Previous Article | Next Article ![]()
Journal of Bacteriology, February 2006, p. 1301-1309, Vol. 188, No. 4
0021-9193/06/$08.00+0 doi:10.1128/JB.188.4.1301-1309.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Immunology,1 Program in Bioinformatics, University of Michigan Medical School, Ann Arbor, Michigan 481042
Received 17 October 2005/ Accepted 23 November 2005
|
|
|---|
|
|
|---|
While teichoic acids or similarly functioning structures are thought to be essential for life in gram-positive bacteria (34), they also serve as powerful attractants for cationic antibacterial compounds, including those central to the innate immune systems of higher organisms, by significantly contributing to the overall negative charge of the bacterial cell wall (22). As an effective means of counteracting this potential threat, bacteria can adjust the net negative charge of these polymers by covalent addition of cationic molecules, most often D-alanine (34). Such modifications are known to be important for the interactions between both pathogenic and probiotic bacteria and their animal hosts (1, 3, 10, 19, 25).
For many gram-positive bacteria, the addition of D-alanine esters to teichoic acids is catalyzed by four protein products encoded by the dltABCD operon. The dltA gene of this operon encodes a D-alanine:D-alanyl carrier protein ligase (Dcl) that covalently attaches D-alanine to the 4' phosphopantetheine prosthetic group present on the D-alanyl carrier protein (Dcp), encoded by dltC. The dltB and dltD gene products are also required for the synthesis of D-alanyl teichoic acids. The former is believed to be a transmembrane channel involved in transport of D-alanyl Dcp to the extracellular space, while the latter serves as a chaperone ensuring the fidelity of D-alanine ligation to Dcp among the cellular pool of possible carrier proteins containing similar prosthetic groups. After transport, no additional proteins are required, and D-alanyl Dcp is thought to associate with LTA, wall-associated teichoic acid, or potentially other surface structures to form a "thioesterase-like" enzyme mimic. Loss of function in any one of the four dltABCD gene products is sufficient to terminate the entire pathway and loss of D-alanine modifications (22).
In the pathogenic bacteria Staphylococcus aureus and Listeria monocytogenes, lack of D-alanyl teichoic acids has been linked to a decrease in virulence (1, 3). Bacillus anthracis is a gram-positive bacterium that causes anthrax after the endospore morphotype enters into a host through ingestion, inhalation, or contact with a cutaneous lesion. Most mammals, including humans, are considered susceptible to anthrax. Systemic disease, characterized by massive septicemia and toxemia, is often highly fatal even if treated. Due, at least in part, to the robust resistance properties of the dormant endospore, B. anthracis remains a viable threat as an agent of biological terrorism. Endospores, not vegetative bacilli, are considered the contagion (6).
The switch from dormant endospore to virulent, rapidly dividing bacilli represents an important early establishment stage in the anthrax infectious cycle (6, 7, 11). The initial events, breaking of endospore dormancy and start of metabolic functions, are termed germination and outgrowth and occur rapidly after spore association with host phagocytes, or potentially, within certain bodily fluids (5). These processes remain incompletely defined at nearly all molecular levels but entail, among other events, dramatic changes in the bacterial cell surface as the structural and chemical compositions of the surfaces differ greatly between endospore and bacillus morphotypes (2, 7, 26, 31). While the cell surface of the endospore contributes greatly to its resistance properties in the environment (6, 7), this surface is deconstructed and replaced by vegetative cell-specific structures during germination and outgrowth (26, 31).
