-velocity OrfA-Pit system (69). The rate of Pi uptake via PstSCAB was much higher than the rate of Pi uptake via the PhoCDET system, and Pi uptake via the PstSCAB system was not inhibited by methyl or ethyl phosphonates, which is consistent with the pst gene designation (phosphate-specific transport) (Table 4). To summarize the data in obtained in this and previous studies, S. meliloti RCR2011 cells grown in media with excess Pi transport Pi via the low-affinity, low-velocity OrfA-Pit transporter. Upon transfer to Pi-limited media, the orfA-pit genes are repressed and the pstSCAB and phoCDET gene are expressed. Pi transport then occurs via the high-affinity, high-velocity PstSCAB system (Fig. 4).

The identification of the single C deletion mutation in the pstC gene of Rm1021 agrees with the recent report of Krol and Becker (36), in which this sequence difference between Rm1021 and Rm2011 (a derivative of RCR2011) was also described. Moreover, employing site-directed mutagenesis, we demonstrated that this specific mutation is responsible for several Pho-related phenotypes observed in the Rm1021 background but not in the RCR2011 background. These phenotypes include the high alkaline phosphatase activity detected when Rm1021 is cultured in LB medium, constitutive pstS expression, and the inability of phoCDET mutants of Rm1021 to form N2-fixing root nodules on alfalfa. The Pho phenotype resulting from the pstC1021 mutation is similar to the Pho regulon constitutive phenotype that results from pst mutations in E. coli (20, 71, 73) and from mutations in the PHO84 high-affinity Pi transport system in Saccharomyces cerevisiae (76). While these data suggest that the transport systems play a role in sensing the Pi concentration and the signal transduction pathway, more recent evidence suggests that it is the intracellular concentration of Pi that is the major signal for regulation of the Pho pathway (3, 32, 76). We note that the pstC1021 mutation of S. meliloti 1021 results in a partial Pho constitutive phenotype in which PhoB transcription of genes such as pstS is constitutive (Table 3), whereas transcription of the phoA gene encoding alkaline phosphatase and the phoC genes is repressed upon addition of 2 mM Pi (5). Our data and conclusions regarding the partial function of the pstC1021 allele concur with those of Krol and Becker (36). Moreover, our data suggest that members of the Pho regulon show a hierarchical regulation that is presumably influenced by the level of activated PhoB protein in the cell. We infer that since the pstC1021 mutation allows a low level of Pi transport, the resulting Pho phenotype is partial.

We failed to detect Pi uptake via the PstSCAB system in previous studies as the Rm1021 background strain employed in those studies carried the C deletion mutation in pstC. While this frameshift mutation at nucleotide position 553 of the 1,485-nucleotide pstC gene would be expected to eliminate PstSCAB-mediated Pi uptake, below we discuss several lines of evidence which suggest that a very low level of Pi uptake still occurs via this mutant PstSCAB system. The pstC1021 mutation is not polar on transcription of the downstream pstAB-phoUB genes since pstB::lacZ gene fusions are expressed in Rm1021 and also PhoB-dependent alkaline phosphatase activity occurs in Rm1021 cells. It is therefore very likely that in Rm1021, the 5' region of the pstC mRNA is translated to give a 201-amino-acid C-terminal truncated protein and that additional translation of the pstC mRNA from an internal ATG generates an N-terminal truncated 303-amino-acid PstC protein, as suggested from the genome annotation (26). The lengths of PstC proteins from various organisms, including E. coli, Haemophilus influenzae, Bacillus subtilis, and Mesorhizobium loti (294 to 327 amino acids), are similar to the length of the predicted Rm1021 mutant PstC protein, and this protein has six predicted membrane-spanning domains frequently present in the ABC permease proteins (1, 13, 31, 45, 46, 53). Thus, while the size of the predicted wild-type PstC protein (494 amino acids) is similar to the sizes of the annotated PstC proteins from Agrobacterium tumefaciens (504 amino acids) and Brucella suis 1330 (496 amino acids) (50, 75), it is possible that the N-terminal 150-amino-acid region from PstC is not absolutely required for full PstC function.

We attribute the ability of Rm1021 pit phoC mutants to grow, albeit slowly, in media containing 2 mM Pi to be due to residual Pi uptake via the defective pstSCAB system. We previously showed that the S. meliloti phoC pit double mutant RmG830 could transport 33Pi (0.25 nmol/min/mg protein) but that the level of transport was insufficient to allow growth at a wild-type rate in media with 2 mM Pi (16).

