Departamento de Microbiología, Facultad de Biología, Universidad de Barcelona, Diagonal 645, 08071 Barcelona, Spain,1 Division of Molecular and Genetic Medicine, University of Sheffield Medical School, Sheffield S10 2RX, United Kingdom2
Received 25 July 2005/ Accepted 21 October 2005
| ABSTRACT |
|---|
|
|
|---|
54 (rpoN); mutation of this factor suggested that it is involved in expression of both types of flagella. | INTRODUCTION |
|---|
|
|
|---|
Mesophilic Aeromonas strains usually have a single polar unsheathed flagellum in all culture conditions, but it is known that 50% to 60% of the mesophilic aeromonads most commonly associated with diarrhea (18) also have many unsheathed peritrichous lateral flagella when they are grown in viscous environments or on surfaces (38). Different workers have shown that lateral flagella increase bacterial adherence and are required for swarming motility and biofilm formation (10, 19).
The expression of two distinct flagellar systems is relatively uncommon, although it has been observed in Vibrio parahaemolyticus (19), Azospirillum brasilense (26), Rhodospirillum centenum (15), Helicobacter mustelae (29), and Plesiomonas shigelloides (13). V. parahaemolyticus is the best-studied organism, and it has two distinct flagellar systems. Recently, an Escherichia coli O42 lateral flagellar gene cluster (Flag-2) has been described (33), and the presence of Flag-2-like gene clusters in Yersinia pestis, Yersinia pseudotuberculosis, and Chromobacterium violaceum suggests that the coexistence of two flagellar systems in the same species is more common than previously suspected (33). The polar flagellum (Fla) of V. parahaemolyticus requires around 60 genes distributed in five clusters on chromosome I for biogenesis and assembly (41), whereas lateral flagella (Laf) are coded for by 38 different genes distributed in two clusters on chromosome II (39). We have previously described lateral flagellar regions containing 9 genes in A. hydrophila and 10 genes in A. caviae (10). These regions encode one flagellin (LafA) in A. hydrophila and two flagellins (LafA1 and LafA2) in A. caviae, a HAP-2 protein (LafB), a protein with an unknown function (LafX), a flagellin chaperone (LafC), some regulatory proteins (LafE, LafF, and LafS), and the motor proteins (LafT and LafU). Characterization of mutants and nucleotide and N-terminal sequencing demonstrated that the lateral flagellins were distinct from their polar flagellin counterparts (10, 32). Mutations of the lateral flagellar genes, such as lafB, lafS, or lafA, did not affect polar flagellum synthesis and vice versa.
Little is known about the organization and expression of lateral flagella in mesophilic Aeromonas strains. Some genes have been described previously, but many others are required for the expression of flagella. In this work we employed transposon mutagenesis and complementation of homologous mutants to isolate the A. hydrophila AH-3 chromosomal regions involved in expression of lateral flagella. Furthermore, we investigated the distribution of the genes in the mesophilic Aeromonas species, characterized several Aeromonas strains with defined mutations in different lateral flagellar genes, and studied the motility of these strains, the presence of both types of flagella, the adherence to HEp-2 cells, and the ability to form biofilms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
TEM. For transmission electron microscopy (TEM) bacterial suspensions were placed on Formvar-coated grids and negative stained with a 2% solution of uranyl acetate (pH 4.1). The preparations were observed with a Hitachi 600 transmission electron microscope.
Mini-Tn5Km-1 mutagenesis.
Conjugal transfer of transposition element mini-Tn5Km-1 from E. coli S17-1
pirKm-1 (8) to A. hydrophila AH-405 (rifampin-resistant AH-3) was carried out in a conjugal drop incubated for 6 h at 30°C with a ratio of S17-1
pirKm-1 to AH-405 to HB101(pRK2073) (helper plasmid) of 1:5:1. Serial dilutions of the mating mixture were plated on TSA supplemented with rifampin and kanamycin in order to select mutants.
DNA techniques. DNA manipulations were carried out essentially as described previously (35). DNA restriction endonucleases, T4 DNA ligase, the E. coli DNA polymerase Klenow fragment, and alkaline phosphatase were used as recommended by the suppliers. PCR was performed using Taq DNA polymerase (Invitrogen) with a Perkin-Elmer Gene Amplifier PCR System 2400 thermal cycler. Amplification of 4,000 bp was performed using High Fidelity Platinum Taq DNA polymerase (Invitrogen) as recommended by the supplier. Colony hybridization was carried out by colony transfer onto positive nylon membranes (Roche), and then preparations were lysed according to the manufacturer's instructions. Probe labeling with digoxigenin, hybridization, and detection (Amersham) were carried out as recommended by the suppliers.
