JB Free Medline Searching
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Puri-Taneja, A.
Right arrow Articles by Hulett, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Puri-Taneja, A.
Right arrow Articles by Hulett, F. M.
Journal of Bacteriology, February 2006, p. 1266-1278, Vol. 188, No. 4
0021-9193/06/$08.00+0     doi:10.1128/JB.188.4.1266-1278.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

CcpA Causes Repression of the phoPR Promoter through a Novel Transcription Start Site, PA6

Ankita Puri-Taneja, Salbi Paul, Yinghua Chen,{dagger} and F. Marion Hulett*

Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, Chicago, Illinois 60607

Received 25 August 2005/ Accepted 23 November 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Bacillus subtilis PhoPR two-component system is directly responsible for activation or repression of Pho regulon genes in response to phosphate deprivation. The response regulator, PhoP, and the histidine kinase, PhoR, are encoded in a single operon with a complex promoter region that contains five known transcription start sites, which respond to at least two regulatory proteins. We report here the identification of another direct regulator of phoPR transcription, carbon catabolite protein A, CcpA. This regulator functions in the presence of glucose or other readily metabolized carbon sources. The maximum derepression of phoPR expression in a ccpA mutant compared to a wild-type stain was observed under excess phosphate conditions with glucose either throughout growth in a high-phosphate defined medium or in a low-phosphate defined medium during exponential growth, a growth condition when phoPR transcription is low in a wild-type strain due to the absence of autoinduction. Either HPr or Crh were sufficient to cause CcpA dependent repression of the phoPR promoter in vivo. A ptsH1 (Hpr) crh double mutant completely relieves phoPR repression during phosphate starvation but not during phosphate replete growth. In vivo and in vitro studies showed that CcpA repressed phoPR transcription by binding directly to the cre consensus sequence present in the promoter. Primer extension and in vitro transcription studies revealed that the CcpA regulation of phoPR transcription was due to repression of PA6, a previously unidentified promoter positioned immediately upstream of the cre box. E{sigma}A was sufficient for transcription of PA6, which was repressed by CcpA in vitro. These studies showed direct repression by CcpA of a newly discovered E{sigma}A-responsive phoPR promoter that required either Hpr or Crh in vivo for direct binding to the putative consensus cre sequence located between PA6 and the five downstream promoters characterized previously.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacteria respond to changes in environmental conditions through various strategies, one of which is two-component signal transduction systems. The Pho regulon represents one such system and responds to the phosphate starvation conditions experienced by the gram-positive bacterium Bacillus subtilis. This system consists of the histidine kinase PhoR, which senses limited Pi (inorganic phosphate) conditions in the environment, and the response regulator PhoP, which is phosphorylated by the histidine kinase and regulates the transcription of a number of genes to create the cellular response to phosphate starvation (the Pho response) (21).

In addition to PhoP-PhoR, the Pho signal transduction network includes two parallel activation pathways for upstream regulators, the ResDE two-component system and the transition state regulator AbrB. A mutation in the response regulator resD leads to an approximately 80% reduction in the Pho response, while an abrB mutation causes an approximately 20% reduction in Pho regulon gene expression. A resD-abrB double mutant is incapable of inducing Pho regulon genes upon phosphate starvation (54). The role of ResD is indirect via its essential role in the production of a-type terminal oxidases that oxidize reduced quinones that were shown to inhibit PhoR autophosphorylation in vitro (50), suggesting that ResD is required for modulation of the Pho signal. The role of AbrB remains unclear, but extensive protection of the phoPR promoter region by AbrB suggests that it may have a direct role in phoPR transcription (M. Strauch and F. M. Hulett, unpublished data).

The genes encoding the two regulatory proteins, PhoP and PhoR, are present in an operon transcribed from a common promoter region (33, 51). Primer extension analysis using RNA from a wild-type (JH642) and a {Delta}sigB mutant strain showed that expression of the phoPR promoter was the sum of five promoter start sites and that each responded to specific growth phase and environmental controls (43). Several forms of RNAP holoenzymes were required for expression from these promoters (Fig. 1; two promoters required E{sigma}A (PA3 and PA4), one E{sigma}B (PB1), and one E{sigma}E (PE2). Expression from PE2, PA3 and PA4 was enhanced by PhoP~P (phosphorylated PhoP). The form of RNAP required for a fifth transcription start site (called P5), observed using RNA from a sigB mutant strain, remains unknown (43).


Figure 1
View larger version (39K):
[in this window]
[in a new window]
 
FIG. 1. (A) phoPR promoter sequence and 5' PhoP coding sequence showing the various transcription start sites and PhoP binding sites. Gray shading identifies the region protected by both PhoP and PhoP~P. Stippled shading identifies the sequence protected only by PhoP~P. Transcription start sites for PB1, PE2, PA3, PA4, P5 and PA6 are indicated by bold sequences that are identified by a bent arrow followed by the promoter number. The letters in each promoter name, B, E, and A, stand for E{sigma}B, E{sigma}E, and E{sigma}A, respectively. The –10 and –35 sites are also marked for each promoter. The consensus repeats for PhoP dimer binding, TT(A/C/T)A(C/T)A, are underlined with the sequence in bold print. The translational start codon ATG is boxed and identified by a bent arrow marked +1. Sequence numbering is relative to the A of ATG as +1. Arrows with half arrowheads identify primers used in primer extension and/or in vitro transcription. The DraI and BspHI sites indicate the restriction sites used for creating fragments for gel shift assays. The conserved cre box sequence is boxed and labeled. (B) Comparison of cre box consensus sequence and phoPR cre box sequence. 3' and 5' A+T-rich regions are separated from the cre sequence by a space. The mutation created in the cre box is shown. Symbols for nucleotides in the consensus sequence: W, A or T; R, A or G; Y, C or T; N, A, G, C, or T.

 
Carbon catabolite regulation is a widespread phenomenon found in bacteria where the expression of a number of genes is regulated by the presence of a preferred carbon source such as glucose. This regulation is typically mediated by a transcriptional regulator. In gram-positive bacteria such as B. subtilis, the regulation is through CcpA, a pleiotropic transcriptional regulator belonging to the LacI/GalR family of transcription regulators (18). CcpA functions as a DNA binding protein, either activating or repressing a number of genes in the presence of a preferred carbon source.

A consensus sequence called the cre (catabolite response element) box is typically present within the regulated promoter (20, 59) or in the coding region of a downstream gene or operon. Activation or repression of many CcpA-regulated genes requires HPr, a member of the phosphotransferase system (PTS) system or Crh, a protein with 45% identity to HPr as a coeffector (13). HPr and Crh require phosphorylation at residue Ser46 for the purpose of catabolite regulation (9, 14). This phosphorylation is achieved exclusively by a kinase called HPr kinase (15, 49) that also has a phosphatase activity (31). HPr can function in the phosphotransferase system and this activity requires phosphorylation at the His15 residue by the PTS enzyme I. Crh lacks the His15 phosphorylation site, restricting it to function only in catabolite regulation (38).

The majority of the CcpA-regulated genes are affected negatively, for example, the genes involved in alternate carbon source utilization (2, 11, 17, 30, 39, 40, 60) or certain genes of the tricarboxylic acid (TCA) cycle (26, 55). Positive regulation by CcpA is observed for genes that are involved in the carbon excretion pathway, such as pta (46), ackA (41), acetoin biosynthesis (56), and certain genes encoding enzymes of glycolysis (37, 55).