Perhaps the most definitive evidence showing that the Rm1021 mutant PstSCAB system has residual Pi uptake activity was obtained from experiments in which we transduced polar and nonpolar pstB::lacZ-aacC1 alleles into Rm1021 pit, Rm1021 phoC, and Rm1021 pit phoC double-mutant backgrounds (Table 5). No recombinants were recovered when either of the pstB alleles was transferred into the pit phoC double mutant RmG830. However, pit pstB double-mutant recombinants were readily constructed with the nonpolar pstB::lacZ-aacC1 allele (RmR385 donor) that expressed phoB, while pit pstB recombinants were not recovered with the polar pstB allele (RmK386 donor) (Table 5). We suggest that the failure to recover pit pstB (polar) double mutants is due to the requirement of PhoB for transcription of both the pstSCAB and phoCDET genes; hence, a pit pstB (polar) double mutant is genotypically pit and pstB and phenotypically PhoCDET. The data in Table 5 also revealed that we failed to recover phoC pstB recombinants with the nonpolar pstB::lacZ-aacC1 allele, while recombinants were readily recovered upon transduction of the nonpolar pstB allele into the phoC mutant strain (Table 5). This was expected since in a phoC pstB (nonpolar) recombinant strain, phoB is expressed and the resulting activated PhoB protein represses orfA-pit transcription (6). In the phoC pstB (polar) recombinants, phoB is not transcribed and there is no PhoB protein to repress orfA-pit expression; hence, Pi transport occurs via Pit.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Transduction of polar and nonpolar pstB insertion mutations into RmG804, RmG212, RmG490, and RmG830

We noted that in the related organism A. tumefaciens, disruption of the phoB gene appears to be lethal (21). Examination of the orfA-pit region in A. tumefaciens C58 (atu4633-4634) revealed that the Pit-like protein (Atu4633) has a 138-amino-acid C-terminal deletion compared to the 334-amino-acid Pit protein of S. meliloti (5, 75). We suggest that in A. tumefaciens, the OrfA-Pit transport system is nonfunctional and hence, as in a Pit S. meliloti strain, disruption of the phoB gene would be lethal.

Our finding that the pstSCAB system of Rm1021 is partially active for Pi uptake and the transcriptional requirement of this system for phoB activation, together with the transduction results shown in Table 5, led us to conclude that the OrfA-Pit, PstSCAB, and PhoCDET systems are the major transport systems that can transport Pi in S. meliloti. This is reminiscent of the transport activities reported for E. coli, although in E. coli the pit systems do not appear to be negatively regulated by phoB (32, 55, 74). In view of the specificity and activity of the pstSCAB-encoded transport system, it is worth reconsidering the annotation of the phoCDET genes. These genes were annotated as Pho genes because they are regulated by PhoB and the PhoCDET transport system was demonstrated to transport Pi at a high rate (4, 69). Phylogenetically, the Pho genes cluster with the phosphonate uptake (phn) genes (33, 44), and while we demonstrated that there is Pi uptake via the PhoCDET system, the uptake was inhibited by stoichiometric concentrations of alkyl phosphonates, such as methyl or ethyl phosphonates. The S. meliloti genome sequence revealed that genes whose sequences are similar to the sequences of the phnMN genes from E. coli are 1 kb downstream of the phoT gene. For these reasons we suggest that the phoCDET genes should be reannotated as the phnCDET genes.

We previously reported that phoCDET mutations eliminate N2 fixation; however, as described here, it is now clear this Fix symbiotic phenotype is dependent on the pstC1021 mutation, which severely reduces PstSCAB-mediated Pi uptake in S. meliloti Rm1021. This finding is consistent with our previous reports in which the symbiotic Fix phenotype of Rm1021 phoCDET mutants was shown to be suppressed to Fix+ by mutations that allow expression and Pi transport via the OrfA-Pit transport system (5, 48, 69). We have also observed that a pstB::{Omega}Sp mutation suppressed the symbiotic Fix phenotype of Rm1021 phoCDET mutants and the growth deficiency phenotype of the Rm1021 phoCDET mutant in the presence of 2 mM Pi (data not shown). This was expected because the pstB::{Omega}Sp mutation was polar on the downstream genes, including phoB, and phoB mutations suppressed the Fix phenotype of phoCDET mutants by allowing the orfA-pit system to be expressed (5, 6). We constructed phoC pit double mutants in RCR2011 (RmP633) and RmP110 backgrounds (RmP636), in which the pstSCAB genes were wild type, and both the double mutants formed normal wild-type N2-fixing root nodules (Table 3). Thus, the results of this study, together with previous reports, show that expression of a single functional Pi transport system, be it OrfA-Pit, PstSCAB, or PhoCDET, is necessary and sufficient for symbiotic N2 fixation in alfalfa.