Cloning of DNA flanking mini-Tn5Km-1 insertions. Chromosomal DNA of mini-Tn5Km-1 mutants was digested with EcoRI, PstI and EcoRV, purified, ligated into the vector pBCSK (Stratagene), and introduced into E. coli XL1-Blue. Recombinant plasmids containing the transposon with flanking insertions were selected in LB agar plates supplemented with kanamycin and chloramphenicol. The mini-Tn5Km-1 flanking sequences were obtained by using specific primers for the I and O ends of mini-Tn5Km-1 (5'-AGATCTGATCAAGAGACAG-3' and 5'-ACTTGTGTATAAGAGTCAG-3', respectively), as well as primers M13for and T3.
Nucleotide sequencing and computer sequence analysis. Plasmid DNA for sequencing was isolated by using a QIAGEN plasmid purification kit (QIAGEN, Inc. Ltd.) as recommended by the supplier. In some cases, inverse PCR was used to amplify a chromosomal DNA fragment that was not present in the A. hydrophila library for sequencing. Briefly, 2 µg of A. hydrophila AH-3 chromosomal DNA was digested with appropriate restriction endonucleases, cleaned, and subjected to overnight ligation. The ligation reaction mixture was phenol and chloroform extracted and resuspended in water, and 100 to 200 ng of ligated DNA was then subjected to inverse PCR with specific primers. PCR products were visualized in an agarose gel, and amplified fragments were recovered for DNA sequencing. Double-stranded DNA sequencing was performed by using the Sanger dideoxy chain termination method (36) with an ABI Prism dye terminator cycle sequencing kit (Perkin-Elmer). Custom-designed primers used for DNA sequencing were purchased from Amersham Biosciences.
The DNA sequence was translated in all six frames, and all open reading frames (ORFs) that were more than 100 bp long were inspected. Deduced amino acid sequences were compared with sequences in the GenBank, EMBL, and Swiss-Prot databases by using the BLASTX, BLASTP, or PSI-BLAST network service at the National Center for Biotechnology Information (3). A protein family profile was determined using the Pfam Protein Family Database at the Sanger Center (5). Possible terminator sequences were determined by using the Terminator program from the Genetics Computer Group package (Genetics Computer Group, Madison, Wis.). Other online sequence analysis services were also used.
RT-PCR. Total RNA was isolated from A. hydrophila AH-3 grown in solid agar (TSA) by using the Trizol reagent (Invitrogen). To ensure that RNA was devoid of contaminating DNA, the preparation was treated with RNase-free DNase I (amplification grade; Invitrogen). The isolated RNA was used as a template in reverse transcription PCRs (RT-PCRs), utilizing the Thermoscript RT-PCR system (Invitrogen) according to the manufacturer's instructions. A PCR without reverse transcriptase was also performed to confirm the absence of contaminating DNA in the RNA samples. RT-PCR amplifications were performed at least twice with total-RNA preparations obtained from a minimum of two independent extractions. The RT-PCR and PCR products were analyzed by agarose gel electrophoresis.
Construction of defined insertion mutants.
To obtain single defined insertion mutants with mutations in the flhAL, fliJL, flgNL, maf-5, and rpoN genes, we used a method based on suicide plasmid pFS100 (34). Briefly, an internal fragment of the selected gene was amplified by PCR, ligated into pGEM-T Easy (Promega), and transformed into E. coli XL1-Blue. The DNA insert was recovered by EcoRI restriction digestion and was ligated into EcoRI-digested and phosphatase-treated pFS100. The ligation preparation was transformed into E. coli MC1061 (
pir) with selection for kanamycin resistance (Kmr). Triparental mating with the mobilizing strain HB101/pRK2073 was used to transfer the recombinant plasmid into A. hydrophila AH-405 rifampin-resistant (Rifr) strains to obtain defined insertion mutants, with selection for Rifr and Kmr.
