Previous Article | Next Article ![]()
Journal of Bacteriology, February 2006, p. 1260-1265, Vol. 188, No. 4
0021-9193/06/$08.00+0 doi:10.1128/JB.188.4.1260-1265.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Manfred Beleut,2,
Enea Rezzonico,1
Doris Jacobs,1
Fabrizio Arigoni,1
Fritz Titgemeyer,2 and
Ivana Jankovic1*
Nestlé Research Center, Vers-chez-les-Blanc, 1000 Lausanne 26, Switzerland,1 Lehrstuhl für Mikrobiologie, Friedrich-Alexander-Universität Erlangen-Nürnberg, 91058 Erlangen, Germany2
Received 25 August 2005/ Accepted 30 November 2005
|
|
|---|
|
|
|---|
Bifidobacteria can utilize a wide range of carbon sources. Some of them, such as oligofructose, inulin, and raffinose, have been identified as growth-promoting, bifidogenic compounds (8, 10). This is further substantiated by sequence information from Bifidobacterium longum NCC2705, whose chromosome encodes a large variety of carbohydrate utilization genes (22). Nevertheless, little is known about the mechanisms of simple sugar transport, utilization, and regulation in bifidobacteria. Biochemical analyses of glucose transport revealed that a glucose-specific phosphotransferase system (PTS) is present in Bifidobacterium breve, and a potassium-dependent glucose permease, a facilitator for galactose, and a proton-driven symporter for lactose were described in Bifidobacterium bifidum (5, 12, 13). A sucrose permease gene from Bifidobacterium lactis was found as part of an operon that is induced by sucrose and raffinose and is subject to glucose repression (23). The isolation of a fructose kinase gene, frk, which is also repressed by glucose, has been related to fructose utilization in B. longum (3).
In this report, we demonstrate that B. longum NCC2705 preferentially uses lactose over glucose when grown in the presence of both sugars. We further show that glucose transport is down-regulated by lactose, and we identify a glucose transporter gene that undergoes lactose repression.
|
|
|---|
served as a host strain for subcloning experiments, and the glucose transport-deficient E. coli mutant LM1 [tonA galT nagE manA1 kba(Ts) rplI xyl metB thi his mglA agrG crr] (15) was used for heterologous complementation experiments. E. coli strains were grown in Luria-Bertani broth supplemented with ampicillin (100 mg liter1), where appropriate, in baffled flasks under vigorous shaking at 37°C. Bacterial growth was monitored by measuring the optical density at 600 nm (OD600). glcP cloning strategy. Chromosomal DNA of B. longum was isolated following the procedure of Germond et al. (7). Two DNA fragments of 2,031 bp and 1,605 bp comprising glcP (accession number AAN25419) of B. longum, with and without its upstream region, were amplified from chromosomal DNA by PCR with Taq-Hifi DNA polymerase (Roche, Germany) using pairs of oligonucleotides glcP1 (AATCAGGATCCGTGTGCCGGTTGTCTAGC; BamHI site underlined) and glcP3 (TATCGAAGCTTGGTGCCCCAAAAGCACGGC; HindIII site underlined) and glcP1 and glcP2 (GCAACAAGCTTGGTCCGTTAACGGCGAAAGG; HindIII site underlined), respectively. glcP3 and glcP2 were designed to provide a stop codon in frame with the lacZ gene encoded by pBluescript II KS(). The PCR fragments were cloned into BamHI and HindIII sites of pBluescript II KS() to produce plasmids pMB1 and pMB2, harboring glcP without and with its upstream region, respectively.
Glucose transport assays. For glucose transport experiments B. longum was grown in Sixfors fermenters on SSM supplemented with 10 mM glucose, 5 mM lactose, and 10 mM glucose plus 5 mM lactose. A culture (50 ml) of exponentially growing cells was taken at OD600 of 0.5. Cells were immediately harvested at room temperature and washed twice in SSM, saturated with CO2 and 5 mM L-cysteine, at 37°C. Cells were adjusted to OD600 of 1.0 and kept statically at 37°C under anaerobic conditions using the gas pack system. Samples were sequentially taken from the gas pack system, and glucose uptake was initiated by addition of [14C]glucose at a final concentration of 200 µM (0.25 mCi mmol1) without delay. Glucose transport activity was determined by taking 1-ml samples after 60 s of incubation at 37°C, which was within the linear range of transport. Samples were rapidly filtered through nitrocellulose filter disks (NC45; Schleicher & Schuell) and washed with chilled 0.1 M LiCl. Radioactivity was determined by scintillation oscillography.