The basic understanding of the phoPR operon regulatory region makes the mechanistic analysis of additional regulators feasible, regulators such as AbrB and CcpA. A sequence identical to the consensus sequence for the cre box (19, 59) in the phoPR promoter region has long been recognized. Recently, inclusion of phoPR among the genes repressed by CcpA in the transcriptome studies of Stulke and colleagues (6) suggests a possible role for CcpA in phoPR regulation. The studies reported here were initiated to determine if the apparent role of CcpA is direct and, if so, which of the phoPR promoter(s) is regulated by CcpA. We demonstrate that CcpA plays a significant role in the transcriptional regulation of the phoPR promoter, which is achieved by its direct binding to the cre box consensus sequence present in the phoPR promoter. Transcription of the phoPR promoter is controlled by CcpA through a previously unknown start site now referred to as PA6 which requires E{sigma}A.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains and plasmids. All strains and plasmids used in this work are listed in Table 1. ccpA, crh, and ptsH1 mutant strains were obtained by transforming QB5407, JZ4, or JZ8 chromosomal DNA, respectively, into MH6024 competent cells and selecting for spectinomycin resistance (Spcr) or chloramphenicol resistance (Cmr) as required. The parent strain for MH6024 was JH642. The transformants were plated on tryptose blood agar base (TBAB) with glucose medium with the antibiotics mentioned above for selection.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids

 
Construction of isotopic phoPR-lacZ fusions. pMUTIN2 (57) was used to create lacZ fusion strains. pES2 contains the complete phoPR promoter and 494 bp of the upstream gene mdh. pES2 was constructed by using the 802-bp EcoRI-BamHI fragment from pES1 (23) and cloning into the EcoRI and BamHI sites of pUC19. The 802-bp EcoRI-BamHI fragment from pES2 was ligated into pMUTIN2 at complementary restriction sites giving rise to plasmid pAT3. This ligation orients the promoter upstream of the lacZ reporter gene. pAT3 was transformed into B. subtilis and was integrated into the phoPR locus by Campbell insertion creating strain MH6024, which contained complete mdh gene upstream of phoPR promoter-lacZ fusion and partial mdh gene and complete phoPR operon under the control of its own promoter (see Fig. 2).


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2. Isotopic Campbell insertion of the phoP-lacZ fusion from a pMUTIN2 construct into the B. subtilis genomic DNA. (A) Structure of pAT3. Single crossover through homologous recombination between plasmid DNA and genomic DNA. (B) Resultant insertion into the genomic DNA after the recombination event. The plasmid DNA is shown in black and the genomic DNA is shown in gray. Genes are shown as thick arrows, phoP and phoR are in solid colors and the mdh (citH) gene is shown in stripes. The promoters are shown as broken arrows.

 
A point mutation in the cre box was created using QuikChange site-directed mutagenesis kit (Stratagene) using the following primers: FMH641 (TTTACTATAAATGAAAGCTCTATCATAAACGTCTTTATTTC) and FMH642 (GAAATAAAGACGTTTATGATAGAGCTTTCATTTATAGTAAA) for the cre1 mutation using plasmid pES2 as a template. The mutated promoter was then amplified using primers FMH735 (AAGCTTCAGGTGTGTTGATACG) and FMH079 (GTGGATCCGTAATGACATCATAGCCT), and the resulting PCR products were cloned into pCR2.1 (Invitrogen). FMH735 contains a HindIII site at the 5' end and FMH079 contains a BamHI site. The phoPR promoter fragments were excised by digestion with BamHI and HindIII and cloned into complementary sites in pMUTIN2. Mutations were confirmed by DNA sequencing (University of Chicago cancer research sequencing center).

Bacterial growth media and enzyme assays. For expression of the phoPR-lacZ fusion, the cells were cultured in low-phosphate defined medium (LPDM) or high-phosphate defined medium (HPDM) as described previously (22). When grown in LPDM, ccpA mutant strains exhibited the characteristic severe growth defect, which inhibited the study of the effect of the mutation in ccpA on our system. Addition of glutamate (5 mM), glutamine, valine, and isoleucine (all 0.5 mg/ml) (36) to our medium helped the growth of ccpA mutant. Amino acids routinely added to our defined medium were leucine, methionine, phenylalanine, and tryptophan (each 0.5 mg/ml). After these additions the growth of the ccpA mutant strain in LPDM was comparable to that of the wild-type strain and allowed us to study the effect of CcpA on phoPR promoter expression.

The strains were grown in HPDM and LPDM for a period of 12 h and samples were taken every hour. ß-Galactosidase assays were conducted as per Ferrari et al. (10). The activity unit was defined as 0.33 nmol of ortho-nitrophenol produced per minute and the specific activity was calculated as activity per mg of protein. The alkaline phasphatase assays were conducted as described previously (22). LPCM (Low-Phosphate Complex Medium) contained 3 g/liter ammonium acetate, 0.25 g/liter MgSO4, 0.02 g/liter calcium acetate, 0.5 mM MnCl2, 10 g/liter Bacto peptone, 0.2 g/liter L-arginine, 50 mM Tris (pH 6.9), 0.5% glucose, 0.05 mg/ml amino acids (methionine, histidine, tryptophan, leucine, and phenylalanine), and 0.05 mg/ml thiamine.

Overexpression and purification of proteins. (i) His-CcpA. CcpA was purified as described by Kim et al. (26). The plasmid for production of His-tagged CcpA was a gift from T. Henkin.

Overexpression and purification of proteins. (ii) {sigma}A and RNAP and core polymerase. These were purified as described previously (43).

Gel shift assays. The probe was prepared by digesting plasmid pAT11 (wild type) and pAT12 (cre1) with BspHI and DraI enzymes to yield a fragment of 109-bp length that was labeled with [{gamma}-32P]ATP using polynucleotide kinase (Fermentas). In each reaction 20,000 cpm of labeled probe was incubated with various concentrations of CcpA in buffer containing 10 mM Tris-Cl (pH 7.5), 1 mM EDTA (pH 7.5), 50 mM KCl, 0.05% NP-40, 10% glycerol, 1 mM dithiothreitol modified from Kim et al. (27) at room temperature for 15 min. The samples were then loaded and run on 6% polyacrylamide gel made in 1x Tris-borate-EDTA. The gel was run for 1 h at 4°C, vacuum dried and the radioactivity was detected using PhosphorImager or X-ray film.

Preparation of phoPR promoter probe for footprinting. Primer FMH464 (M13Reverse: 5'-GGATAACAATTTCACACAGGA-3') or FMH465 (M13Foward: 5'-GTAAAACGACGGCCAGT-3') was end labeled with T4 polynucleotide kinase (Fermentas) in the presence of [{gamma}-32P]ATP and then purified by polyacrylamide gel electrophoresis (PAGE) extraction followed by ethanol precipitation. PCR was conducted using the primer pair FMH464 and FMH465 and plasmid pSB5 as the template. pSB5 contains the complete promoter sequence shown in Fig. 1. For radiolabeling of the noncoding or coding strand, radiolabeled FMH464 and FMH465, or FMH464 and radiolabeled FMH465 were used. The PCR conditions were: denaturing at 94°C and 1 min, annealing at 55°C and 2 min, and extension at 68°C and 3 min for 30 cycles. The PCR products were extracted from PAGE, and purified by Elutip-D minicolumns (Schleicher & Schuell) as described in the instruction manual.

DNase I footprinting of the phoPR promoter. In each reaction, the required protein and probes (20,000 cpm) were incubated at room temperature for 30 min in binding buffer containing 10 mM Tris (pH 7.5), 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol (same as the gel-shift binding buffer, except NP-40 was omitted). DNase I (3 µl of 0.04 U/µl in 5 mM MgCl2, 5 mM CaCl2) was added to each reaction mixture, and digestion was conducted for 60s for protein-containing samples and 30s for protein-free samples. The reaction was stopped and the DNA fragments were purified by phenol extraction followed by ethanol precipitation. The DNA fragments were run on a 4% polyacrylamide gel containing 7 M urea and detected by PhosphorImager analysis and/or X-ray film (Fuji) radiography.