To obtain mutants with mutations in lafK and flgEL, the genes were amplified by PCR, ligated into the vector pGEM-T Easy (Promega), and transformed into E. coli XL1-Blue. The Tn5-derived kanamycin resistance cartridge (nptll) from pUC4-KIXX was inserted into each of the genes. This cartridge contains an outward-reading promoter that ensures expression of downstream genes when it is inserted in the correct orientation (6); however, such an insertion alters the regulation of the genes. The SmaI-digested cassette was inserted into a restriction site internal to each gene, and the presence of a single HindIII site in the SmaI-digested cassette allowed its orientation to be determined. Constructs containing the mutated genes were ligated to suicide vector pDM4 (25) and electroporated into E. coli MC1061 (
pir), which was plated on chloramphenicol plates at 30°C. Plasmids with mutated genes were transferred into rifampin-resistant A. hydrophila AH-405 by triparental mating using E. coli MC1061 (
pir) containing the insertion constructs and the mobilizing strain HB101/pRK2073. Transconjugants were selected on plates containing chloramphenicol, kanamycin, and rifampin. PCR analysis confirmed that the vector had integrated correctly into the chromosomal DNA. To complete the allelic exchange, the integrated suicide plasmid was forced to recombine out of the chromosome by adding 5% sucrose to the agar plates. The pDM4 vector contains sacB, which produces an enzyme that converts sucrose into a product that is toxic to gram-negative bacteria. Transconjugants surviving on plates with 5% sucrose that were rifampin resistant, kanamycin resistant (Kmr), and chloramphenicol sensitive (Cms) were chosen and confirmed by PCR.
Plasmid construction.
For complementation studies A. hydrophila AH-3 DNA fragments with fliML-flhAL and lafK-flgAL clusters were PCR amplified using primers FLIMF1 (5'-GCTCTAGATGCAACAGAGAGCAAACCG-3') and VIRG (5'-GCTCTAGAGATTGGGAATGGATTGG-3') and primers FHIA (5'-GCTCTAGAAGTTATTGGGACACTGGG-3') and LFGNF1 (5'-GCTCTAGAGCTGCGGGTCAAGCAAC-3'), respectively. Amplified fragments that were 7,584 bp and 7,822 bp long, respectively, were XbaI digested, blunt ended with Klenow DNA polymerase (the XbaI sites are underlined in the primers), and ligated into pLA2917 (1). The wild-type DNA fragment with the flgB to flgLL cluster and the maf-5 gene were amplified using primers LFGBF (5'-GAAGATCTGTGCATTCAGCCAGATAG-3') and LFGLR (5'-GAAGATCTGATCCAGCCTTGAAACCAC-3') and primers LFGFIN (5'-GAAGATCTCTTAAACGTCTGGAGCAGC-3') and LAFAB (5'-GAAGATCTGGAGAAAATTGAGCCGGAG-3'), respectively. Amplified fragments of 9,724 bp and 3,212 bp, respectively, were BglII digested (BglII sites are underlined on the primers) ligated separately into pLA2917 (1). Attempts to introduce the lateral flagellar plasmids into E. coli DH5
by transformation were unsuccessful. However, we were able to introduce these plasmids into the nonflagellated organism K. pneumoniae strain 52145 by electroporation, resulting in plasmids pLA-FLIL1 (fliML-flhAL), pLA-FLIL2 (lafK-flgAL), pLA-FLGL (flgBL-flgLL), and pLA-MAFL (maf-5) (Fig. 1). A plasmid containing only the rpoN gene from A. hydrophila AH-3 was obtained by PCR amplification of genomic DNA using oligonucleotides 5'-TGTCTTGATCACCGACCAC-3' and 5'-GCTTGTCCAGCAGGGTATC-3' to generate a 1,927-bp band. The amplified band was ligated into pGEM-T Easy (Promega). The DNA insert was recovered by EcoRI restriction digestion and was ligated into EcoRI phosphatase-treated pACYC184 (34) to generate plasmid pACYC-RPON. This vector was electroporated into E. coli DH5
, and recombinant plasmids surviving on tetracycline plates were selected on the basis of chloramphenicol sensitivity.
|
Assay of adherence to HEp-2 cells.