The determination of Km and Vmax of B. longum GlcP was carried out in E. coli LM1(pMB1). The heterologous expression of glcP was induced in E. coli for one hour at early exponential growth phase (OD600 of 0.5) with 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside). Cells were harvested and washed twice with chilled transport buffer (Tris-HCl, pH 7.5, 50 mM; NaCl, 50 mM; KCl, 10 mM), adjusted to OD600 of 1 and kept on ice. Glucose uptake was conducted at 37°C as described above.
Substrate competition experiments were performed with E. coli LM1(pMB1). The heterologous expression of glcP was induced in E. coli for one hour at early exponential growth phase (OD600 of 0.5) with cells to which an excess of 10 mM nonradioactive carbon source was added 1 min prior to addition of [14C]glucose at a final concentration of 200 µM (0.25 mCi mmol1). The initial uptake rates were determined at final glucose concentrations in the range of 0.8 to 500 µM. All data were collected in triplicate and reproduced in three independent experiments.
NMR experiments.
B. longum was grown on SSM supplemented with 10 mM [13C]glucose and 5 mM [12C]lactose in fermenter. Samples (1.5 ml) of growing culture were taken at different time points. Filtered culture supernatants were subjected to nuclear magnetic resonance (NMR) analysis. Samples were prepared by adding 40 µl deuterium oxide as the magnetic field lock substance and 10 µl of a 50 mM solution of TSP [(3-trimethylsilyl)-D4-propionic acid sodium salt] in D2O to 450 µl of filtered cell extracts. The samples were transferred to 5-mm-diameter NMR tubes and measured at 300 K. 1H NMR spectra were acquired on a Bruker DRX600 NMR spectrometer operating at a proton NMR frequency of 600.13 MHz. A standard one-dimensional pulse sequence (RD-90°-t1-90°-tm-90°-acquisition) with water presaturation during the relaxation delay (RD) and the mixing time (tm) was applied. Typical acquisition parameters included 32,000 data points, 64 transients, a spectral width of 8,389 Hz, a mixing time of 100 ms, an acquisition time of 1.95 s, and a relaxation delay of 2 s. As for standard one-dimensional NMR spectra, an exponential line-broadening function of 0.3 Hz was applied to the free induction decay prior to Fourier transformation. All spectra were referenced to TSP at 0.00 ppm and were phase and baseline corrected. For quantitative analysis, peak heights at 5.374 ppm assigned to 13CH-
1-glucose and at 4.45 ppm assigned to CH-1'-lactose were measured and referenced to an internal standard at 7.728 ppm. The detection limit of the method is 50 µM.
Determination of sugar concentrations by HPLC. B. longum was grown in fermenter containing SSM supplemented with 10 mM glucose, 5 mM lactose, or in a combination of both sugars. Culture samples (1.5 ml) were taken at different time points. Sugar concentrations were determined from filtered supernatants by high-performance liquid chromatography (HPLC) (series 1100 system; Hewlett Packard, Waldbronn, Germany). Samples (20 µl) were injected on an Aminex HPX-87H column (Bio-Rad) connected to a cation-H guard column (Bio-Rad) at 35°C. Sugars were eluted with 5 mM sulfuric acid at a flow rate of 0.6 ml/min for 25 min. The compounds were detected with a refractometer heated at 35°C and were compared to standards.
RNA preparation. B. longum was grown in fermenter containing SSM supplemented with 100 mM glucose, 50 mM lactose, or 50 mM glucose and 25 mM lactose. Culture samples (15 ml) were taken during exponential growth phase at OD600 of 0.5. Cells were harvested, immediately frozen with liquid nitrogen, and stored at 80°C. Isolation of total RNA from B. longum was performed following the method of Kuipers et al. (14) with the following modifications: macaloid/phenol/sodium dodecyl sulfate/bacteria suspensions were homogenized in a bead beater (Mini-Bead Beater-8; BioSpec) for 3 x 1 min and centrifuged to remove glass beads and cell debris. After phenol extraction, total RNA was precipitated from aqueous phase with ethanol, resuspended in 100 µl diethylpyrocarbonate-treated water, and stored at 80°C. DNase treatment of total RNA was performed with an RNeasy kit (QIAGEN). RNA quality was controlled using an Agilent 2100 bioanalyzer by looking at the integrity of 16S and 23S rRNAs.