RNA preparation and primer extension analysis. Total RNA was isolated using the QIAGEN Rneasy kit, from B. subtilis strains MH6024 and MH6025 grown in LPDM at various time intervals during the 12-h growth curve. A total of 20 to 50 µg of RNA was used in each primer extension reaction. The primer extension solutions were the same as described previously (7). A sequencing ladder was produced by end labeling primer FMH079 or FMH811 (CTTGTTCATGCTGTGCCTCCAGTATT) with [{gamma}-32P]ATP, annealing it to pSB5, and using Sequenase (U.S. Biochemicals Corp.), according to the manufacturer's instructions.

In vitro transcription. The reactions were performed as described previously (43). The phoPR promoter from bp –300 to +92 as shown in Fig. 2 was used as and template (2 nM). In vitro transcription in the presence of CcpA was performed with various concentrations of CcpA (0.15, 0.5, 1.0, and 1.5 µM) added to the in vitro transcription reaction prior to the addition of RNAP (0.4 µM). RNAP core (0.1 µM) was used with (0.8 µM) {sigma}A.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CcpA represses the transcription of the phoPR promoter under excess phosphate conditions. Because the phoPR promoter contains a perfect match to the cre box consensus sequence (59) upstream of the five previously identified phoPR promoter start sites (43) (Fig. 1), we sought to determine if CcpA had an affect on phoPR transcription. Isogenic wild-type (MH6024) and ccpA mutant (MH6025) strains containing an isotopic phoPR-lacZ fusion were constructed using the plasmid pMUTIN2 (57). The full-length phoPR promoter from pES2 that contained 705 bp 5' of the translational +1 start site, including 494 bp of the upstream mdh (citH) gene and 92 bp downstream of the +1, was ligated into the multiple cloning site of pMUTIN2 downstream of the IPTG-inducible PSPAC promoter and upstream of the lacZ gene. (Only 300 bp of the 705 bp upstream of +1 are shown in Fig. 1.)

The construct was transformed into JH642 by insertion duplication due to homology with the 3' region of the citH gene-3' region of the phoPR promoter (Fig. 2). This isotopic insertion allowed expression of the phoPR-lacZ fusion under the control of the phoPR promoter and also retained the intact phoPR promoter element upstream of the operon to control phoPR expression. The strains were grown in LPDM plus amino acids over a period of 12 h as described in Materials and Methods (Fig. 3A). When grown in LPDM containing glucose as the carbon source, the wild-type strain JH642 (MH6024) exhibited low-level transcription from the phoPR promoter fusion during excess phosphate conditions (hours 0 to 5), but transcription was induced when inorganic phosphate levels fell below 0.1 mM (1, 48) (hours 6 to 12). When grown in LPDM containing additional (5 mM) inorganic phosphate (HPDM), the wild-type strain (MH6024) exhibited a low level of phoPR expression throughout growth.


Figure 3
View larger version (50K):
[in this window]
[in a new window]
 
FIG. 3. Effect of ccpA null mutation or a cre box mutation on phoPR transcription in (A) LPDM and (B) HPDM. Each medium is supplemented with amino acids to support ccpA strain growth. The cells were cultured and the readings were taken for 12 h. Solid symbols represent growth and open symbols represent ß-galactosidase specific activity of the phoPR-lacZ fusion in each strain, wild type (MH6024, {square}); ccpATn917 (MH6025, {circ}); phoPR cre1-lacZ (MH6040, {triangleup}). (C) EMSA for phoPR promoter fragment with wild-type cre box with CcpA. (D) Promoter with phoPRcre1 type mutation. The promoter fragment in both cases is a 109-bp BspHI-DraI fragment from the phoPR promoter. Restriction site positions and sequences are given in Fig. 1.

 
The ß-galactosidase assays revealed that transcription of the phoPR promoter was much higher in the ccpA mutant strain (MH6025) relative to the wild-type strain (MH6024) (Fig. 3A) with the most significant elevated levels observed during the initial stages of growth (>8-fold; hours 0 to 5) when the phosphate levels are sufficient to inhibit autoinduction of the phoPR operon (Fig. 3A). When the strains were grown in HPDM (5 mM Pi) where phosphate does not become limiting during growth of the culture, the transcription level of phoPR-lacZ in a ccpA mutant strain (MH6025) was consistently high, roughly 20-fold higher than that of the wild-type strain (MH6024) where transcription remained low (Fig. 3B). These data suggested a repressor function for CcpA on the phoPR promoter.

Mutation in the putative phoPR promoter cre box resulted in increased levels of phoPR transcription. A single base pair change (C to T) at a conserved base in the cre box sequence (Fig. 1B) was created by site-directed mutagenesis and the mutant phoPRcre1 promoter was substituted for the wild-type promoter in the B. subtilis JH642 chromosome as described in materials and methods. The presence of this cre1 mutation (MH6040) resulted in an increase in phoPRcre1-lacZ transcriptional activity in LPDM (Fig. 3A) or HPDM (Fig. 3B) relative to the level of wild-type phoPR expression, activity that was similar to that observed for the ccpA mutant strain (MH6025) grown in LPDM (Fig. 3A) or HPDM (Fig. 3B). Together the observed effect of a ccpA mutation or the cre box mutation on the expression of the phoPR promoter suggested strongly that CcpA is a negative regulator of the phoPR promoter. That the cre1 mutation caused the phoPRcre1 promoter fusion expression to resemble that of the wild-type promoter in a ccpA mutant background suggested further that CcpA may act by binding directly to the phoPR cre box.

CcpA binds to the phoPR promoter. To determine if CcpA functions by binding to the phoPR promoter, we performed an electrophoretic mobility shift assay (EMSA). Gel shift assays showed that purified CcpA bound efficiently to the 109-bp phoPR promoter fragment containing the wild-type cre box (Fig. 3C). CcpA formed two complexes with the wild-type fragment, one was observed at the lowest concentration of CcpA used (0.46 nM), and a slower moving band appeared at concentrations of 1.84 nM and higher. The CcpA binding affinity to the phoPRcre1 fragment (Fig. 3D) was lower than at the wild-type fragment, with binding first observed at 1.84 nM of CcpA, a concentration where the shift was nearly maximal for the wild-type promoter. The slower migrating DNA-protein complex observed with the wild-type promoter fragment at increasing CcpA concentrations was absent with the phoPRcre1 promoter fragment. These data indicated that CcpA directly binds to the phoPR promoter fragment-containing cre box consensus sequence and that a single base pair change (C to T) at a conserved site in the consensus sequence reduces the affinity for CcpA binding at either DNA-protein complex.

CcpA binds specifically to the phoPR promoter cre box. To determine the CcpA binding region in the phoPR promoter, DNase I footprinting assays were performed (Fig. 4). CcpA protected one distinct region on both the coding and noncoding strands of the phoPR promoter that encompassed the cre sequence on each strand. Protection began at 0.5 nM CcpA on both strands, albeit protection is more complete for the coding strand. Nearly complete protection of the region was observed at 2.3 nM of CcpA on both the strands. These data, in combination with the in vivo transcription studies, suggest that CcpA exerts its effect directly on the phoPR promoter through this cre box.


Figure 4
View larger version (55K):
[in this window]
[in a new window]
 
FIG. 4. DNase I footprinting of the phoPR promoter by CcpA. Labeled DNA fragments are the PCR products using primers FMH464 and FMH465, with pSB5 as the template. The CcpA concentration (nM) is shown at the top of each lane. F, free of CcpA; G, Maxam-Gilbert G-sequencing reaction lane as a marker. (A) Footprinting on the noncoding strand. End-labeled FMH465 was used to create the probe. (B) Footprinting on the coding strand. End-labeled FMH464 was used to create the probe. (C) Sequence showing the region protected by CcpA shown as a shaded area. The cre box sequence is underlined on both the coding and the noncoding sequence. * indicates the dotted G's on the marker lanes from A and B.