An HEp-2 tissue culture was maintained as described by Thornley et al. (40). The adherence assay was performed by using a slight modification of the method described by Carrello et al. (7). Bacteria were grown statically in brain heart infusion broth at 37°C, harvested by gentle centrifugation (1,600 x g, 5 min), and resuspended in PBS (pH 7.2) at a concentration of approximately 107 CFU/ml (A600,
0.07). The HEp-2 monolayer was infected with 1 ml of the bacterial suspension for 90 min at 37°C in 5% CO2. Following infection, the nonadherent bacteria were removed from the monolayer by three washes with PBS. The remaining adherent bacteria and the monolayer were then fixed in 100% methanol for 5 min. Methanol was removed by washing with PBS, and the HEp-2 cells with adherent bacteria were stained for 45 min in 10% (vol/vol) Giemsa stain (BDH) prepared in Giemsa buffer. The coverslips were air dried, mounted, and viewed by oil immersion using a light microscope. Twenty HEp-2 cells/coverslip were randomly chosen, and the number of bacteria adhering/HEp-2 cell was recorded. Assays were carried out in duplicate or triplicate.
Biofilm formation. A quantitative biofilm formation experiment was performed in a microtiter plate as described previously (31), with minor modifications. Briefly, bacteria were grown on TSA, and several colonies were gently resuspended in TSB (with or without the appropriate antibiotic); 100-µl aliquots were place in a microtiter plate (polystyrene) and incubated 48 h at 30°C without shaking. After the bacterial cultures were poured out, the plate was washed extensively with water, fixed with 2.5% glutaraldehyde, washed once with water, and stained with a 0.4% crystal violet solution. After solubilization of the crystal violet with ethanol-acetone (80:20, vol/vol) the absorbance at 570 nm was determined.
Statistical analysis. The differences in adherence to HEp-2 cells or biofilm formation in vitro between the wild-type and mutant strains were analyzed by the t test, using the Microsoft Excel software.
Nucleotide sequence accession numbers. The nucleotide sequences determined in this study have been deposited in the GenBank/EMBL database under accession numbers DQ124694 and DQ124695.
| RESULTS |
|---|
|
|
|---|
As no EcoRV restriction sites were present in the transposon, the two groups of mutants were analyzed for the presence of the transposon by Southern hybridization of EcoRV chromosomal DNA digests. A single band was detected in every mutant, indicating that each mutant had a single copy of the mini-transposon in its genome (data not shown).
Sequence analysis of genes interrupted by mini-Tn5Km-1. The DNA flanking the transposon was isolated and cloned into pBCSK (see Materials and Methods). Nucleotide sequencing of the cloned fragments from most of the transposon insertion mutants in the first group (six of nine mutants) revealed ORFs that exhibited high levels of homology to different structural and regulatory A. hydrophila AH-3 lateral flagellar genes (lafA to lafS) reported previously by our laboratory (10). However, the amino acid sequence predicted from DNA flanking the mini-transposon of mutant AH-5501 exhibited homology to FlhAL of the V. parahaemolyticus lateral flagellar export apparatus (38). The amino acid sequence predicted from DNA flanking the mini-transposon in the other two insertion mutants exhibited extremely low levels of homology to possible chaperones, which recently have been identified as ORF14 and ORF15 (Fig. 1). Therefore, we decided to focus on mutant AH-5501. Nucleotide sequencing of members of the second mutant group revealed ORFs that exhibited high levels of homology to the A. hydrophila AH-3 proton flagellar motor genes lafT and lafU reported previously by our laboratory (10).
Organization of the A. hydrophila AH-3 lateral flagellar cluster. Transposon flanking sequences from the AH-5501 mutant were used to synthesize an internal probe of the flhAL-like gene and to screen a previously constructed genomic library of A. hydrophila AH-3 (28). We screened 12,000 recombinant clones, and no positive recombinant was identified. In order to analyze the A. hydrophila lateral flagellar loci, progressive inverse PCR with specific oligonucleotides (see Materials and Methods) was used to amplify and sequence this chromosomal region that was not present in the A. hydrophila AH-3 library.