It is important to consider the data and conclusions reported here, together with previously published microarray data (36) regarding the pleiotropic effect of the pstC1021 mutation in Rm1021, when genomic experiments with strain Rm1021 are considered. Thus, the partial Pho constitutive phenotype resulting from the pstC1021 mutation appears to be responsible for the reported expression of phoCDET in microarray studies and the presence of phoD in proteomic studies of alfalfa bacteroids formed by Rm1021 (7, 22, 36). On the basis of nodule plant gene expression data and metabolite analysis of Lotus japonicus root nodules, Colebatch et al. (19) recently suggested that root nodules experience P limitation and that this could result from preferred acquisition of available P by bacteroids. Analysis of P metabolism in Rhizobium tropici and bean nodules suggested that the bacteroids are Pi limited (2). The expression of orfA-pit and not pstSCAB or phoCDET in RCR2011 bacteroids (Fig. 5 and 6) clearly suggests that metabolism in alfalfa bacteroids is not limited by Pi under the plant growth conditions employed in our experiments. However, it is possible that bacteroid metabolism and the high density of bacteroids in nodules are a considerable Pi sink and could lead to P stress conditions in the alfalfa plant cytoplasm. It would be interesting to determine whether manipulation of the amount of Pi available to the plant (38, 66) can alter the pattern of expression of the Pi transporters in bacteroids within the alfalfa nodule.


arrow
ACKNOWLEDGMENTS
 
This work was primarily supported by grants from the Natural Sciences and Engineering Council of Canada to T.M.F. R.Z. was also supported by funding from Genome Canada through the Ontario Genomics Institute and by funding from the Ontario Research and Development Challenge Fund to T.M.F.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Center for Environmental Genomics, Department of Biology, McMaster University, Hamilton, Ontario, Canada L8S 4K1. Phone: (905) 525-9140, ext. 22932. Fax: (905) 522-6066. E-mail: finan{at}mcmaster.ca. Back


arrow
REFERENCES
 
    1
  1. Aguena, M., E. Yagil, and B. Spira. 2002. Transcriptional analysis of the pst operon of Escherichia coli. Mol. Genet. Genomics 268:518-524.[CrossRef][Medline]
  2. 2
  3. Al-Niemi, T. S., M. L. Kahn, and T. R. McDermott. 1997. P Metabolism in the bean-Rhizobium tropici symbiosis. Plant Physiol. 113:1233-1242.[Abstract]
  4. 3
  5. Auesukaree, C., T. Homma, H. Tochio, M. Shirakawa, Y. Kaneko, and S. Harashima. 2004. Intracellular phosphate serves as a signal for the regulation of the PHO pathway in Saccharomyces cerevisiae J. Biol. Chem. 279:17289-17294.[Abstract/Free Full Text]
  6. 4
  7. Bardin, S. D., S. Dan, M. Osteras, and T. M. Finan. 1996. A phosphate transport system is required for symbiotic nitrogen fixation by Rhizobium meliloti. J. Bacteriol. 178:4540-4547.[Abstract/Free Full Text]
  8. 5
  9. Bardin, S. D., and T. M. Finan. 1998. Regulation of phosphate assimilation in Rhizobium (Sinorhizobium) meliloti. Genetics 148:1689-1700.[Abstract/Free Full Text]
  10. 6
  11. Bardin, S. D., R. T. Voegele, and T. M. Finan. 1998. Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene. J. Bacteriol. 180:4219-4226.[Abstract/Free Full Text]
  12. 7
  13. Barnett, M. J., C. J. Toman, R. F. Fisher, and S. R. Long. 2004. A dual-genome symbiosis chip for coordinate study of signal exchange and development in a prokaryote-host interaction. Proc. Natl. Acad. Sci. USA 101:16636-16641.[Abstract/Free Full Text]
  14. 8
  15. Beck, D. P., and D. N. Munns. 1984. Phosphate nutrition of Rhizobium spp. Appl. Environ. Microbiol. 47:278-282.[Abstract/Free Full Text]
  16. 9
  17. Becker, A., M. Schmidt, W. Jager, and A. Puhler. 1995. New gentamicin-resistance and lacZ promoter-probe cassettes suitable for insertion mutagenesis and generation of transcriptional fusions. Gene 162:37-39.[CrossRef][Medline]
  18. 10
  19. Bieleske, R. L. 1973. Phosphate pools, phosphate transport and phosphate availability. Annu. Rev. Plant Physiol. 24:225-252.