The overall goal of this work is to gain an understanding of this process and, specifically, to judge its importance to the bacillus's success in survival and growth within the host. Although direct evidence for the presence of teichoic acids is lacking for B. anthracis (20), this study uses temperature-dependent plasmid insertion mutagenesis (9) to show that the enzymes encoded within the dltABCD operon are expressed during endospore outgrowth and control the presence of cell wall-associated, ester-linked D-alanine. Additionally, this operon was found to be critical for resistance to peptide, enzymatic, and cellular mediators of innate immunity as well as virulence in a murine model of inhalation anthrax.
|
|
|---|
Disruption of dltABCD by pNFd13. A 0.572-kilobase fragment (from positions 22 to 552 with respect to the transcriptional start site of dltA) of the 5' region of dltABCD, termed dltA', was amplified from B. anthracis chromosomal DNA using the primers attB1, CGAATTTTAGGGTGGGAACGTTATGAAG and attB2-GCCCTGTTTGTAAGTTGAAGTCTTCTACAGCCC where attB1 and attB2 are modified recombinase recognition sequences that allow entry into the Gateway cloning system (Invitrogen). The resulting amplicon was transferred first to pDONRtet (9), then to pNFd13 (9), which was integrated into the B. anthracis chromosome at the dltABCD locus as described (9) (Fig. 1). Integration into the chromosome occurs randomly by homologous recombination between the plasmid born dltA' sequence and that on the chromosome.
![]() View larger version (9K): [in a new window] |
FIG. 1. Integration of pNFd13 into the dltABCD locus for construction of the DLTd mutant strain. A 500-base-pair fragment, including the Shine-Dalgarno sequence and a truncated 5' region of dltA, was inserted into pNFd13 via gateway cloning. The resulting plasmid was transferred to B. anthracis where the temperature-sensitive gram-positive origin of replication allows efficient transformation and recovery of kanamycin-resistant clones at 30°C. Subsequent transfer to the nonpermissive temperature of 39°C, with continued kanamycin selection, allows isolation of clones in which pNFd13 has inserted into the chromosome via homologous recombination with the 5' region of dltA. The resulting chromosomal structure of the DLTd mutant was verified and monitored extensively. Integration of pNFd13 into the targeted locus results in (i) Pdlt being separated from the coding region of operon, (ii) a lacZ reporter gene, encoding ß-galactosidase, placed downstream of Pdlt for determination of promoter expression levels, and (iii) the intact coding regions of dltABCD placed under the control of the inducible Pspac promoter, allowing complementation studies without further genetic manipulation (9).
|
ß-Galactosidase assays. An enzymatic reporter system was used to monitor dltABCD transcriptional expression throughout logarithmic growth, stationary phase, and sporulation. Four ml of a culture grown to stationary phase in BHI broth was added to 100 ml fresh BHI or modified G medium and incubated at 39°C with vigorous aeration. Since the mutant grew poorly in this medium, 4 mM IPTG was added to the culture at the time of inoculation in order to restore growth to parental levels. This treatment had no detectable effect on sporulation efficiency. At 30-min intervals throughout growth, the optical density at 600 nm (OD600) was recorded and cells were collected by centrifugation from a 1-ml aliquot and stored at 80°C until analysis.
For expression analysis during outgrowth, endospores were heat activated by incubation at 65°C for 20 min in deionized, distilled water. After cooling to room temperature, endospores were suspended to an optical density at 600 nm of 1.0 in 1 ml of BHI broth. Samples were incubated at 37°C for either 30 min or 1 h, after which the cells were collected by centrifugation and stored at 80°C. In order to differentiate between de novo ß-galactosidase production during outgrowth and ß-galactosidase associated with dormant endospores, 200 µg/ml chloramphenicol was added to parallel samples to prevent nascent protein synthesis during outgrowth.
For analysis of ß-galactosidase activity, cell pellets were suspended in 1 ml Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4 and 50 mM ß-mercaptoethanol, pH 7.0) and were lysed by the addition of 20 µl toluene followed by vigorous vortexing for 15 seconds. Lysates were warmed to 30°C and the reaction was initiated by the addition of 200 µl 4.0 mg/ml o-nitrophenyl-ß-D-galactoside in Z buffer. After development, the reaction was terminated by addition of 0.5 ml 1 M Na2CO3. Cell debris was removed by centrifugation, the absorbance at 420 nm was recorded, and Miller units were calculated as (1,000 x A420)/(reaction time in minutes x OD600) (4).