Sequence analysis of amplified fragments revealed a 28,000-bp gene cluster upstream of the A. hydrophila AH-3 lafA lateral flagellin gene (10); this region contained 29 complete ORFs, most of which were related to the V. parahaemolyticus lateral flagellar gene system (39) (Fig. 1). ORF1 (fliML) to ORF14 (fliJL) and lafA-U (downstream of ORF29) (Fig. 1) were similar to region 2 of the V. parahaemolyticus lateral flagellar gene system, with no putative motYL motor gene, whereas ORF15 (flgNL) to ORF28 (flgLL) were related to region 1 of the V. parahaemolyticus lateral flagellar gene system (Fig. 1 and 2). ORF1 (fliML) to ORF14 (fliJL) and ORF18 (flgBL) to ORF29 (maf-5) were transcribed in the same direction, and ORF17 (flgAL) to ORF15 (flgNL) were transcribed in the opposite direction (Fig. 1). Upstream of ORF1 and transcribed in the same direction was a truncated ORF that encoded a homologue of the putative methyltransferase YarL, which appears not to be involved either in motility or in flagellar biosynthesis; a strong stem-loop termination sequence, AAAATCCCGGCACCTTCTGGTGCCGGGATTTT, was located 469 bp downstream of its TAA stop codon. ORF7 (flhAL) was separated from ORF8 (lafK) by 423 bp; ORF28 (flgLL) was separated from ORF29 (maf-5) by 1,073 bp; and ORF29 was separated from A. hydrophila AH-3 lafA (9) by 459 bp. The other ORFs overlapped or were located one behind the other with intergenic regions less than 80 bp long. Putative Shine-Dalgarno sequences were found upstream of each ORF. Data summarizing the locations of the 29 complete ORFs are shown in Table 2. Sequence analysis in silico revealed possible transcriptional terminator rho-independent sequences downstream of ORF7 (flhAL), ORF14 (fliJL), ORF28 (flgLL), and ORF29 (maf-5). Putative
54 promoter sequences were found upstream of ORF1 (fliML), ORF17 (flgAL), ORF18 (flgBL), and ORF29 (maf-5); a putative
28 promoter sequence was located upstream of ORF16 (flgML); and a different putative promoter sequence was found upstream of ORF8 (lafK) (Fig. 1). RT-PCR using specific primers and total RNA from A. hydrophila AH-3 grown on solid agar (TSA) showed that there was amplification (data not shown) between ORF1 to ORF7 (fliML to flhAL), ORF8 to ORF14 (lafK to fliJL), ORF17 to ORF15 (flgAL to flgNL), and ORF18 to ORF28 (flgBL to flgLL) and ORF29 (maf-5) (Fig. 1). However, no amplification (data not shown) was obtained with pairs of oligonucleotides from ORF7 (flhAL) and ORF8 (lafK), ORF28 (flgLL) and ORF29 (maf-5), and ORF29 and lafA, confirming that at least six clusters are present in the A. hydrophila AH-3 lateral flagellar gene region. The nomenclature of the A. hydrophila lateral flagellar genes is consistent with that of the V. parahaemolyticus genes (39), which are designated with reference to the genes encoding the polar flagella, so that fliML is the lateral flagellar gene equivalent of the polar flagellar gene fliM (Fig. 1).
|
|
28 factor (FlgML), P and L-ring formation (FlgA, FlgH, and FlgIL), and rod and hook formation (FlgB, FlgC, FlgD, FlgE, FlgF, FlgG, FlgJ, FlgK, and FlgLL) proteins of V. parahaemolyticus lateral flagellar system region 1 (39). The last protein (encoded by ORF29) contained a protein family domain (DUF115) between amino acids 194 and 347 and exhibited homology with proteins of Shewanella oneidensis (SO3259), Clostridium acetobutylicum (CAC2196), and Campylobacter jejuni (Cj1337) (36, 27, and 26% identity, respectively). A recent study suggested that CAC2196 of C. acetobutylicum and Cj1337 of C. jejuni are members of the maf (motility accessory factor) gene family involved in flagellin modification and phase variation (16). Construction of lateral flagellar gene defined insertion mutants and complementation studies. To determine the role of some of the identified genes in motility and flagellar biosynthesis, amplified internal fragments of flhAL, fliJL, flgNL, and maf-5 were ligated to pFS100, creating pFS-FLHAL, pFS-FLIJL, pFS-FLGNL, and pFS-MAFL, respectively. The plasmids were independently introduced into AH-405 by conjugation. Defined insertion mutants with mutations in flhAL (AH-5504), lafK (AH-5503), fliJL (AH-5505), flgNL (AH-5506), flgEL (AH-5507), and maf-5 (AH-5508) were obtained. The lafK and flgEL genes were mutated using the Km cassette to avoid polar effects. Correct construction of all mutants was verified by Southern blot hybridization (data not shown). Mutants were subjected to swarming assays in semisolid agar plates and swimming assays with light microscopy in liquid media. All mutants exhibited reduced swarming motility with motility zones that were approximately one-half those of the wild type, but they exhibited wild-type levels of swimming motility (Table 3), like mini-Tn5 mutant AH-5501. To confirm that the alterations in swarming motility were in fact caused by a loss of the lateral flagella, an examination of both flagellar types (polar and lateral) in mutants grown on semisolid and liquid media was carried out by TEM. All mutants exhibited polar flagella and were unable to produce lateral flagella on semisolid media (Table 3). These results suggest that the A. hydrophila fliML-flhAL, lafK-fliJL, flgAL-flgNL, and flgBL-flgLL clusters, as well as the maf-5 gene, are involved in biosynthesis of lateral flagella and not in the formation of polar flagella (Fig. 3).