  20. 11
  21. Blanco, A. G., M. Sola, F. X. Gomis-Ruth, and M. Coll. 2002. Tandem DNA recognition by PhoB, a two-component signal transduction transcriptional activator. Structure 10:701-713.[Medline]
  22. 12
  23. Boivin, C., S. Camut, C. A. Malpica, G. Truchet, and C. Rosenberg. 1990. Rhizobium meliloti genes encoding catabolism of trigonelline are induced under symbiotic conditions. Plant Cell 2:1157-1170.[Abstract/Free Full Text]
  24. 13
  25. Braibant, M., P. Lefevre, L. de Wit, P. Peirs, J. Ooms, K. Huygen, A. B. Andersen, and J. Content. 1996. A Mycobacterium tuberculosis gene cluster encoding proteins of a phosphate transporter homologous to the Escherichia coli Pst system. Gene 176:171-176.[CrossRef][Medline]
  26. 14
  27. Capela, D., F. Barloy-Hubler, J. Gouzy, G. Bothe, F. Ampe, J. Batut, P. Boistard, A. Becker, M. Boutry, E. Cadieu, S. Dreano, S. Gloux, T. Godrie, A. Goffeau, D. Kahn, E. Kiss, V. Lelaure, D. Masuy, T. Pohl, D. Portetelle, A. Puhler, B. Purnelle, U. Ramsperger, C. Renard, P. Thebault, M. Vandenbol, S. Weidner, and F. Galibert. 2001. Analysis of the chromosome sequence of the legume symbiont Sinorhizobium meliloti strain 1021. Proc. Natl. Acad. Sci. USA 98:9877-9882.[Abstract/Free Full Text]
  28. 15
  29. Chan, F. Y., and A. Torriani. 1996. PstB protein of the phosphate-specific transport system of E. coli is an ATPase. J. Bacteriol. 178:3974-3977.[Abstract/Free Full Text]
  30. 16
  31. Charles, T. C., W. Newcomb, and T. M. Finan. 1991. ndvF, a novel locus located on megaplasmid pRmeSU47b (pEXO) of Rhizobium meliloti is required for normal nodule development. J. Bacteriol. 173:3981-3992.[Abstract/Free Full Text]
  32. 17
  33. Charles, T. C., and T. M. Finan. 1991. Analysis of a 1600-kilobase Rhizobium meliloti megaplasmid using defined deletions generated in vivo. Genetics 127:5-20.[Abstract]
  34. 18
  35. Charles, T. C., and T. M. Finan. 1990. Genetic map of Rhizobium meliloti pRmSU47b. J. Bacteriol. 172:2469-2476.[Abstract/Free Full Text]
  36. 19
  37. Colebatch, G., G. Desbrosses, T. Ott, L. Krusell, O. Montanari, S. Kloska, J. Kopka, and M. K. Udvardi. 2004. Global changes in transcription orchestrate metabolic differentiation during symbiotic nitrogen fixation in Lotus japonicus. Plant J. 39:487-512.[CrossRef][Medline]
  38. 20
  39. Cox, G. B., D. Webb, and H. Rosenberg. 1989. Specific amino acid residues in both the PstB and PstC proteins are required for phosphate transport by the Escherichia coli Pst system. J. Bacteriol. 171:1531-1534.[Abstract/Free Full Text]
  40. 21
  41. Danhorn, T., M. Hentzer, M. Givskov, M. R. Parsek, and C. Fuqua. 2004. Phosphorus limitation enhances biofilm formation of the plant pathogen Agrobacterium tumefaciens through the PhoR-PhoB regulatory system. J. Bacteriol. 186:4492-4501.[Abstract/Free Full Text]
  42. 22
  43. Djordjevic, M. A., H. C. Chen, S. Natera, G. Van Noorden, C. Menzel, S. Taylor, C. Renard, O. Geiger, G. F. Weiller. Sinorhizobium DNA Sequencing Consortium. 2003. A global analysis of protein expression profiles in Sinorhizobium meliloti: discovery of new genes for nodule occupancy and stress adaptation. Mol. Plant-Microbe Interact. 16:508-524.[Medline]
  44. 23
  45. Ellison, D. W., and W. R. McCleary. 2000. The unphosphorylated receiver domain of PhoB silences the activity of its output domain. J. Bacteriol. 182:6592-6597.[Abstract/Free Full Text]
  46. 24
  47. Finan, T. M., B. Kunkel., G. F. De Vos, and E. R. Signer. 1986. Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes. J. Bacteriol. 167:66-72.[Abstract/Free Full Text]
  48. 25
  49. Finan, T. M., E. Hartweig, K. LeMieux, K. Bergman, G. C. Walker, and E. R. Signer. 1984. General transduction in Rhizobium meliloti. J. Bacteriol. 159:120-124.[Abstract/Free Full Text]
  50. 26