Chemical analysis and quantification of nonpeptidoglycan surface D-alanine.
Ester-linked D-alanine was isolated from bacterial cell walls essentially as described in (14); 4-ml broth cultures of B. anthracis 34F2 or DLTd were grown to early stationary phase (OD600
1.5) in BHI at 39°C and back-diluted into 400 ml fresh BHI in 1-liter baffled flasks. Cultures were incubated at 39°C, 300 rpm and growth was monitored by recording the optical densities of the cultures at 600 nm. Cells were harvested by centrifugation from 50-ml (lag phase and early logarithmic growth phase) or 15-ml (middle logarithmic to stationary phase) aliquots each hour after inoculation. Pellets were stored at 80°C prior to analysis. After thawing to room temperature, cells were washed three times with 1 ml 0.1 M morpholineethanesulfonic acid (MES), pH 6.0. After washing, cells were boiled in 0.5 ml 0.2% sodium dodecyl sulfate, 0.1 M MES, pH 6.0, for 15 min. Cell wall material was collected by centrifugation and washed four times with 0.5 ml 0.1 M MES, pH 6.0, and then dried in a tabletop vacuum centrifuge heated to 50°C and weighed.
Ester-linked (nonpeptidoglycan) D-alanine was released from the cell wall material by suspending the dried pellet in 0.5 ml sodium pyrophosphate, pH 8.3 and incubation at 60°C for 3 h. The insoluble material was then removed by centrifugation and discarded and 0.1 ml of the supernatant was combined with 0.25 ml assay reagent (4 vol 0.1 M sodium pyrophosphate, pH 8.3, 2 vol 0.2 mg/ml flavin adenine dinucleotide in 0.1 M sodium pyrophosphate, 1 vol 50 mg/ml horseradish peroxidase (200 units/mg), 1 vol 5 mg/ml dianisidine sulfate, and 0.1 vol 5 mg/ml D-amino acid oxidase (15 units/mg)). The reaction was allowed to proceed for 15 min at 37°C after which it was terminated by the addition of 1 ml 0.1% sodium dodecyl sulfate. The absorbance at 460 nm for the supernatant was recorded and compared with a standard curve to determine the total amount of D-alanine present, which was related to the dry weight of the cell wall material from each preparation.
Analysis of MICs of antibacterial peptides.
Nisin and gramicidin D were purchased from INC Biomedicals. All other reagents tested were purchased from Sigma. Broth cultures of B. anthracis 34F2 or DLTd were grown to late log phase (OD600
1.2) in BHI at 39°C and back-diluted at a ratio of 1:100 into individual wells of a microtiter plate containing 200 µl fresh medium with increasing concentrations of antibacterial compounds and a constant concentration of IPTG. In order to determine if resistance levels were determined by dltABCD expression levels, the concentration of IPTG was varied independently from the antibacterial in parallel experiments. Plates were incubated at 39°C with gentle shaking for 16 h and the optical densities of the cultures at 600 nm were recorded. The MIC was determined to be the lowest concentration of compound that prevented bacterial growth.
Susceptibilities to innate immune mediators. Lysozyme, sPLA2, and recombinant human defensins were purchased from Sigma. Approximately 106 endospores were heat activated by incubation at 65°C for 20 min, then allowed to cool to room temperature prior to germination in 1 ml BHI. After a 30 min incubation at 37°C, cells were centrifuged and washed twice with fresh buffer. After washing, cells were suspended in either buffer alone or buffer containing 500 µg/ml lysozyme, 100 units/ml sPLA2 (1 µmol of phosphatidylcholine hydrolyzed per unit per minute), 25 µg/ml HNP-1 or HNP-2, or 5 µg/ml ß-defensin-1 or ß-defensin-2. For lysozyme and sPLA2 treatment, the buffer used was phosphate-buffered saline with 1 mM CaCl2, pH 7. Due to the salt sensitivity of defensins, 1 mM HEPES, pH 7, was used in those cases. Cell suspensions were incubated for 30 min at 37°C and susceptibility to the tested compound was assessed by enumeration of viable CFU on BHI agar plates and is presented as the percentage of viable CFU for each exposure compared to buffer alone.