Microarray experiments.
Glass microarrays were produced by Eurogentec SA (Belgium) by printing PCR-based probes designed to cover approximately 97% of the identified open reading frames of the B. longum NCC2705 genome. Labeling of RNA, synthesis of cDNAs, and hybridizations were performed using a 3DNA Array 350RP Genisphere kit (Genisphere Inc., Hatfield, Pa.), following the protocol provided by the supplier. Relative gene expression ratios were then calculated using expression of glucose-grown cells as a reference. Mean results of each comparison represent the average of four hybridizations from two biological repeats (two hybridizations for each biological repeat). Genes were considered differentially expressed if they displayed an average absolute log2-tranformed gene expression ratio of
1 and a P value of
0.002. Detailed description of the method is provided as supplementary material.
Real-time PCR. cDNAs were synthesized from RNAs using random hexamers and TaqMan reverse transcription reagents (Applied Biosystems, Roche) according to the supplied protocol. Real-time PCR was performed in an ABI PRISM 7000 machine (Applied Biosystems) using the SYBR Green PCR Master Mix (Applied Biosystems) following the supplied protocol. Average relative gene expression values were calculated by combining data from three independent biological replicates. The normalization of real-time PCR results was done using two genes: BL0274, encoding L-ribulokinase (EC 2.7.1.16), and BL0301, encoding a cysteinyl-tRNA synthetase (EC 6.1.1.16), whose expression was shown to be constitutive under different experimental conditions (data not shown). Primers designed with the PRIMEREXPRESS software (Applied Biosystems) are presented in Table 1.
|
View this table: [in a new window] |
TABLE 1. Primers used for real-time PCR
|
Computer analysis. Protein databank searches were carried out at the BLAST server of the National Center for Biotechnology Information at the National Institutes of Health, Bethesda, Md. (http://www.ncbi.nlm.nih.gov), and the BLAST server of the Transport Classification Databank, TCDB (www.tcdb.org).
|
|
|---|
![]() View larger version (23K): [in a new window] |
FIG. 1. Sugar depletion from culture medium containing lactose ( ) and glucose ( ) during growth of B. longum (). The strain was grown on SSM supplemented with 10 mM glucose and 5 mM lactose. Changes in cell density were recorded every hour. Sugar analysis was done by HPLC. For NMR analysis, the strain was grown on SSM supplemented with 10 mM [13C]glucose and 5 mM [12C]lactose. The NMR spectra on the right correspond to the most relevant time points showing lactose and glucose depletion. The missing peaks of [12C]glucose and [12C]galactose moieties of lactose are framed. Reference spectra below represent 10 mM glucose (Glc) or galactose (Gal) and 5 mM lactose (Lac) in nonfermented SSM.
|
![]() View larger version (13K): [in a new window] |
FIG. 2. Glucose uptake by B. longum cells. The cells were grown on SSM supplemented with 10 mM glucose (Glc), 5 mM lactose (Lac), and 10 mM glucose plus 5 mM lactose (Glc+Lac) to OD600 of 0.5. Glucose uptake was determined using 200 µM [14C]glucose. Glucose uptake activities are presented as a percentage of the uptake by cells grown on glucose (100% = 6.10 [±0.44] nmol of glucose OD6001 min1).
|
Quantitative real-time PCR using the same RNA samples was performed to validate the microarray results. In this experiment, BL1631 expression was on average 2.6-fold lower in cells grown on lactose compared to cells grown on glucose (95% confidence interval between 1.6 and 4.0). In the presence of glucose and lactose on the other hand, expression of BL1631 was on average 4.3-fold lower than on glucose (95% confidence interval between 3.4 and 5.6). This result together with the observed pattern in the microarray led us to conclude that the expression of BL1631 is regulated in a sugar-dependent manner and that the transcription is down-regulated in cells growing in the presence of lactose compared to glucose-grown cells.