  51. Galibert, F., T. M. Finan, S. R. Long, A. Puhler, P. Abola, F. Ampe, F. Barloy-Hubler, M. J. Barnett, A. Becker, P. Boistard, G. Bothe, M. Boutry, L. Bowser, J. Buhrmester, E. Cadieu, D. Capela, P. Chain, A. Cowie, R. W. Davis, S. Dreano, N. A. Federspiel, R. F. Fisher, S. Gloux, T. Godrie, A. Goffeau, B. Golding, J. Gouzy, M. Gurjal, I. Hernandez-Lucas, A. Hong, L. Huizar, R. W. Hyman, T. Jones, D. Kahn, M. L. Kahn, S. Kalman, D. H. Keating, E. Kiss, C. Komp, V. Lelaure, D. Masuy, C. Palm, M. C. Peck, T. M. Pohl, D. Portetelle, B. Purnelle, U. Ramsperger, R. Surzycki, P. Thebault, M. Vandenbol, F. J. Vorholter, S. Weidner, D. H. Wells, K. Wong, K. C. Yeh, and J. Batut. 2001. The composite genome of the legume symbiont Sinorhizobium meliloti. Science 293:668-672.[Abstract/Free Full Text]
  52. 27
  53. Gao, J. L., B. Weissenmayer, A. M. Taylor, J. Thomas-Oates, I. M. Lopez-Lara, and O. Geiger. 2004. Identification of a gene required for the formation of lyso-ornithine lipid, an intermediate in the biosynthesis of ornithine-containing lipids. Mol. Microbiol. 53:1757-1770.[CrossRef][Medline]
  54. 28
  55. Garner, M. M., and A. Revzin. 1981. A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: application to components of the Escherichia coli lactose operon regulatory system. Nucleic Acids Res. 9:3047-3060.[Abstract/Free Full Text]
  56. 29
  57. Geiger, O., V. Rohrs, B. Weissenmayer, T. M. Finan, and J. E. Thomas-Oates. 1999. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32:63-73.[CrossRef][Medline]
  58. 30
  59. Glazebrook, J., and G. C. Walker. 1989. A novel exopolysaccharide can function in place of the calcofluor-binding exopolysaccharide in nodulation of alfalfa by Rhizobium meliloti. Cell 56:661-672.[CrossRef][Medline]
  60. 31
  61. Gonin, M., E. M. Quardokus, D. O'Donnol, J. Maddock, and Y. V. Brun. 2000. Regulation of stalk elongation by phosphate in Caulobacter crescentus. J. Bacteriol. 182:337-347.[Abstract/Free Full Text]
  62. 32
  63. Harris, R. M., D. C. Webb, S. M. Howitt, and G. B. Cox. 2001. Characterization of PitA and PitB from Escherichia coli. J. Bacteriol. 183:5008-5014.[Abstract/Free Full Text]
  64. 33
  65. Jiang, W., W. W. Metcalf, K. S. Lee, and B. L. Wanner. 1995. Molecular cloning, mapping, and regulation of Pho regulon genes for phosphonate breakdown by the phosphonatase pathway of Salmonella typhimurium LT2. J. Bacteriol. 177:6411-6421.[Abstract/Free Full Text]
  66. 34
  67. Katzen, F., A. Becker, M. V. Ielmini, C. G. Oddo, and L. Ielpi. 1999. New mobilizable vectors suitable for gene replacement in gram-negative bacteria and their use in mapping of the 3' end of the Xanthomonas campestris pv. campestris gum operon. Appl. Environ. Microbiol. 65:278-282.[Abstract/Free Full Text]
  68. 35
  69. Kimura, S., K. Makino, H. Shinagawa, M. Amemura, and A. Nakata. 1989. Regulation of the phosphate regulon of Escherichia coli: characterization of the promoter of the pstS gene. Mol. Gen. Genet. 215:374-380.[CrossRef][Medline]
  70. 36
  71. Krol, E., and A. Becker. 2004. Global transcriptional analysis of the phosphate starvation response in Sinorhizobium meliloti strains 1021 and 2011. Mol. Genet. Genomics 272:1-17.[CrossRef][Medline]
  72. 37
  73. Levitz, R., A. Klar, N. Sar, and E. Yagil. 1984. A new locus in the phosphate specific transport (PST) region of Escherichia coli. Mol. Gen. Genet. 197:98-103.[CrossRef][Medline]
  74. 38
  75. Liu, H., A. T. Trieu, L. A. Blaylock, and M. J. Harrison. 1998. Cloning and characterization of two phosphate transporters from Medicago truncatula roots: regulation in response to phosphate and to colonization by arbuscular mycorrhizal (AM) fungi. Mol. Plant-Microbe Interact. 11:14-22.[Medline]
  76. 39
  77. MacLellan, S. R., L. A. Smallbone, C. D. Sibley, and T. M. Finan. 2005. The expression of a novel antisense gene mediates incompatibility within the large repABC family of alpha-proteobacterial plasmids. Mol. Microbiol. 55:611-623.[CrossRef][Medline]
  78. 40
  79. Makino, K., M. Amemura, T. Kawamoto, S. Kimura, H. Shinagawa, A. Nakata, and M. Suzuki. 1996. DNA binding of PhoB and its interaction with RNA polymerase. J. Mol. Biol. 259:15-26.[CrossRef][Medline]
  80. 41
  81. Makino, K., M. Amemura, S. K. Kim, A. Nakata, and H. Shinagawa. 1993. Role of the sigma 70 subunit of RNA polymerase in transcriptional activation by activator protein PhoB in Escherichia coli. Genes Dev. 7:149-160.[Abstract/Free Full Text]