Quantification of macrophage survival. RAW 264.7 cells (ATCC TIB 71), murine peritoneal macrophages transformed by Abelson murine leukemia virus, were maintained in Dulbecco's minimal essential medium (DMEM) supplemented with 10% fetal bovine serum (Gibco BRL). Cells were incubated at 37°C with an atmosphere of 5% CO2 and saturating humidity. Intracellular viability in RAW cells was monitored by using cell monolayers grown on glass coverslips and placed in a 24 well plate at approximately 4 x 105 cells per well overnight (33). The following day medium was removed by aspiration and replaced with DMEM and 10% horse serum.
For complementation of the mutant phenotype, 100 mM IPTG was added to the medium. B. anthracis 34F2 or DLTd endospores, at a multiplicity of infection of approximately 10:1, were placed on the monolayers and spun for 5 min in a Sorvall RT 6000D at 1,000 rpm. After 30 min of infection, monolayers were washed three times with 37°C phosphate-buffered saline followed by the addition of 0.5 ml of 37°C medium. To quantitate bacterial intracellular survival, coverslips were removed at the indicated time points, cell monolayers were lysed by vortexing in sterile water, and CFU were determined by plating dilutions of cell lysates on BHI plates followed by overnight incubation at 39°C. Initial cell-associated CFU were counted similarly immediately following the wash step and the results from each time point was related to this value according to (CFU at Tn)/(CFU at T0) x 100%, where n is time postinfection in hours.
Surgical intratracheal inoculation of mice. Mice anesthetized by intraperitoneal injection of ketamine (2.5 mg/mouse) and xylazine (0.1 mg/mouse) were restrained on a small surgical board and a small incision was made through the skin over the trachea and the underlying tissue was separated. A 30-gauge needle was inserted into the trachea, and a 30 µl inoculum of B. anthracis 34F2 or DLTd endospores suspended in deionized, distilled water was dispensed into the lungs. Following inoculation, the skin was closed with cyanoacrylate adhesive. Aliquots of the inoculum were plated to monitor the number of CFU delivered. For analysis of plasmid maintenance during infection, CFU were collected from mice that succumbed to disease by surgical removal of lung and spleen tissue followed mechanical disruption and plating on BHI agar plates at 39°C. 100 µg/ml trimethoprim was added to prevent contamination by extraneous bacteria but kanamycin was not added at this time. After 24 h, single colonies were transferred to fresh plates containing kanamycin selection and growth was monitored for an additional 24 h at 39°C.
|
|
|---|
In order to initially characterize this locus, the B. anthracis operon was targeted for temperature-dependent, plasmid-insertion mutagenesis as described in (9). This approach results in (i) Pdlt being separated from the coding region of the operon creating a protein-null strain, (ii) a lacZ reporter gene, encoding ß-galactosidase, placed downstream of Pdlt for determination of promoter expression levels, and (iii) the intact coding regions of dltABCD placed under the control of the inducible Pspac promoter, allowing complementation studies without further genetic manipulation (Fig. 1). The mutant chromosomal structure was verified by extensive PCR analysis as described (9), which was shown to be the most accurate method for detection of any rare plasmid excision events.
In addition to the phenotypes detailed below, the resulting mutant strain exhibited morphological defects that included a high frequency of abnormally long cells when grown on BHI agar plates (not shown). In BHI broth, germination, outgrowth and vegetative growth of the DLTd mutant and the parental strain were indistinguishable and elongated cells could not be found, however the mutant was incapable of growth in modified G medium without induction of dltABCD by the addition of IPTG. Enumeration of vegetative cells or endospores on modified G medium agar plates resulted in a 3 or 4 log decrease, respectively, in the viable CFU count compared to BHI or modified G medium plates supplemented with IPTG. The nature of this defect is unknown. However, the observation that growth could not be restored by addition of glucose suggests that the defect is not merely the result of an inability to grow in a nutrient poor medium. It has been reported that dltABCD plays a role in cation homeostasis (22). Therefore, it is likely that dltABCD is required for B. anthracis survival in high concentrations of cations, including magnesium, manganese, zinc and calcium found in modified G medium (17).