BL1631 encodes a glucose-specific permease, GlcP. BL1631 was originally annotated as a xylose transporter, xylT, based on the highest BLAST similarity with the well-characterized xylose transporter XylT from Lactobacillus brevis (46% amino acid identity; accession number AAC95127) (4, 25, 26). Further analysis using the BLAST search at the TCDB, in which experimentally investigated targets are considered, revealed significant identities to the glucose permeases GlcP from Synechocystis sp. strain PCC6803 (37% identity; accession number CAA34119) and Streptomyces coelicolor (33% identity; accession number CAC01642) (4, 25, 26). Based on the TCDB BLAST result together with the BL1631 gene expression profile and glucose transport results, we hypothesized that this gene encodes a glucose permease rather than a xylose transporter. To confirm this, we tested whether BL1631 was able to functionally complement E. coli strain LM1 that carries mutations in all intrinsic glucose transporter genes (15). LM1 was transformed with pMB1, in which the BL1631 coding region was cloned under control of the Ptac promoter in pBluescript KS(). LM1(pMB1) formed red colonies on MacConkey agar plates supplemented with 50 mM glucose and 1 mM IPTG due to fermentation of glucose, while the isogenic control LM1[pBluescript KS()] remained white. Subsequently performed glucose uptake experiments revealed that LM1(pMB1) effectively transported glucose at a rate of 2.6 nmol of glucose OD6001 min1, while glucose uptake of LM1[pBluescript KS()] was negligible (<0.1 nmol of glucose OD6001 min1).
To further characterize the properties of BL1631 in vivo, we analyzed its substrate specificity by measuring glucose transport in the presence of an excess of competing sugars. As can be inferred from Fig. 3, BL1631 showed the highest specificity for glucose, followed by 2-deoxy-D-glucose, mannose, and galactose. In contrast, fructose, arabinose, and xylose were poorly recognized. The Km and Vmax values for glucose uptake were determined to be 70 (±14) µM and 11 (±2) nmol OD6001 min1 (not shown). Thus, BL1631 encodes a specific glucose permease and xylT was renamed glcP.
![]() View larger version (22K): [in a new window] |
FIG. 3. Competition of sugars with glucose uptake by E. coli LM1(pMB1). The cells were grown in Luria-Bertani broth to OD600 of 0.5. After one hour of further growth in the presence of 1 mM IPTG, glucose uptake was determined in the presence of 200 µM [14C]glucose and 10 mM competitor sugar. The initial rate of glucose transport in E. coli LM1(pMB1) was 2 nmol min1 OD1 (100%). Glucose uptake activities are presented as a percentage of the uptake by cells grown on glucose.
|
![]() View larger version (12K): [in a new window] |
FIG. 4. The genomic organization of the glcP region in B. longum. The sizes and orientations of the genes were deduced from the nucleotide sequences. A part of the nucleotide sequence of the glcP-ptsG intergenic region is presented below the genetic organization, showing inverted repeats of the transcriptional terminator and of the RAT sequence, which is aligned with a RAT consensus sequence. A potential transcriptional terminator is indicated by inverted arrows and a stem-loop. A putative transcriptional start site of glcP determined by primer extension is indicated by an asterisk.
|
In addition to ptsG, which is the single PTS transporter identified in the genome of B. longum NCC2705, the expression of general PTS genes ptsI and ptsH was also barely detectable in microarrays. The presence of only one PTS transporter and a weak expression of all PTS genes suggest the minor role of this system in the sugar metabolism of B. longum.
The genome of B. longum (accession number AE014295) contains four putative lactose operons. Two operons are identical, consisting of LacI-like regulator, ß-galactosidase, and ABC transporter genes (BL0258-BL0260 and BL1167-BL1169). The third operon consists of genes encoding putative lactose permease (BL0976) and ß-galactosidase (BL0978). The fourth, probably nonfunctional operon consists of a LacI regulator-like gene (BL1774) and a cryptic ß-galactosidase-like gene (BL1775). The microarray data indicate that these genes are either constitutively expressed or induced by lactose, but none of them is significantly repressed by glucose (data not shown).