|
|
Additionally, when the COS-FLG plasmid (2) carrying the A. hydrophila AH-3 flg polar flagellar loci (flgA, flgM, flgNP, and flgB to flgLP) was introduced into AH-5506 and AH-5507, it was unable to rescue motility or lateral flagellar expression. Although the flg polar flagellar genes have functions homologous to those of their lateral flagellar counterparts, they could not perform their functions in lateral flagellar biogenesis.
Cloning of the A. hydrophila AH-3 alternative sigma factor
54 (rpoN).
In order to clone the A. hydrophila alternative sigma factor
54 (rpoN), the genomic library of A. hydrophila AH-3 (28) was transferred by mating into rifampin-resistant V. cholerae rpoN in-frame deletion mutant strain KKV56 (21). Transconjugants were selected for rifampin and tetracycline resistance and inoculated into LB agar (0.3% agar) plates supplemented with 2 mM glutamine and tetracycline. The complemented colonies which spread on the plates were isolated, and plasmid pLA-RPON was recovered. Sequence analysis of pLA-RPON revealed a complete 1,440-bp ORF which encoded a protein consisting of 479 amino acids and having a predicted molecular mass of 53.8 kDa. Moreover, we found two putative promoter sequences approximately 111 bp and 156 bp upstream of the start codon and a putative rho-independent sequence 179 bp downstream of the stop codon. A search of the protein database showed that the deduced amino acid sequence exhibited high levels of homology (55 to 57% identity; 68 to 70% similarity) with the alternative
54 sigma factors from different Enterobacteriaceae, such as Salmonella enterica, E. coli, and Shigella flexneri, as well as from Photobacterium profundum and different Vibrio species.
Construction of rpoN defined insertion mutants and complementation studies. To study the role of rpoN in the regulation of formation of Aeromonas flagella, an amplified internal fragment of the rpoN gene was ligated into pFS100 (pFS-RPON), and the suicide recombinant plasmid was introduced into AH-405 by conjugation. A defined insertion mutant with a mutation in rpoN (AH-5502) was obtained, whose correct construction was verified by Southern blot hybridization (data not shown). The AH-5502 mutant was tested for swarming in semisolid plates and for swimming with light microscopy in liquid media (Table 3). The mutant was absolutely unable to swarm or swim. TEM assays after growth in semisolid or liquid media revealed that AH-5502 lacked both types of flagella (Fig. 4A), in contrast to the wild type. Specific immunoblots of AH-5502 (rpoN) whole cells after growth in solid or liquid media using lateral flagellin- or polar flagellin-specific antibodies showed that the mutant was unable to produce polar or lateral flagellins (Fig. 4B). These results suggest that inactivation of A. hydrophila rpoN eliminated formation of lateral and polar flagella completely.
|
Distribution of the lateral flagellar genes and the rpoN gene in mesophilic Aeromonas strains. The distribution of lateral flagellar genes in mesophilic Aeromonas strains was analyzed by dot blot hybridization experiments with total genomic DNA using independent PCR probes. The distribution of lateral flagella was screened using five separate PCR probes for fliQL-flhBL, lafK-fliFL, flgA-NL, flgD-EL, and maf-5.