Expression analysis of Pdlt. Integration of pNFd13 into the chromosome results in the replacement of the dltABCD open reading frames with the lacZ gene, encoding ß-galactosidase (Fig. 1) under the control of the wild-type dltABCD promoter region. In order to monitor native promoter activity, cell lysates were collected throughout the growth cycle and the level of ß-galactosidase was scored by a standard enzymatic assay. Expression levels and patterns from Pdlt did not vary significantly between growth in either BHI (irrespective of the addition of IPTG, not shown) or modified G medium supplemented with 4 mM IPTG (Fig. 2A). However, growth in BHI resulted in an extended stationary phase and asynchronous sporulation (not shown) whereas growth in IPTG supplemented modified G medium allowed the culture to rapidly and synchronously progress to sporulation, and is shown for this reason. This analysis shows that the dltABCD promoter is highly active during early logarithmic growth but diminishes during stationary phase and sporulation. This pattern of expression is similar to that observed for Pdlt in B. subtilis except that optimal expression of dltABCD was detected slightly later, during mid-logarithmic growth in that organism (24).
![]() View larger version (15K): [in a new window] |
FIG. 2. Expression analysis of the dltABCD operon of B. anthracis. To monitor expression during vegetative growth and sporulation (A), DLTd was grown in modified G medium with 4 mM IPTG. At 30-min intervals, the optical density of the culture was measured (line) and cells were harvest and analyzed for ß-galactosidase activity (4) (columns). For analysis during germination and outgrowth (B), dormant DLTd endospores were suspended to an OD600 of 0.25 in BHI (gray) or BHI plus 200 µg/ml chloramphenicol (black). The suspension was incubated at 37°C for either 30 or 60 min prior to analysis of ß-galactosidase activity (gray). Results are an average from the analysis of two independent endospore preparations, each assayed in triplicate, with error bars representing one standard deviation from the mean.
|
D-Alanine incorporation into the surface. In order to determine if mutation of dltABCD affected the incorporation of D-alanine into the cell surface, ester-linked D-alanine was isolated and quantified from partially purified cell walls from B. anthracis 34F2 and DLTd. The alkaline hydrolysis method used releases only ester-linked D-alanine, not the D-alanine present in peptidoglycan cross-linkages (14). D-Alanine was found to be associated with purified cell walls from B. anthracis 34F2 (Fig. 3), however cell walls from the DLTd mutant were devoid of ester-linked D-alanine. As a control, expression of dltABCD in the mutant, induced by addition of IPTG, rescued ester-linked D-alanine incorporation into the cell wall extracts to levels surpassing even those of the parental strain. Collectively, these data indicate a strict relationship between the expression of the dltABCD operon of B. anthracis and the presence of ester-linked D-alanine in the cell wall.
![]() View larger version (14K): [in a new window] |
FIG. 3. Analysis of cell wall-associated D-alanine. Cells were grown in BHI broth alone or with 16 mM IPTG. The OD600 of the culture was recorded (line) and cells were harvested and analyzed for cell wall-associated D-alanine (columns). The growth rates of B. anthracis 34F2 or DLTd were indistinguishable in BHI with or without IPTG, and thus a single curve is shown for clarity. Addition of IPTG to 34F2 had no impact on D-alanine levels. Columns: 34F2, black; DLTd without IPTG, gray; DLTd with IPTG, white. Results are the averages of two independent experiments performed in triplicate with error bars representing one standard deviation from the mean.