Primer extension analysis of glcP. A potential transcriptional start site of glcP was resolved by primer extension analysis in a carbon source-dependent manner. The result of the experiment depicted in Fig. 5 revealed that primer extension signals match with a G residue located 205 bases upstream of glcP and 19 bases upstream of a putative RAT sequence. Signals were stronger in RNA preparations from glucose-grown cells, compared to cells grown on lactose or both sugars, which is consistent with the observed lactose-mediated repression of glcP in real-time PCR and microarrays.
![]() View larger version (64K): [in a new window] |
FIG. 5. Primer extension analysis of glcP gene transcription of B. longum. Total RNA was isolated from cells grown on SSM supplemented with 10 mM glucose (Glc), 5 mM lactose (Lac), and 10 mM glucose plus 5 mM lactose (Glc+Lac). Primer extension products, obtained with 15 µg of RNA, were separated along with sequencing reactions on an 8% polyacrylamide-urea gel. Products were analyzed on 8% polyacrylamide-urea gels. The determined transcriptional start site is indicated with an asterisk.
|
|
|
|---|
Glucose transport assays with B. longum revealed the down-regulation of glucose transport by lactose. A genome-wide screening led to the identification of one target gene (BL1631) of lactose-mediated repression. Initially, bioinformatic analysis of BL1631 suggested a function as xylose transporter since it is clearly most similar to XylT of L. brevis, which exhibits the highest substrate specificity for xylose (4). However, gene expression results, complementation of a glucose-deficient E. coli strain, and data derived from substrate specificity analysis clearly support that BL1631 encodes a glucose-specific permease of the major facilitator superfamily, which likely functions as a glucose:H+ symporter (18, 25) and therefore was named glcP.
Independent transcriptional analyses using microarrays, real-time PCR, and primer extension revealed lower levels of glcP expression in lactose-grown cells. The regulation of gene expression by different carbon sources usually involves a regulatory mechanism of carbon catabolite repression. This regulatory mechanism is not known to occur in B. longum NCC2705, especially since the genome contains no obvious catabolite repression elements such as a ccpA-like homologue, respective cis-acting catabolite responsive elements (cre), or HPr-kinase.
A mechanism of glcP regulation in B. longum might implicate the putative LicT-like antiterminator encoded two genes upstream from glcP (Fig. 4). Antiterminator proteins bind to RAT sequences to prevent the formation of an overlapping RNA terminator structure, thereby facilitating gene transcription (20). A RAT sequence was identified 19 nucleotides downstream of the glcP transcriptional start site partially overlapping with a predicted terminator structure (Fig. 4). Activation of antiterminator proteins usually occurs via phosphorylation of conserved histidine residues by the general PTS components in response to the availability of the substrate (16). Hence, one might speculate that B. longum LicT is activated in the presence of glucose upon depletion of lactose from the culture medium. Further analyses should be performed to prove a possible implication of LicT in antitermination of glcP and its activation by the products of poorly expressed PTS genes.
The glcP-ptsG locus described here as being involved in glucose uptake is opposed by three putative lactose operons in the genome of B. longum. Interestingly, the expression of these putative lactose operons seems not to be down-regulated in the presence of glucose, and ß-galactosidase activity remained constitutive. These observations illustrate how well B. longum has adapted to growth on lactose. The potential to use lactose probably contributes to the adaptation to the gastrointestinal tracts of mammals in the first months of life, when lactose is a predominant carbon source.
In summary, the lactose-over-glucose preference in B. longum NCC2705 is manifested by lactose repression of the glucose transport. Data presented here suggest that this is (partially) achieved by down-regulation of glcP expression in a lactose-dependent manner, thereby shifting the balance of uptake and metabolism between glucose and lactose. More work is required to study the molecular mechanisms of lactose repression in B. longum. This is still hampered because development of cloning vectors and strategies to obtain mutants in bifidobacteria has not yet progressed sufficiently. The present work provides the basis to further analyze the phenomenon of lactose preference at the molecular level in bifidobacteria.
The work was funded by grant SFB473 of the Deutsche Forschungsgemeinschaft.
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
Both authors contributed equally to this work. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»