 
Either HPr or Crh functions in the transcriptional regulation of the phoPR promoter. To further examine the mechanism of CcpA regulation at the phoPR promoter, a role for the coeffectors of CcpA, HPr, and Crh (14), was investigated. In vivo transcription assays for the wild-type phoPR-lacZ fusion were performed in a ptsH1 (MH6033), crh mutant (MH6032) or ptsH1 crh double mutant (MH6034) background and compared with wild-type (MH6024) and ccpA (MH6025) strains in LPDM. ptsH1 is an allele of the ptsH gene that encodes the HPr protein with an S46A substitution (9).

The ß-galactosidase activity assays showed that neither the ptsH1 (MH6033) nor the crh mutation (MH6032) alone had an effect on the transcription of the phoPR promoter (Fig. 5) compared to the wild type (MH6024). When both the mutations were introduced into the same strain (MH6034), phoPR transcription was observed during the initial 6 h of growth in LPDM at a level roughly 50% that of the ccpA mutant strain. Transcription from the phoPR promoter in the double mutant was further elevated during hours 6 to 12 (Fig. 5) to levels identical to that seen in a ccpA mutant strain (MH6025). These observations suggest that either HPr or Crh was sufficient for CcpA repression activity because the absence of both of these proteins was required to relieve the catabolite repression from the phoPR promoter to a level similar to that of a ccpA mutant strain during phosphate starvation.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5. Effect of a ptsH1 or crh or ptsH1 crh double mutations on phoPR promoter expression. Solid symbols are growth and open symbols are ß-galactosidase specific activity of the phoPR-lacZ fusion in each strain. All the strains were grown in LPDM over a period of 12 h. Wild type (MH6024, {square}); ccpA Tn917 (MH6025, {circ}); ptsH1 (MH6033, {triangleup}); crh SpcR (MH6032, {triangledown}); ptsH1 crh Spcr (MH6034, {lozenge}).

 
Presence of poor carbon sources in the medium leads to higher expression from the phoPR promoter. When the carbon source for the wild-type strain growing in low-phosphate complex medium was changed from glucose to either succinate or lactate, both at 0.5%, the transcription level of the phoPR-lacZ promoter fusion increased compared to levels expressed during growth in the presence of glucose (Fig. 6). These levels were comparable to that of the ccpA mutant strain (MH6025) growing in glucose, consistent with involvement of carbon source-mediated regulation of phoPR operon transcription. LPCM was used for these studies because the wild-type strain was unable to grow in LPDM with low levels of a poor carbon source. Induction of pho regulon genes occurs at the same decreased Pi concentration in LPCM as in LPDM (47) but the maximum phoPR induction is routinely three- to fourfold lower than in LPDM.


Figure 6
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 6. Effect of alternate carbon sources on phoPR transcription. All strains were grown in LPCM for 11 h. Solid symbols represent growth and open symbols represent ß-galactosidase specific activity of the phoPR-lacZ fusion in each strain. Wild-type (MH6024) with glucose, {square}; ccpA (MH6025) with glucose, {circ}; wild type with lactate, {triangleup}; wild type with succinate, {triangledown}.

 
CcpA represses the expression of a previously unknown promoter in the complex phoPR promoter. Because the phoPR promoter contained five transcriptional start sites and each responded to specific growth phase and environmental controls (43), we performed primer extension to determine which of these promoters was directly regulated by CcpA. Primer extension using RNA from a ccpA mutant strain revealed the presence of an unknown 5' mRNA end, in addition to those reported previously for the phoPR promoter (Fig. 7). The expression of four start sites using RNA from a wild-type strain is shown in Fig. 7A (lanes 5 to 7) as a control. P5, which was first observed in RNA from a sigB mutant strain, is absent in the wild-type control experiment shown in Fig. 7A (lanes 5, 6, and 7), and had much weaker expression relative to the other four promoters in the ccpA mutant strain (lanes 8 to 14) compared to that reported for the sigB deletion strain (43).


Figure 7
View larger version (55K):
[in this window]
[in a new window]
 
FIG. 7. Primer extension analysis using RNA from a ccpA mutant strain shows appearance of a new 5' mRNA end in the phoPR promoter region. (A) Primer extension of the phoPR promoter. Lanes 1 to 4 are the sequencing ladder. Lanes 5 to 7 are the primer extension of RNA samples taken from a wild-type strain growing in LPDM at times T0, T2, and T3, respectively. T0 is the time of Pho induction and T2 and T3 are 2 and 3 h, respectively, after Pho induction. Lanes 8 to 14 are primer extension of RNA samples grown in LPDM at times between T3 and T4. The positions of all the promoter start sites are given by arrows labeled PB1, PE2, PA3, PA4, and P-5, and P6 identifies the mRNA5' ends. Primer FMH079 was used (Fig. A1). (B) Portion of the primer extension enlarged to show the position of PA6 on the phoPR promoter. RNA from a ccpA mutant strain at times T2 and T1 was used. Primer FMH811 (Fig. 1) was used for better resolution of the 5' mRNA location.

 
The unique 5' mRNA end observed in RNA from a ccpA mutant strain grown in LPDM (lanes 8 to 14) was upstream of all five promoters described above (Fig. 7A) and 15 bp upstream of the cre box (Fig. 7B and Fig. 1A). RNA samples for the ccpA mutant strain were taken 3 hours before (T3) Pho induction, at Pho induction (T0) and then each hour after induction (T1 through T4). RNA samples taken at T3 (Fig. 7A) showed the dramatic appearance of P6 which was located 81 bp upstream of P5 (Fig. 7B and Fig. 1). Although the P6 transcript persisted throughout growth, the relative intensity decreased after T2 (Fig. 7A). The absence of P6 in RNA isolated from a wild-type strain can be attributed to its repression due to the presence of active CcpA.

To further characterize this newly identified 5' mRNA end, in vitro transcription studies were conducted. RNAP purified from B. subtilis (43) grown in LPDM was used for in vitro transcription studies from the phoPR promoter template (shown in Fig. 1A). Core RNAP plus {sigma}A was sufficient for the expression of PA6 (Fig. 8A). Using RNAP holoenzyme isolated (T4) from a {Delta}sigE strain (a strain that retains {sigma}A RNAP, (25) also showed expression from PA6 (Fig. 8B, lane 1). When increasing amounts of CcpA were added to the in vitro transcription reaction (lanes 3 to 6), transcription from PA6 decreased, and at 1.5 µM of CcpA no transcript from PA6 was observed (Fig. 8B). These data confirmed that CcpA is functioning as a direct negative regulator of the phoPR promoter with the primary effect being exerted on a newly identified promoter, PA6. PhoP and PhoP~P did not enhance PA6 transcription in vitro (data not shown).


Figure 8
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 8. Core RNAP plus {sigma}A is sufficient for in vitro transcription of PA6. (A) In vitro transcription using core RNAP alone or core plus {sigma}A. Lane 1: marker; lane 2: in vitro transcription with core RNAP alone; lane 3: in vitro transcription with core and {sigma}A. (B) In vitro transcription of PA6 in the presence of CcpA. All reactions were done with RNAP holoenzyme (0.4 µM) isolated from a {Delta}sigE strain. Lane 1: marker; lanes 2 to 6: in vitro transcription reactions performed in the presence of increasing amounts of CcpA.