  82. 42
  83. Makino, K., H. Shinagawa, M. Amemura, T. Kawamoto, M. Yamada, and A. Nakata. 1989. Signal transduction in the phosphate regulon of Escherichia coli involves phosphotransfer between PhoR and PhoB proteins. J. Mol. Biol. 210:551-559.[CrossRef][Medline]
  84. 43
  85. Meade, H. M., S. R. Long, G. B. Ruvkun, S. E. Brown, and F. M. Ausubel. 1982. Physical and genetic characterization of symbiotic and auxotrophic mutants of Rhizobium meliloti induced by transposon Tn5 mutagenesis. J. Bacteriol. 149:114-122.[Abstract/Free Full Text]
  86. 44
  87. Metcalf, W. W., and B. L. Wanner. 1991. Involvement of the Escherichia coli phn (psiD) gene cluster in assimilation of phosphorus in the form of phosphonates, phosphite, Pi esters, and Pi. J. Bacteriol. 173:587-600.[Abstract/Free Full Text]
  88. 45
  89. Nikata, T., Y. Sakai, K. Shibat, J. Kato, A. Kuroda, and H. Ohtake. 1996. Molecular analysis of the phosphate-specific transport (pst) operon of Pseudomonas aeruginosa. Mol. Gen. Genet. 250:692-698.[Medline]
  90. 46
  91. Novak, R., A. Cauwels, E. Charpentier, and E. Tuomanen. 1999. Identification of a Streptococcus pneumoniae gene locus encoding proteins of an ABC phosphate transporter and a two-component regulatory system. J. Bacteriol. 181:1126-1133.[Abstract/Free Full Text]
  92. 47
  93. Okamura, H., S. Hanaoka, A. Nagadoi, K. Makino, and Y. Nishimura. 2000. Structural comparison of the PhoB and OmpR DNA-binding/transactivation domains and the arrangement of PhoB molecules on the phosphate box. J. Mol. Biol. 295:1225-1236.[CrossRef][Medline]
  94. 48
  95. Oresnik, I. J., T. C. Charles, and T. M. Finan. 1994. Second site mutations specifically suppress the Fix phenotype of Rhizobium meliloti ndvF mutations on alfalfa: identification of a conditional ndvF-dependent mucoid colony phenotype. Genetics 136:1233-1243.[Abstract]
  96. 49
  97. Osteras, M., B. T. Driscoll, and T. M. Finan. 1997. Increased pyruvate orthophosphate dikinase activity results in an alternative gluconeogenic pathway in Rhizobium (Sinorhizobium) meliloti. Microbiology 143:1639-1648.[Abstract/Free Full Text]
  98. 50
  99. Paulsen, I. T., R. Seshadri, K. E. Nelson, J. A. Eisen, J. F. Heidelberg, T. D. Read, R. J. Dodson, L. Umayam, L. M. Brinkac, M. J. Beanan, S. C. Daugherty, R. T. Deboy, A. S. Durkin, J. F. Kolonay, R. Madupu, W. C. Nelson, B. Ayodeji, M. Kraul, J. Shetty, J. Malek, S. E. Van Aken, S. Riedmuller, H. Tettelin, S. R. Gill, O. White, S. L. Salzberg, D. L. Hoover, L. E. Lindler, S. M. Halling, S. M. Boyle, and C. M. Fraser. 2002. The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. Proc. Natl. Acad. Sci. USA 99:13148-13153.[Abstract/Free Full Text]
  100. 51
  101. Prell, J., B. Boesten, P. Poole, and U. B. Priefer. 2002. The Rhizobium leguminosarum bv. viciae VF39 {gamma}-aminobutyrate (GABA) aminotransferase gene (gabT) is induced by GABA and highly expressed in bacteroids. Microbiology 148:615-623.[Abstract/Free Full Text]
  102. 52
  103. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313.[CrossRef][Medline]
  104. 53
  105. Qi, Y., Y. Kobayashi, and F. M. Hulett. 1997. The pst operon of Bacillus subtilis has a phosphate-regulated promoter and is involved in phosphate transport but not in regulation of the pho regulon. J. Bacteriol. 179:2534-2539.[Abstract/Free Full Text]
  106. 54
  107. Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127:15-21.[CrossRef][Medline]
  108. 55
  109. Rao, N. N., and A. Torriani. 1990. Molecular aspects of phosphate transport in Escherichia coli. Mol. Microbiol. 4:1083-1090.[Medline]
  110. 56
  111. Reeve, W. G., R. P. Tiwari, C. M. Wong, M. J. Dilworth, and A. R. Glenn. 1998. The transcriptional regulator gene phrR in Sinorhizobium meliloti WSM419 is regulated by low pH and other stresses. Microbiology 144:3335-3342.[Abstract/Free Full Text]
  112. 57
  113. Riess, G., B. W. Holloway, and A. Puhler. 1980. R68.45, a plasmid with chromosome mobilizing ability (Cma) carries a tandem duplication. Genet. Res. 36:99-109.[Medline]