|
|
View this table: [in a new window] |
TABLE 1. Minimal growth-inhibitory concentration of various antibacterial compounds against B. anthracis 34F2 and DLTd
|
![]() View larger version (8K): [in a new window] |
FIG. 4. Resistance to the cationic peptide nisin is determined by the level of dltABCD expression. Late-exponential-phase cells of B. anthracis 34F2 (black square) or DLTd (gray circle) were back-diluted 1:100 into fresh BHI containing serial dilutions of nisin and the indicated concentration of IPTG. Cultures were incubated 16 h at 39°C at which time the MIC of nisin was determined by measuring the OD600. The assay was repeated four times with identical results.
|
Contribution of the dltABCD operon to innate immune resistance. Since dltABCD expression is part of the outgrowth program of B. anthracis, we investigated its requirement for resistance to innate immune mediators during outgrowth (Fig. 5). Secretory phospholipase A and lysozyme are two major enzymatic components of the mammalian innate immune system, while defensins are cationic peptides produced by professional phagocytes (HNP-1 and HNP-2) or epithelial cells (ß-defensin-1 and ß-defensin-2) (12). When outgrowing endospores of the parental B. anthracis strain were exposed to lysozyme and ß-defensin-1, no reduction in CFU was detected. This strain was found to be slightly susceptible to sPLA2 and HNP-1 (25 and 18% killing, respectively), and moderately susceptible to HNP-2 and ß-defensin-2 (42 and 40% killing, respectively). In contrast, the DLTd mutant exhibits increased sensitivity to each of the mediators tested with the exception of ß-defensin-1. This exception is consistent with previous studies which have also found ß-defensin-1 to be, in general, the least microbicidal of those tested in vitro (8, 23).
![]() View larger version (15K): [in a new window] |
FIG. 5. Resistance to innate immune mediators requires dltABCD. We germinated 106 endospores of B. anthracis 34F2 (black) or DLTd (gray) in BHI broth for 30 min at 37°C, washed them twice in buffer, and suspended them in buffer containing the indicated enzyme or peptide. After a 30-min incubation at 37°C, survival was calculated by enumerating the number of viable CFU after 24 h of growth on BHI agar plates. Percent survival was calculated against a buffer only control and results are triplicate averages of two different experiments with error bars representing one standard deviation.
|
Contribution of dltABCD operon to B. anthracis macrophage growth and survival. Upon inhalation, B anthracis endospores are taken up by resident phagocytic cells (28, 11). In order to analyze the role of D-alanine in resistance to the microbicidal effects of the phagocyte, the DLTd mutant was compared to its isogenic parent in an in vitro infection of the RAW 264.7 murine macrophage-like cell line. Cell monolayers were infected with endospores, washed, harvested and plated for CFU at specified time points. Under microscopic observation, endospores for both strains appeared to be intimately associated with the RAW267.4 cells to virtually identical degrees (not shown).
Bacterial survival in macrophages was scored over time as described in materials and Methods. Macrophage bactericidal activity resulted in a decrease in viable CFU of 16.1% in 2 h and 48.6% in 5 h for parental B. anthracis 34F2 (Fig. 6). Cell-mediated killing appears exacerbated by inactivation of the dltABCD locus since detectable CFU decreased more rapidly during infection with the DLTd strain (40.8% killing after 2 h and 83.4% after 5 h). IPTG-induced activation of dltABCD transcription in the mutant results in partial restoration of the parental phenotype (25.8% killing in 2 h and 68.8% killing in 5 h). Although enumerated CFU typically depends on both macrophage-mediated killing and bacterial growth, bacterial replication is seldom seen prior to 3 h postinoculation under the conditions tested (5, 6), presumably due to the temporal requirements for completion of germination and outgrowth prior to the resumption of the vegetative life cycle. Thus, at least for the initial time point, the observed decrease in CFU represents macrophage-mediated killing of B. anthracis cells undergoing germination and outgrowth and loss of dltABCD results in hyper-sensitivity to this killing.