 
Elevated phoPR transcription in a CcpA mutant strain is PhoP independent during Pi-replete growth but cumulative during Pi starvation. In a wild-type strain PhoP~P is required for full induction of the phoPR operon during Pi limitation via enhanced transcription from the phoPR promoters PE2, PA3 and PA4 (43). In the PA6 promoter region PhoP, PhoP~P, and CcpA binding sites overlap (see Fig. 1) raising questions concerning a role for PhoP or Pho~P in derepression in a ccpA mutant strain. To determine if PhoP was required for the ccpA transcription phenotype, the following strains were used. A phoPR deletion strain containing the phoPR-lacZ fusion with (MH6070) or without a ccpA (MH6069) mutation was grown in LPDM and HPDM along with wild-type (MH6024) and ccpA (MH6025) strains containing the phoPR-lacZ fusion. The transcription level of phoPR-lacZ in the phoPR mutant strain grown in HPDM was very low and is similar to levels observed in a wild-type strain (Fig. 3B and Fig. 9A). However, a phoPR ccpA double mutant (MH6070) exhibited high transcription levels that were similar to transcription levels observed in a ccpA mutant strain (MH6025) (Fig. 9A). The similarity between phoPR-lacZ transcription in MH6025 (ccpA) and MH6070 (phoPR ccpA) grown in HPDM suggested that the elevated levels of phoPR transcription were independent of PhoP and resulted from derepression in the ccpA mutant.


Figure 9
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 9. Absence of PhoP-PhoR in phoPR ccpA double mutant affects phoPR transcription specifically during phosphate-limited growth. (A) HPDM. (B) LPDM. Solid symbols represent growth and open symbols represent ß-galactosidase specific activity of the phoPR-lacZ fusion in each strain. Wild-type (MH6024), {square}; ccpA (MH6025), {circ}; phoPR (MH6069), {triangleup}; phoPR ccpA (MH6070), {triangledown}.

 
When grown in LPDM (Fig. 9B), low-level phoPR-lacZ transcription was observed in the phoPR mutant strain (MH6069) throughout growth, as expected due to the absence of autoinduction. Compared to the wild-type strain during exponential growth (hours 0 to 5), a phoPR ccpA double mutant exhibited derepressed phoPR transcription that was similar to that in a ccpA mutant strain. During phosphate-limited growth (hours 6 to 12) transcription from the phoPR-lacZ fusion decreased in the phoPR ccpA double mutant strain but not in the ccpA single mutant strain. The reduction of total phoPR-lacZ transcription in the phoPR ccpA double mutant strain, compared to the ccpA mutant strain, during stationary-phase growth is approximately equal to the increase in transcription in the wild-type strain due to phoPR-dependent autoinduction (43).

Together, these data suggested that during stationary-phase growth provoked by phosphate starvation (hours 6 to 12), phoPR transcription in the ccpA mutant strain is cumulative, due to both derepression of the CcpA repressed promoter and PhoPR autoinduction of the PA3, PA4 and PE2 promoters. These data were consistent with the in vitro transcription data which showed that PA6 expression was independent of PhoP (data not shown).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Carbon catabolite regulation of phoPR expression involves CcpA repression of PA6, the newly discovered promoter located most 5' among the six phoPR promoters. The importance of Pho regulon gene expression to survival of B. subtilis under phosphate stress was underscored when a basic understanding of the complexity of the phoPR regulatory region was recently reported (43). Assurance of the availability of phoPR expression was provided during vegetative growth from two promoters, PA3 and PA4, and during stage two of sporulation from PE2. These three promoters provide maintenance-level expression during phosphate-replete conditions but each of these three promoters is enhanced by PhoP~P during phosphate starvation.

Two additional promoters revealed a portion of the interdependent regulation of the SigB and PhoPR regulons during phosphate starvation. One was a SigB-dependent phoPR promoter, P1B. The other promoter, P5, was expressed only in a sigB mutant when the phosphate starvation-induced SigB regulon is not available. Knowledge of the basic architecture of the phoPR promoter made possible initiation of the studies reported here to determine if and how carbon regulation might affect the promoters of this complex phoPR regulatory region.

This study promised to be interesting because the 100% conserved cre sequence in the phoPR promoter region physically maps upstream of the previously identified five phoPR promoters (43), a position usually reserved for CcpA binding to activated promoters (41, 46). Contrary to this idea, our initial studies of phoPR expression in a ccpA mutant suggested that CcpA was a repressor (4) and that result was corroborated by the transcriptome studies of Stulke and colleagues (6). The quandary was resolved when primer extension analysis of the phoPR promoter using mRNA from a ccpA mutant identified a sixth 5' mRNA end (Fig. 7A) positioned upstream of the cre consensus sequence and all five of the promoters identified previously. Because E{sigma}A initiated transcription at this 5' start site in vitro, we now refer to it as the PA6 transcription start site of the phoPR promoter. The identification of a carbon catabolite regulation phoPR promoter expands the possible importance of Pho regulon gene expression to include survival during carbon nutrient stress.

Relief of CcpA repression of phoPR transcription in a crh ptsH1 double mutant differs during phosphate-sufficient growth and phosphate starvation. Binding of CcpA to a cre site in vivo usually requires complex formation between CcpA and the seryl-phosphorylated forms of the coeffector HPr or Crh. Gel shift and DNA protection studies indicated that CcpA alone binds efficiently to the phoPR promoter in vitro. A Kd of {approx}0.5 nM was calculated for CcpA binding to the phoPR cre site from the footprint data (data not shown) using the procedure described by Kim et. al (28). This Kd was lower than for those calculated for CcpA binding at other cre sites, including ccpC (12 nM) (26), amyE (28 nM), gnt (100 nM), and xyl (330 nM) (29). Other cre sites that bind CcpA without coeffectors but for which no Kd was reported include the cre2 site of ackA (41) and the cre site of rocG (3).

The fact the in vitro CcpA-DNA interaction did not require the presence of Hpr phosphorylated on serine (Hpr-Ser-P) or Crh-Ser-P does not diminish the importance of Hpr and Crh in vivo. Either coeffector was sufficient for full in vivo repression of phoPR by CcpA because a single mutation in ptsH (HPr) or crh was not sufficient to relieve the CcpA-mediated repression of phoPR transcription, but a double mutant strain exhibited derepressed transcription levels comparable to that observed in a ccpA mutant strain during phosphate limited growth. A similar discrepancy between in vivo and in vitro data concerning the role of Crh and Hpr has been noted at another promoter with a highly conserved cre site, the rocG promoter (3).

Interestingly, repression of phoPR transcription during Pi-replete exponential growth (hours 1 to 5, Fig. 5) was less relieved in the ptsH crh double mutant than in a ccpA mutant. Because CcpA is present in the double mutant, the partial relief of repression may indicate an affinity of the uncomplexed CcpA for the cre site in the promoter or enhancement of CcpA binding by a yet unknown effector(s) or metabolic factor(s) other than HPr and Crh. However, the absence of CcpA repression in the ptsH crh double mutant during phosphate-limiting growth, but not during phosphate-replete growth, suggests that the latter condition may provide another factor(s) that promotes CcpA binding to the phoPR cre site. Such a factor(s) would provide an additional level of protection to assure that phoPR transcription remains low in the presence of adequate levels of environmental phosphate. The identified cre site is implicated in this repression because in the wild-type strain the cre1 mutation was sufficient to restore expression to the level exhibited by a ccpA mutant strain despite the presence of CcpA.

Media composition has been shown to affect the mechanism of carbon catabolite regulation at other promoters. In minimal media carbon catabolite regulation of the hut operon by glucose was relieved only in a crh ptsH1 double mutant but during growth in LB mutation in ptsH1 (Hpr) was sufficient to relieve glucose repression (62). Also, complete relief of repression of citM was observed in a crh ptsH1 double mutant grown in CSE medium (C medium plus Succinate and Glutamate) but only partial relief occurred in CI medium (C medium plus myo-Inositol), leading to the proposal that other metabolic intermediates promote CcpA binding to the cre site in CI medium (58).