  114. 58
  115. Rosenberg, H., R. G. Gerdes, and K. Chegwidden. 1977. Two systems for the uptake of phosphate in Escherichia coli. J. Bacteriol. 131:505-511.[Abstract/Free Full Text]
  116. 59
  117. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  118. 60
  119. Schmitz, A., and Galas, D. J. 1979. The interaction of RNA polymerase and lac repressor with the lac control region. Nucleic Acids Res. 6:111-137.[Abstract/Free Full Text]
  120. 61
  121. Summers, M. L., L. M. Botero, S. C. Busse, and T. R. McDermott. 2000. The Sinorhizobium meliloti Lon protease is involved in regulating exopolysaccharide synthesis and is required for nodulation of alfalfa. J. Bacteriol. 182:2551-2558.[Abstract/Free Full Text]
  122. 62
  123. Summers, M. L., M. C. Denton, and T. R. McDermott. 1999. Genes coding for phosphotransacetylase and acetate kinase in Sinorhizobium meliloti are in an operon that is inducible by phosphate stress and controlled by phoB. J. Bacteriol. 181:2217-2224.[Abstract/Free Full Text]
  124. 63
  125. Summers, M. L., J. G. Elkins, B. A. Elliott, and T. R. McDermott. 1998. Expression and regulation of phosphate stress inducible genes in Sinorhizobium meliloti. Mol. Plant Microbe Interact. 11:1094-1101.[Medline]
  126. 64
  127. Surin, B. P., D. A. Jans, A. L. Fimmel, D. S. Shaw, G. B. Cox, and H. Rosenberg. 1984. Structural gene for the phosphate-repressible phosphate-binding protein of Escherichia coli has its own promoter: complete nucleotide sequence of the phoS gene. J. Bacteriol. 157:772-778.[Abstract/Free Full Text]
  128. 65
  129. Torriani, A. 1990. From cell membrane to nucleotides: the phosphate regulon in Escherichia coli. Bioessays 12:371-376.[CrossRef][Medline]
  130. 66
  131. Uhde-Stone, C., K. E. Zinn, M. Ramirez-Yanez, A. Li, C. P. Vance, and D. L. Allan. 2003. Nylon filter arrays reveal differential gene expression in proteoid roots of white lupin in response to phosphorus deficiency. Plant Physiol. 131:1064-1079.[Abstract/Free Full Text]
  132. 67
  133. VanBogelen, R. A., E. R. Olson, B. L. Wanner, and F. C. Neidhardt. 1996. Global analysis of proteins synthesized during phosphorus restriction in Escherichia coli. J. Bacteriol. 1784344-4366.[Abstract/Free Full Text]
  134. 68
  135. Vincent, J. M. 1941. Serological properties of the root-nodule bacteria. I. Strains of Rhizobium meliloti. Proc. Linn. Soc. N. S. W. 66:145-154.
  136. 69
  137. Voegele, R. T., S. Bardin, and T. M. Finan. 1997. Characterization of the Rhizobium (Sinorhizobium) meliloti high- and low-affinity phosphate uptake systems. J. Bacteriol. 179:7226-7232.[Abstract/Free Full Text]
  138. 70
  139. Walthers, D., V. K. Tran, and L. J. Kenney. 2003. Interdomain linkers of homologous response regulators determine their mechanism of action. J. Bacteriol. 185:317-324.[Abstract/Free Full Text]
  140. 71
  141. Wanner, B. L. 1993. Gene regulation by phosphate in enteric bacteria. J. Cell Biochem. 51:47-54.[CrossRef][Medline]
  142. 72
  143. Watson, R. J., R. Heys, T. Martin, and M. Savard. 2001. Sinorhizobium meliloti cells require biotin and either cobalt or methionine for growth. Appl. Environ. Microbiol. 67:3767-3770.[Abstract/Free Full Text]
  144. 73
  145. Webb, D. C., H. Rosenberg, and G. B. Cox. 1992. Mutational analysis of the Escherichia coli phosphate-specific transport system, a member of the traffic ATPase (or ABC) family of membrane transporters. A role for proline residues in transmembrane helices. J. Biol. Chem. 267:24661-24668.[Abstract/Free Full Text]
  146. 74
  147. Willsky, G. R., and M. H. Malamy. 1980. Characterization of two genetically separable inorganic phosphate transport systems in Escherichia coli. J. Bacteriol. 144:356-365.[Abstract/Free Full Text]
  148. 75