![]() View larger version (15K): [in a new window] |
FIG. 6. Intracellular survival of B. anthracis Sterne 34F2 and Dltd mutant in a RAW 264.7 murine macrophage-like cell line. Cells were seeded in a monolayer overnight and infected with parental (black squares) or DLTd (gray circles) endospores as described in the text at a multiplicity of infection of 10:1. For complementation of the mutant, 100 mM IPTG was added at the time of infection (open circles). Viable CFU were counted at the indicated time points and results are presented as the percentage of initial cell-associated CFU detected in each case. Results are the averages of three independent experiments with error bars representing one standard deviation.
|
![]() View larger version (8K): [in a new window] |
FIG. 7. Virulence in a mouse model of inhalational anthrax requires dltABCD. DBA/2J mice were intratracheally inoculated with 1.5 x 104 endospores of B. anthracis 34F2 (black) or DLTd (gray). Survival was monitored over 10 days and results are presented as the number of mice alive at the indicated time points postinfection.
|
|
|
|---|
During germination and outgrowth of bacterial endospores, the germ cell wall is deconstructed by dedicated autolysins (often referred to as spore lytic enzymes) and replaced by the de novo synthesis of the vegetative cell wall (26). In the case of B. anthracis endospore germination, this complex alteration takes place in the hostile environment of a host armed with a variety of antibacterial capabilities (13). This report is the first to demonstrate that the dltABCD locus of an endospore forming species is expressed immediately after germination, during outgrowth and before the first round of cellular division. In addition to showing that dltABCD expression is essential for resistance to cationic antimicrobial peptides and antibiotics during vegetative growth, as has been seen for a few other gram positive pathogens (1, 3, 19, 25), this study demonstrates that outgrowth-specific expression of dltABCD is required for resistance to peptide, enzymatic, and cellular mediators of innate immunity, presumably those seen by the bacteria early during anthrax infection.
The peptide (defensins) and enzymatic (lysozyme and secretory phospholipase) components tested each exhibit a predominantly cationic charge that is crucial to efficient antimicrobial activity (18, 22). Thus, it is likely that D-alanine esterification of an anionic cell wall component is crucial to proper modulation of the overall charge of the B. anthracis cell wall during the morphogenetic process of outgrowth. This modulation may be a general component of the outgrowth program common to all endospore forming bacteria. However, optimal expression of dltABCD occurs later during the growth cycle within B. subtilis (24) leaving the intriguing possibility that early expression of dltABCD may be a specific adaptation of B. anthracis to life in association with animal hosts.
In order to assess the importance of cell wall-associated D-alanine to B. anthracis disease establishment and progression, DBA/2J mice were challenged by a high dose (lethal dose 90 for the parental strain) of 34F2 or DLTd endospores. Mice given the mutant strain were more resistant to infection than those that received the parental strain. The observed decrease in mortality caused by the DLTd strain is most likely related to the role of the dltABCD operon during both outgrowth-specific cell wall remodeling and vegetative growth. The infection system used does not allow for measure of the relative contribution of each. However, our in vitro findings strongly suggest that attenuation is at least partially related to the role of dltABCD in protection against host immune mediators during outgrowth.
To our knowledge, this is the first study to correlate a mutation affecting B. anthracis endospore outgrowth with decreased virulence in an animal model of infection. Attenuating mutants of B. anthracis are rarely reported, aside from those affecting toxin and capsule production, and this also is generally true for the nonencapsulated Sterne model used in this study. Thus, additional attention to the dltABCD operon of B. anthracis is warranted. Important topics to be addressed include (i) identification of the D-alanine esterification target within the cell wall, since there are contradictory reports regarding the presence of teichoic acids in the very closely related B. cereus group of bacteria, to which B. anthracis belongs (15, 16, 20, 21, 29, 30, 32), (ii) discernment between the roles of dltABCD during outgrowth and vegetative growth in the context of infection, and (iii) analysis of mutation of dltABCD in a fully virulent, encapsulated strain in order to determine if, in the absence of ester-linked cell wall D-alanine, capsule can mediate resistance to peptide and enzymatic mediators of innate immunity.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»