The proposed coeffector required for only partial repression of phoPR expression by CcpA during Pi-replete growth of a crh ptsH double mutant (Fig. 5) remains unknown. In addition to Crh and Hpr, other effectors of CcpA have been identified, including fructose-1,6-diphosphate (12), glucose-6-phosphate (16), and NADP (28). Unlike other effectors, including Hpr and Crh, NADP had little effect on CcpA DNA binding but rather increased CcpA's ability to inhibit transcription in vitro, possibly via enhanced interaction with the transcription machinery (28).

NADP may be an attractive candidate for the hypothetical CcpA coeffector active during Pi-replete exponential growth in a crh ptsH double mutant (Fig. 5) for several reasons. (i) CcpA without cofactors binds efficiently to the phoPR promoter cre site (Kd {approx} 0.5 nM) but required more than 1 µM CcpA to inhibit PA6 transcription in vitro in the absence of coeffectors. (ii) Hpr was shown to antagonize the CcpA mediated transcription inhibition caused by NADP in vitro (28). (iii) NADP was most abundant during exponential growth in a minimal glucose medium (similar to our growth conditions) in a related Bacillus species (52).

Single point mutation in the cre site completely relieves CcpA-mediated repression of phoPR expression in vivo and significantly reduces binding in vitro. The footprinting analysis showed a single protected region on the phoPR promoter that encompasses the cre consensus sequence region. Because a single base pair change in the cre consensus (cre1) caused elevated phoPR transcription levels similar to that observed in a ccpA deletion strain, it can be argued that this cre sequence is the site of CcpA regulation. The appearance of a second complex (Fig. 3C) observed in the EMSA at increasing concentrations of CcpA suggested the formation of an additional DNA-protein complex or multimerization of protein as CcpA concentrations were increased.

The phoPR promoter fragment containing the cre1 mutation required higher concentrations of CcpA than the wild-type probe to form the faster-moving complex, while the slower-migrating complex failed to form. These data suggest that formation of both complexes require the proposed cre site and that a certain concentration of the smaller complex is required before the larger complex is formed. A second cre box mutation (data not shown) that caused only partial derepression of phoPR transcription in vivo allowed the formation of both complexes at CcpA concentrations intermediate between that required for the nonmutated and the cre1 probe in EMSA studies. Although the nature of the CcpA-DNA complexes formed is not yet clear, the EMSA data, together with the footprinting on the complete promoter, suggest that there is a single CcpA binding site in the phoPR promoter and that it is at the cre consensus shown in Fig. 1A.

PA6, one of three phoPR operon {sigma}A-responsive promoters, may require an unknown activator during exponential growth. E{sigma}A was sufficient for transcription from the 5' start site and we now refer to it as the PA6 promoter. However, it appears that PA6 may require an additional activator protein for full promoter activity because the relative abundance of the PA6 transcript compared to PA4 in vivo is much higher than in the in vitro studies. That activator does not appear to be PhoP~P because (i) addition of PhoP or PhoP~P did not increase PA6 transcription in vitro in the presence or absence of CcpA (data not shown), (ii) the PA6 transcript was most abundant in vivo at T3 (Fig. 7), 3 hours before Pho induction, and (iii) a phoPR deletion mutation did not affect derepression of phoPR transcription in a ccpA mutant strain during phosphate-replete growth while the decrease observed upon phosphate starvation was roughly equal to the autoinduction of phoPR via PA3, PA4 and PE2 in the wild-type strain (43). The last observation indicates that during phosphate starvation ccpA derepression and autoinduction of phoPR transcription are additive in a ccpA-defective strain.

The other {sigma}A-dependent promoters for this operon, PA3 and PA4, are also expressed during exponential growth although at low levels, and are responsible for the low-level constitutive transcription from the phoPR promoter before autoinduction in a wild-type strain (43, 45) but unlike PA3 and PA4, PA6 expression is not enhanced by PhoP~P upon phosphate starvation. Several hours after cultures enter the stationary phase, E{sigma} E displaces E{sigma}A from RNAP (24, 32), which results in decreased transcription from the E{sigma}A promoters and increased transcription from PE2, which is an E{sigma}E promoter. A post-exponential-phase decrease in PA3 and PA4 transcripts in a wild-type strain was reported by Paul et al. (43) in LPDM-grown cultures where stationary phase is provoked by phosphate starvation, conditions where a sigE mutant strain showed prolonged transcription from PA3 and PA4. PA6 showed a similar decrease in transcription levels during the postexponential phase (Fig. 7) in a wild-type stain.

Regulatory coordination between phosphate and carbon deficiency responses. PA6 is the second phoPR promoter identified that was not expressed in a wild-type strain under standard low-phosphate culture conditions. In this case carbon starvation or the presence of a poor carbon source was required for PA6 expression because in the presence of a readily metabolized carbon source, CcpA repressed PA6. When additional PhoP-PhoR is not required, repression of PA6 by CcpA is not only energy efficient, it also avoids placing the cells at a selective disadvantage as has been observed when cellular concentrations of PhoP were increased inappropriately by expression from multicopy plasmids (34, 42) or in spo0 mutants (23). The poor growth phenotype and/or rapid accumulation of spontaneous phoP or phoR mutations in cells overexpressing phoPR or phoP may be the result of inappropriate gene activation or inhibition by higher concentrations of PhoP or PhoP~P, respectively, as observed in vitro (1).

Because PhoPR are part of a signal transduction network including ResDE, Spo0A, and now CcpA, interdependent regulation of these systems is a reasonable requirement. We are now beginning to understand the codependency between the Pho and Res systems during phosphate-limited growth, where phoPR is essential for resABCDE transcription exclusively during phosphate starvation (5) and terminal oxidase production by ResD is essential for full Pho induction via modulation of the PhoR signal (50).

The data presented here provide evidence for the direct role of CcpA in regulation of phoPR transcription via PA6, thus establishing a link between carbon regulation and phosphate starvation regulation, two important yet different signaling systems interconnected for cell survival under nutrient deprivation conditions. Although the physiological significance of these findings is still under investigation, recent reports provide clues concerning the interdependence of carbon and phosphate regulation. CcpA is known to repress the transcription of genes required for utilization of secondary carbon sources and activate genes involved in carbon excretion via acetate (pta and ackA) or acetoin (alsSD) in the presence of a readily metabolized carbon source. CcpA also has a direct and indirect role via repression of ccpC in regulation of TCA cycle genes (27).

It was proposed (8, 53) that CcpA-activated transcription of genes required for acetate or acetoin excretion (pta, ackA, and alsSD) (41, 46, 56) contributed to extensive overflow metabolism that resulted in low Kreb's cycle carbon flux in Pi-limited cultures relative to that of carbon- or nitrogen-limited cultures which had high Kreb's cycle flux and low overflow metabolism. During Pi starvation it was shown that terminal oxidases were required for full Pho induction (50) and that the cellular concentration of ResD is dependent on PhoPR exclusively during phosphate starvation (5). ResD is the response regulator required for heme a biosynthesis necessary for a-type terminal oxidases (35, 44, 54, 63) and for activation of the operon encoding bd oxidase (Schau and Hulett, unpublished data). Further, the structural genes for caa3 (35, 61) and bd oxidase (Schau and Hulett, unpublished data) are repressed by CcpA. Together these observations suggest that simultaneous starvation for carbon and phosphate may result in several metabolic changes that could all be accommodated by silencing CcpA activation (overflow metabolism) and repression (terminal oxidases and phoPR) of genes. Decreased overflow metabolism as a result of carbon limitation should increase the availability of pyruvate and acetyl coenzyme A for increased carbon flux into the Kreb's cycle that would contribute to increased reducing power that would require additional terminal oxidase synthesis for ATP synthesis. Removal of CcpA repression of phoPR transcription would ensure the presence of PhoPR for synthesis of ResD necessary for terminal oxidase production for more efficient use of the available carbon and phosphate sources.