The percentages of strains positive for lateral flagellar genes were 70% for fish isolates (7/10 strains), 62% for clinical strains (31/50 strains), and 55% for strains isolated from foods (22/40 strains). Only five of the reference strains for hybridization groups, corresponding to groups 4, 5a, 6, 9, and 12, exhibited a positive hybridization reaction. Of the reference strains used for O serotyping (44 strains), 47% showed positive hybridization reactions, and these strains corresponded to serotypes 2, 3, 7, 8, 9,10, 11, 12, 14, 16, 17, 19, 25, 26, 28, 30, 38, 39, 40, 42, and 44. The representative Aeromonas strains A. caviae Sch3N and A. veronii biovar sobria AH-1 hybridized positively to all lateral flagellar probes. All the strains that were positive for lateral flagella as determined by dot blot hybridization were able to swarm on plates (data not shown). An internal rpoN probe hybridized to the chromosomal DNA of all mesophilic Aeromonas strains tested.
Adhesion to HEp-2 cells and biofilm formation. We examined the adhesion of the wild type and lateral flagellar and rpoN mutants to cultured monolayers of HEp-2 cells. Differences in adherence were calculated by determining the average numbers of bacteria adhering to HEp-2 cells (Fig. 5A.). Also, we compared the abilities of the strains to form biofilms in microtiter plates (Fig. 5B). For the A. hydrophila wild-type strain, AH-3, 18.3 (18.3 ± 1.7) bacteria adhered per HEp-2 cell, and this strains could form biofilms (optical density at 570 nm, 1.3 [1.3 ± 0.1]). For all the defined lateral flagellar mutant strains, which were polar flagellum positive but lateral flagellum negative, there was an approximately 80% reduction in adhesion to HEp-2 cells and a 62% reduction in the ability to form biofilms compared to the wild-type strain. Similar observations were obtained with the A. hydrophila lafB (AH-1982) and lafS (AH-1983) mutant strains described previously (10). For the AH-5502 (rpoN) mutant, which lacked both types of flagella, there was a dramatic reduction (89%) in adhesion to HEp-2 cells compared to the wild-type strain, as well as a reduction in the ability to form biofilms (75%). When lateral flagellar mutant strain AH-5504 (flhAL) was complemented with plasmid pLA-FLIL1, when AH-5503 (lafK), AH-5505 (fliJL), and AH-5506 (flgNL) were complemented with plasmid pLA-FLIL2, and when AH-5507 (flgEL) and AH-5508 (maf-5) were complemented with plasmids pLA-FLGL and pLA-MAFL, respectively, adhesion and biofilm formation values similar to those obtained for the wild type were obtained. Complementation of the AH-5502 (rpoN) mutant with plasmid pACY-RPON restored wild-type levels of adhesion to HEp-2 cells and biofilm formation.
|
| DISCUSSION |
|---|
|
|
|---|
54-dependent transcriptional regulator LafK, the chaperones FliJL and FlgNL, the hook protein FlgEL, and the modification accessory factor protein Maf-5 all eliminated formation of lateral flagella but did not result in the loss of polar flagella. These mutants also exhibited 80% reductions in adhesion to HEp-2 cells and 62% reductions in the ability to form biofilms (Fig. 5). The wild-type phenotype was restored by introduction of the pLA-FLIL1 plasmid into the flhAL mutant, by introduction of pLA-FLIL2 into the lafK, fliJL, and flgNL mutants, by introduction of pLA-FLGL into the flgEL mutant, and by introduction of pLA-MAFL into the maf-5 mutant. It is important to point out that we were unable to clone in E. coli the regions of the Aeromonas lateral flagellar gene cluster in plasmids pLA-FLIL1, pLA-FLIL2, and pLA-GLGL, but this situation was overcome by cloning them in a nonflagellated bacterium, K. pneumoniae strain 52145. Transfer of the COS-FLG plasmid (2), carrying the A. hydrophila AH-3 flg polar flagellar loci (flgA, flgM, flgN, flgB-flgL), into flgEL and flgNL lateral flagellar mutants did not induce expression of lateral flagella. This suggests that although the genes encode similar proteins, they are specific for each specific type of flagella.