  149. Wood, D. W., J. C. Setubal, R. Kaul, D. E. Monks, J. P. Kitajima, V. K. Okura, Y. Zhou, L. Chen, G. E. Wood, N. F. Almeida, Jr., L. Woo, Y. Chen, I. T. Paulsen, J. A. Eisen, P. D. Karp, D. Bovee, Sr., P. Chapman, J. Clendenning, G. Deatherage, W. Gillet, C. Grant, T. Kutyavin, R. Levy, M. J. Li, E. McClelland, A. Palmieri, C. Raymond, G. Rouse, C. Saenphimmachak, Z. Wu, P. Romero, D. Gordon, S. Zhang, H. Yoo, Y. Tao, P. Biddle, M. Jung, W. Krespan, M. Perry, B. Gordon-Kamm, L. Liao, S. Kim, C. Hendrick, Z. Y. Zhao, M. Dolan, F. Chumley, S. V. Tingey, J. F. Tomb, M. P. Gordon, M. V. Olson, and E. W. Nester. 2001. The genome of the natural genetic engineer Agrobacterium tumefaciens C58. Science 294:2317-2323.[Abstract/Free Full Text]
  150. 76
  151. Wykoff, D. D., and E. K. O'Shea. 2001. Phosphate transport and sensing in Saccharomyces cerevisiae Genetics 159:1491-1499.[Abstract/Free Full Text]
  152. 77
  153. Yuan, Z. C., R. Zaheer, and T. M. Finan. 2005. PhoB-dependent regulation of catalase expression in Sinorhizobium meliloti, Pseudomonas aeruginosa and Agrobacterium tumefaciences. Mol. Microbiol. 58:877-894.[CrossRef][Medline]


Journal of Bacteriology, February 2006, p. 1089-1102, Vol. 188, No. 3
0021-9193/06/$08.00+0     doi:10.1128/JB.188.3.1089-1102.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Saborido Basconcillo, L., Zaheer, R., Finan, T. M., McCarry, B. E. (2009). Cyclopropane fatty acyl synthase in Sinorhizobium meliloti. Microbiology 155: 373-385 [Abstract] [Full Text]  
  • Santos-Beneit, F., Rodriguez-Garcia, A., Franco-Dominguez, E., Martin, J. F. (2008). Phosphate-dependent regulation of the low- and high-affinity transport systems in the model actinomycete Streptomyces coelicolor. Microbiology 154: 2356-2370 [Abstract] [Full Text]  
  • Bahlawane, C., Baumgarth, B., Serrania, J., Ruberg, S., Becker, A. (2008). Fine-Tuning of Galactoglucan Biosynthesis in Sinorhizobium meliloti by Differential WggR (ExpG)-, PhoB-, and MucR-Dependent Regulation of Two Promoters. J. Bacteriol. 190: 3456-3466 [Abstract] [Full Text]  
  • Reid, A. N., Pandey, R., Palyada, K., Whitworth, L., Doukhanine, E., Stintzi, A. (2008). Identification of Campylobacter jejuni Genes Contributing to Acid Adaptation by Transcriptional Profiling and Genome-Wide Mutagenesis. Appl. Environ. Microbiol. 74: 1598-1612 [Abstract] [Full Text]  
  • MacLean, A. M., Anstey, M. I., Finan, T. M. (2008). Binding Site Determinants for the LysR-Type Transcriptional Regulator PcaQ in the Legume Endosymbiont Sinorhizobium meliloti. J. Bacteriol. 190: 1237-1246 [Abstract] [Full Text]  
  • Gebhard, S., Cook, G. M. (2008). Differential Regulation of High-Affinity Phosphate Transport Systems of Mycobacterium smegmatis: Identification of PhnF, a Repressor of the phnDCE Operon. J. Bacteriol. 190: 1335-1343 [Abstract] [Full Text]  
  • Suzuki, S., Aono, T., Lee, K.-B., Suzuki, T., Liu, C.-T., Miwa, H., Wakao, S., Iki, T., Oyaizu, H. (2007). Rhizobial Factors Required for Stem Nodule Maturation and Maintenance in Sesbania rostrata-Azorhizobium caulinodans ORS571 Symbiosis. Appl. Environ. Microbiol. 73: 6650-6659 [Abstract] [Full Text]  
  • Yuan, Z.-C., Edlind, M. P., Liu, P., Saenkham, P., Banta, L. M., Wise, A. A., Ronzone, E., Binns, A. N., Kerr, K., Nester, E. W. (2007). The plant signal salicylic acid shuts down expression of the vir regulon and activates quormone-quenching genes in Agrobacterium. Proc. Natl. Acad. Sci. USA 104: 11790-11795 [Abstract] [Full Text]  
  • Cheng, J., Sibley, C. D., Zaheer, R., Finan, T. M. (2007). A Sinorhizobium meliloti minE mutant has an altered morphology and exhibits defects in legume symbiosis. Microbiology 153: 375-387 [Abstract] [Full Text]  
  • Gebhard, S., Tran, S. L., Cook, G. M. (2006). The Phn system of Mycobacterium smegmatis: a second high-affinity ABC-transporter for phosphate.. Microbiology 152: 3453-3465 [Abstract] [Full Text]  
  • Yuan, Z.-C., Zaheer, R., Morton, R., Finan, T. M. (2006). Genome prediction of PhoB regulated promoters in Sinorhizobium meliloti and twelve proteobacteria.. Nucleic Acids Res 34: 2686-2697 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, Z.-C.
Right arrow Articles by Finan, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, Z.-C.
Right arrow Articles by Finan, T. M.