The two cartoons in Fig. 10 illustrate our current understanding of the PhoPR, ResDE, carbon catabolite regulation-integrated signal transduction network in a wild-type strain provided glucose or a poor carbon source.


Figure 10
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 10. Model for the coordinated regulation of B. subtilis Pho, Res, and carbon catabolite regulation responses during Pi-starved growth conditions. Solid lines represent a direct role in transcriptional activation (with arrowheads) or repression (with flat heads). The activated and repressed genes are indicated above lines. Dashed lines indicate the indirect role of ResD (via terminal oxidases) in full Pho activation. (A) Phosphate starvation in the presence of 2% glucose. Relatively low concentrations of active PhoPR and ResDE proteins activate the transcription of the resABC/DE operon to provide sufficient active ResDE to induce genes required for terminal oxidase synthesis (OX). Terminal oxidases oxidize the reduced quinones (QH2), an inhibitor of PhoR autophosphorylation activity (50). Three CcpA-activated genes, phosphotransacetylase (pta), acetate kinase (ackA), and acetoin biosynthesis operon (alsSD), that are involved in the carbon overflow metabolism provide the primary dissipating flux of ATP equivalents and contribute to low carbon flux through the TCA cycle during phosphate starvation. Direct and indirect repression of certain TCA genes by CcpA may contribute further to low carbon flux through the TCA cycle. Thus, CcpA provides a fine-tuning mechanism for terminal oxidase synthesis via direct repression of the phoPR PA6 promoter to provide sufficiently active terminal oxidases to accommodate the low flux of reducing equivalents. Balance refers to balancing total cellular energy flux based on conversion of energy and energy equivalents (8). (B) Phosphate and carbon starvation in the absence or presence of poorly metabolized C sources. CcpA no longer activates the carbon overflow metabolism, leading to higher carbon flow through the TCA cycle. In order to accommodate the increased reducing equivalents produced from the TCA cycle, the CcpA-mediated repression of the PhoPR-ResDE positive feedback loop involving terminal oxidase synthesis is released. The line thickness in B depicts the increased activities caused by CcpA inactivation compared to that in A, when CcpA is active.

 


    ACKNOWLEDGMENTS
 
We thank Tina Henkin, Jörg Stülke, Michiko Nakano, and Susan Fisher for the strains. We thank W. Abdel-Fattah for proteins for in vitro transcription studies and for helpful discussions.

This work was supported by Public Health Service grant GM 33471 from the National Institutes of Health.


    FOOTNOTES
 
* Corresponding author. Mailing address: Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, 900 S. Ashland Ave. (M/C 567), Chicago, IL 60607. Phone: (312) 996-2280. Fax: (312) 413-2691. E-mail: Hulett{at}uic.edu. Back