The A. hydrophila lateral flagellar gene system contains 38 genes in a single chromosomal region (Fig. 2), similar to the recently described Flag-2 locus of E. coli O42 (33). This is different from the situation in V. parahaemolyticus, whose lateral flagellar genes are distributed in two different chromosomal regions (39). A. hydrophila RT-PCR assays showed that most of the switch and export-assembly genes are divided among two clusters transcribed in the same direction; the first predicted cluster contains fliM, fliN, fliP, fliQ, fliRL, flhB, and flhAL, and the second cluster contains the regulatory gene lafK, as well as fliE, fliF, fliG, fliH, fliI, and fliJL. Moreover, we found upstream of fliML a putative
54 promoter sequence and downstream of flhAL a putative terminator sequence. The regulatory gene lafK starts 423 bp upstream of flhAL, and downstream of fliJL we found a putative terminator sequence. The two clusters are arranged and transcribed differently in V. parahaemolyticus, in which they are transcribed in opposite directions and contain the gene motYL (39). Similar to Flag-2 of E. coli O42 (33) and the lateral flagellar gene system of V. parahaemolyticus, the A. hydrophila lateral flagellar gene clusters do not contain the export-assembly gene fliOL, which is typically found in other flagellar gene systems. The role of FliO is poorly understood, even in S. enterica serovar Typhimurium and E. coli (37). The A. hydrophila lateral flagellar gene clusters (flgA, flgM, flgNL, and flgB to flgLL) exhibit the same distribution and direction of transcription as the V. parahameolyticus cluster in lateral flagellar region 1 (39). Interestingly, we found between flgLL and lafA (10) a modification accessory factor gene (maf-5) that is transcribed independently in the same direction as the flgB-flgLL cluster. The maf-5 gene-encoded protein is homologous to the modification accessory factor (Maf) proteins found in Helicobacter pylori, C. acetobutylicum, and C. jejuni. In all these bacteria, genes encoding Maf proteins are linked to flagellar biosynthesis genes and/or genes involved in sugar biosynthesis and transport (11, 16). Some reports have stated that maf genes contain homopolymeric tracts that result in phase variation via a slipped-strand mispairing mechanism. The fact that insertional mutation of the A. hydrophila AH-3 maf-5 gene eliminated only expression of lateral flagella (Fig. 3) and the fact that the A. hydrophila AH-3 lateral flagellins, like the A. caviae Sch3N lateral flagellins, are glycosylated (10) suggest that the Maf-5 protein maybe involved in specific posttranslational glycosylation of lateral flagella but not polar flagella. Two possible roles could be attributed to this gene: a difference in the last step of polysaccharide synthesis (common for polar and lateral flagella) (unpublished data) linked to only lateral flagella or the specific glycosyl transferase able to link the polysaccharide to the lateral flagellin. If the gene has the latter role, we should be able to find another gene able to transfer the polysaccharide to the polar flagellin.
Different reports have associated the alternative
54 factor rpoN to the formation of polar flagella in different bacteria, such as Pseudomonas aeruginosa, V. cholerae (20), V. parahaemolyticus (39), Vibrio anguillarum (30), and Vibrio alginolyticus (17). The lateral flagellar gene clusters of A. hydrophila, and V. parahaemolyticus (39) are transcribed from promoters recognized by two different, characteristic alternative sigma factors, a specific
28 factor that is encoded by the lafS gene (10) and a
54 factor that has not been described previously in Aeromonas. The A. hydrophila RpoN protein has the three typical domains of
54 factors, the activator interaction domain between amino acids 3 and 51, the core binding domain between amino acids 106 and 306, and the DNA binding domain between amino acids 318 and 477, as well as
54 factor family signature motif 1 (PMVLNDIAEAVEMHESTISRV) and signature motif 2 (RRTIAKY) between amino acids 366 and 386 and amino acids 457 and 463, respectively. Defined insertion into the A. hydrophila rpoN gene resulted in a loss of motility (swarming and swimming), the absence of both types of flagella (lateral and polar), and elimination of polar and lateral flagellin expression (Fig. 4). The wild-type phenotypes were restored when plasmid pACYC-RPON was transferred into the mutant strain. In summary, these results indicated that
54 is essential for transcription of both polar and lateral flagellar gene systems, even though both systems have specific
28 factors. This is the first demonstration that RpoN regulates biosynthesis of Aeromonas lateral flagella.
By comparing the results obtained with mutants that are unable to produce both polar and lateral flagella (rpoN mutant), mutants that are able to produce polar flagella but not lateral flagella (24; this study), and mutants that are able to produce lateral flagella but not polar flagella (2), we concluded that both types of flagella contribute to HEp-2 cell adhesion and biofilm formation in A. hydrophila AH-3. Only the polar flagella in V. parahaemolyticus appear to be involved in these pathogenic features (9).
| ACKNOWLEDGMENTS |
|---|
We thank Maite Polo for her technical assistance and K. E. Klose for providing strain KKV56.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. |