{dagger} Present address: Department of Medicine, Section of Hematology-Oncology, University of Chicago, Chicago, Ill. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abdel-Fattah, W. R., Y. Chen, A. Eldakak, and F. M. Hulett. 2005. Bacillus subtilis phosphorylated PhoP: direct activation of the E{sigma}A and repression of the E{sigma}E-responsive phoB PS+V promoters during Pho response. J. Bacteriol. 187:5166-5178.[CrossRef][Medline]
  2. Atkinson, M. R., L. V. Wray, Jr., and S. H. Fisher. 1990. Regulation of histidine and proline degradation enzymes by amino acid availability in Bacillus subtilis. J. Bacteriol. 172:4758-4765.[Abstract/Free Full Text]
  3. Belitsky, B. R., H. J. Kim, and A. L. Sonenshein. 2004. CcpA-dependent regulation of Bacillus subtilis glutamate dehydrogenase gene expression. J. Bacteriol. 186:3392-3398.[Abstract/Free Full Text]
  4. Birkey, S. M. 1998. Regulation of the phoPR operon of Bacillus subtilis during phosphate starvation and sporulation. Ph.D. thesis. University of Illinois at Chicago, Chicago, Ill.
  5. Birkey, S. M., W. Liu, X. Zhang, M. F. Duggan, and F. M. Hulett. 1998. Pho signal transduction network reveals direct transcriptional regulation of one two-component system by another two-component regulator: Bacillus subtilis PhoP directly regulates production of ResD. Mol. Microbiol. 30:943-953.[CrossRef][Medline]
  6. Blencke, H. M., G. Homuth, H. Ludwig, U. Mader, M. Hecker, and J. Stulke. 2003. Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab. Eng. 5:133-149.[CrossRef][Medline]
  7. Chesnut, R. S., C. Bookstein, and F. M. Hulett. 1991. Separate promoters direct expression of phoAIII, a member of the Bacillus subtilis alkaline phosphatase multigene family, during phosphate starvation and sporulation. Mol. Microbiol. 5:2181-2190.[Medline]
  8. Dauner, M., T. Storni, and U. Sauer. 2001. Bacillus subtilis metabolism and energetics in carbon-limited and excess-carbon chemostat culture. J. Bacteriol. 183:7308-7317.[Abstract/Free Full Text]
  9. Deutscher, J., J. Reizer, C. Fischer, A. Galinier, M. H. Saier, Jr., and M. Steinmetz. 1994. Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis. J. Bacteriol. 176:3336-3344.[Abstract/Free Full Text]
  10. Ferrari, E., S. M. Howard, and J. A. Hoch. 1986. Effect of stage 0 sporulation mutations on subtilisin expression. J. Bacteriol. 166:173-179.[Abstract/Free Full Text]
  11. Fujita, Y., and Y. Miwa. 1994. Catabolite repression of the Bacillus subtilis gnt operon mediated by the CcpA protein. J. Bacteriol. 176:511-513.[Abstract/Free Full Text]
  12. Fujita, Y., Y. Miwa, A. Galinier, and J. Deutscher. 1995. Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr. Mol. Microbiol. 17:953-960.[CrossRef][Medline]
  13. Galinier, A., J. Deutscher, and I. Martin-Verstraete. 1999. Phosphorylation of either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn operon. J. Mol. Biol. 286:307-314.[CrossRef][Medline]
  14. Galinier, A., J. Haiech, M. C. Kilhoffer, M. Jaquinod, J. Stulke, J. Deutscher, and I. Martin-Verstraete. 1997. The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proc. Natl. Acad. Sci. USA 94:8439-8444.[Abstract/Free Full Text]
  15. Galinier, A., M. Kravanja, R. Engelmann, W. Hengstenberg, M. C. Kilhoffer, J. Deutscher, and J. Haiech. 1998. New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression. Proc. Natl. Acad. Sci. USA 95:1823-1828.[Abstract/Free Full Text]
  16. Gosseringer, R., E. Kuster, A. Galinier, J. Deutscher, and W. Hillen. 1997. Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals. J. Mol. Biol. 266:665-676.[CrossRef][Medline]
  17. Grundy, F. J., A. J. Turinsky, and T. M. Henkin. 1994. Catabolite regulation of Bacillus subtilis acetate and acetoin utilization genes by CcpA. J. Bacteriol. 176:4527-4533.[Abstract/Free Full Text]
  18. Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacl and galR repressors. Mol. Microbiol. 5:575-584.[CrossRef][Medline]
  19. Hueck, C., A. Kraus, and W. Hillen. 1994. Sequences of ccpA and two downstream Bacillus megaterium genes with homology to the motAB operon from Bacillus subtilis. Gene 143:147-148.[CrossRef][Medline]
  20. Hueck, C. J., W. Hillen, and M. H. Saier, Jr. 1994. Analysis of a cis-active sequence mediating catabolite repression in gram-positive bacteria. Res. Microbiol. 145:503-518.[Medline]
  21. Hulett, F. M. 2002. The Pho regulon, p. 193-202. In A. L. Sonenshein, J. A. Hoch and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, D.C.
  22. Hulett, F. M., C. Bookstein, and K. Jensen. 1990. Evidence for two structural genes for alkaline phosphatase in Bacillus subtilis. J. Bacteriol. 172:735-740.[Abstract/Free Full Text]
  23. Jensen, K. K., E. Sharkova, M. F. Duggan, Y. Qi, A. Koide, J. A. Hoch, and F. M. Hulett. 1993. Bacillus subtilis transcription regulator, Spo0A, decreases alkaline phosphatase levels induced by phosphate starvation. J. Bacteriol. 175:3749-3756.[Abstract/Free Full Text]
  24. Ju, J., T. Mitchell, H. Peters 3rd, and W. G. Haldenwang. 1999. Sigma factor displacement from RNA polymerase during Bacillus subtilis sporulation. J. Bacteriol. 181:4969-4977.[Abstract/Free Full Text]
  25. Kenney, T. J., and C. P. Moran, Jr. 1987. Organization and regulation of an operon that encodes a sporulation-essential sigma factor in Bacillus subtilis. J. Bacteriol. 169:3329-3339.[Abstract/Free Full Text]
  26. Kim, H. J., C. Jourlin-Castelli, S. I. Kim, and A. L. Sonenshein. 2002. Regulation of the Bacillus subtilis ccpC gene by CcpA and CcpC. Mol. Microbiol. 43:399-410.[CrossRef][Medline]
  27. Kim, H. J., A. Roux, and A. L. Sonenshein. 2002. Direct and indirect roles of CcpA in regulation of Bacillus subtilis Krebs cycle genes. Mol. Microbiol. 45:179-190.[CrossRef][Medline]
  28. Kim, J. H., M. I. Voskuil, and G. H. Chambliss. 1998. NADP, corepressor for the Bacillus catabolite control protein CcpA. Proc. Natl. Acad. Sci. USA 95:9590-9595.[Abstract/Free Full Text]
  29. Kim, J. H., Y. K. Yang, and G. H. Chambliss. 2005. Evidence that Bacillus catabolite control protein CcpA interacts with RNA polymerase to inhibit transcription. Mol. Microbiol. 56:155-162.[CrossRef][Medline]
  30. Kraus, A., C. Hueck, D. Gartner, and W. Hillen. 1994. Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts additional xylR-dependent repression. J. Bacteriol. 176:1738-1745.[Abstract/Free Full Text]
  31. Kravanja, M., R. Engelmann, V. Dossonnet, M. Bluggel, H. E. Meyer, R. Frank, A. Galinier, J. Deutscher, N. Schnell, and W. Hengstenberg. 1999. The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase. Mol. Microbiol. 31:59-66.[CrossRef][Medline]
  32. Kroos, L., and Y. T. Yu. 2000. Regulation of sigma factor activity during Bacillus subtilis development. Curr. Opin. Microbiol. 3:553-560.[CrossRef][Medline]
  33. Lee, J. W., and F. M. Hulett. 1992. Nucleotide sequence of the phoP gene encoding PhoP, the response regulator of the phosphate regulon of Bacillus subtilis. Nucleic Acids Res. 20:5848.[Free Full Text]
  34. Liu, W. 1997. Biochemical and genetic analysis establish a dual role for PhoP in Bacillus subtilis Pho regulation. Ph.D. thesis. University of Illinois at Chicago, Chicago, Ill.
  35. Liu, X., and H. W. Taber. 1998. Catabolite regulation of the Bacillus subtilis ctaBCDEF gene cluster. J. Bacteriol. 180:6154-6163.[Abstract/Free Full Text]
  36. Ludwig, H., C. Meinken, A. Matin, and J. Stulke. 2002. Insufficient expression of the ilv-leu operon encoding enzymes of branched-chain amino acid biosynthesis limits growth of a Bacillus subtilis ccpA mutant. J. Bacteriol. 184:5174-5178.[Abstract/Free Full Text]
  37. Ludwig, H., N. Rebhan, H. M. Blencke, M. Merzbacher, and J. Stulke. 2002. Control of the glycolytic gapA operon by the catabolite control protein A in Bacillus subtilis: a novel mechanism of CcpA-mediated regulation. Mol. Microbiol. 45:543-553.[CrossRef][Medline]
  38. Martin-Verstraete, I., J. Deutscher, and A. Galinier. 1999. Phosphorylation of HPr and Crh by HprK, early steps in the catabolite repression signaling pathway for the Bacillus subtilis levanase operon. J. Bacteriol. 181:2966-2969.[Abstract/Free Full Text]
  39. Martin-Verstraete, I., J. Stulke, A. Klier, and G. Rapoport. 1995. Two different mechanisms mediate catabolite repression of the Bacillus subtilis levanase operon. J. Bacteriol. 177:6919-6927.[Abstract/Free Full Text]
  40. Miwa, Y., K. Nagura, S. Eguchi, H. Fukuda, J. Deutscher, and Y. Fujita. 1997. Catabolite repression of the Bacillus subtilis gnt operon exerted by two catabolite-responsive elements. Mol. Microbiol. 23:1203-1213.[CrossRef][Medline]
  41. Moir-Blais, T. R., F. J. Grundy, and T. M. Henkin. 2001. Transcriptional activation of the Bacillus subtilis ackA promoter requires sequences upstream of the CcpA binding site. J. Bacteriol. 183:2389-2393.[Abstract/Free Full Text]
  42. Ogura, M., H. Yamaguchi, K. Yoshida, Y. Fujita, and T. Tanaka. 2001. DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an approach to comprehensive analysis of B. subtilis two-component regulatory systems. Nucleic Acids Res. 29:3804-3813.[Abstract/Free Full Text]
  43. Paul, S., S. Birkey, W. Liu, and F. M. Hulett. 2004. Autoinduction of Bacillus subtilis phoPR operon transcription results from enhanced transcription from E{sigma}A- and EsE-responsive promoters by phosphorylated PhoP. J. Bacteriol. 186:4262-4275.[Abstract/Free Full Text]
  44. Paul, S., X. Zhang, and F. M. Hulett. 2001. Two ResD-controlled promoters regulate ctaA expression in Bacillus subtilis. J. Bacteriol. 183:3237-3246.[Abstract/Free Full Text]
  45. Pragai, Z., N. E. Allenby, N. O'Connor, S. Dubrac, G. Rapoport, T. Msadek, and C. R. Harwood. 2004. Transcriptional regulation of the phoPR operon in Bacillus subtilis. J. Bacteriol. 186:1182-1190.[Abstract/Free Full Text]
  46. Presecan-Siedel, E., A. Galinier, R. Longin, J. Deutscher, A. Danchin, P. Glaser, and I. Martin-Verstraete. 1999. Catabolite regulation of the pta gene as part of carbon flow pathways in Bacillus subtilis. J. Bacteriol. 181:6889-6897.[Abstract/Free Full Text]
  47. Qi, Y. 1998. Identification and regulation of new Pho regulon genes in Bacillus subtilis. Ph.D. thesis. University of Illinois at Chicago, Chicago, Ill.
  48. Qi, Y., Y. Kobayashi, and F. M. Hulett. 1997. The pst operon of Bacillus subtilis has a phosphate-regulated promoter and is involved in phosphate transport but not in regulation of the pho regulon. J. Bacteriol. 179:2534-2539.[Abstract/Free Full Text]
  49. Reizer, J., C. Hoischen, F. Titgemeyer, C. Rivolta, R. Rabus, J. Stulke, D. Karamata, M. H. Saier, Jr., and W. Hillen. 1998. A novel protein kinase that controls carbon catabolite repression in bacteria. Mol. Microbiol. 27:1157-1169.[CrossRef][Medline]
  50. Schau, M., A. Eldakak, and F. M. Hulett. 2004. Terminal oxidases are essential to bypass the requirement for Res